ID: 1119085872

View in Genome Browser
Species Human (GRCh38)
Location 14:71738430-71738452
Sequence CCGGTGCCTGCATGTGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119085861_1119085872 28 Left 1119085861 14:71738379-71738401 CCATGAGAGCCCTTTCTAAGTAG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 151
1119085864_1119085872 18 Left 1119085864 14:71738389-71738411 CCTTTCTAAGTAGCATGGTAAAA 0: 1
1: 0
2: 25
3: 170
4: 601
Right 1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 151
1119085863_1119085872 19 Left 1119085863 14:71738388-71738410 CCCTTTCTAAGTAGCATGGTAAA 0: 1
1: 0
2: 1
3: 30
4: 167
Right 1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119085872 Original CRISPR CCGGTGCCTGCATGTGTTTG GGG Intronic
901668361 1:10839168-10839190 CAGGTGCGTGCAGGTGTGTGCGG + Intergenic
902173762 1:14633986-14634008 CTGGTGCCTACCTGTGTTTGAGG + Intronic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
905407114 1:37741339-37741361 CCGGTGCCTTCAGGGGATTGAGG + Intronic
906688405 1:47777286-47777308 CAGGGGCAAGCATGTGTTTGAGG - Intronic
907841168 1:58158815-58158837 CCTGTGCCTGCATTTGCTTTGGG - Intronic
910371921 1:86524947-86524969 CCCTTGCCTTCATGTGTATGTGG + Intergenic
917930974 1:179822595-179822617 CAGGTGCATGCAGGTGGTTGGGG - Intergenic
917961747 1:180151119-180151141 CCAGTGCCTCCCTGTGTTTCTGG + Intergenic
918385912 1:184007170-184007192 CCTGTGCCTTCATGAGCTTGGGG - Intronic
921522390 1:216172692-216172714 CTGATGCCTACATGTCTTTGGGG + Intronic
923732172 1:236562537-236562559 CCTATGCCTGCATGTGTTTCTGG + Intronic
1063114325 10:3063521-3063543 CGGGTGCCTGCATGGGTCTCTGG + Intergenic
1065734117 10:28735973-28735995 CCAGTGCCTACATGAGTGTGGGG - Intergenic
1067055093 10:43045459-43045481 CCAGGGCCTGCATCTGTGTGGGG + Intergenic
1067957461 10:50808104-50808126 CACATGCATGCATGTGTTTGTGG + Intronic
1069181336 10:65363269-65363291 GTGGTGCATGCATGTGGTTGAGG - Intergenic
1069510759 10:69040765-69040787 CCGCTGCCTCCATGTGTATCTGG + Intergenic
1070790429 10:79186055-79186077 CAGGTCCCTGGATGTTTTTGAGG + Intronic
1072564826 10:96608673-96608695 CAGGTGTATGCATGTGTCTGTGG - Intronic
1075654804 10:124153845-124153867 CCTGTGCCTGTATGTGTGAGTGG - Intergenic
1075654854 10:124154473-124154495 GGGGTGGCTGCATGTGTGTGTGG - Intergenic
1076700161 10:132267444-132267466 CGTGTGCATGCATGTGTATGTGG + Intronic
1076759474 10:132594638-132594660 GTGGTGCATGCATGTGTGTGGGG + Intronic
1077574413 11:3370645-3370667 CCTGTACCTGCCTGTTTTTGAGG - Intronic
1078655166 11:13231911-13231933 CAGGTGCATGCATGCTTTTGTGG + Intergenic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1080133102 11:28819501-28819523 CTGGTGCCAGCATCTGTTTCTGG + Intergenic
1082281366 11:50274464-50274486 CCTGTGCATGCATTTGTTTGGGG + Intergenic
1083185232 11:61013797-61013819 CATGTGCCTGCAAGTGTTGGGGG + Intronic
1084697814 11:70766545-70766567 CCAGGGCCTGGAGGTGTTTGAGG - Intronic
1085273844 11:75285760-75285782 AGGGTGCCTGCGTGTGTTGGGGG + Intronic
1085342779 11:75744300-75744322 CCTGTGCCCCCATGTGTCTGAGG + Intergenic
1089604482 11:119634032-119634054 CCTTGGACTGCATGTGTTTGGGG + Intronic
1089627355 11:119759971-119759993 CCCGTGCCACCATGTGTTGGAGG + Intergenic
1089709940 11:120307407-120307429 CCGGTGCCTTCATGGATCTGAGG - Intronic
1091315900 11:134613884-134613906 CCGGTCCCCGCATGGCTTTGTGG + Intergenic
1091721875 12:2819929-2819951 CCCGCCCCTGCCTGTGTTTGCGG - Intronic
1091889433 12:4041440-4041462 CCAGTGACTGCTTGAGTTTGGGG + Intergenic
1095945008 12:47748818-47748840 CCGGTTCCTGCCTGGGGTTGGGG + Exonic
1101809312 12:108093765-108093787 CCCCTGCCTGCACCTGTTTGGGG + Intergenic
1104954140 12:132456086-132456108 GTGGTGTCTGCATGTGTGTGTGG + Intergenic
1110575084 13:77046763-77046785 TCTGTGCCTGCATTTGTCTGAGG - Intronic
1111589225 13:90322522-90322544 TCAGTGCCTGGGTGTGTTTGAGG - Intergenic
1112909034 13:104459206-104459228 GGGGTACCTGCATGTGTTTTGGG - Intergenic
1113802620 13:113094449-113094471 CCGCTGTCTGCATCTGTCTGAGG - Intronic
1114564614 14:23621092-23621114 CTGGAGCCTGCTTGAGTTTGGGG + Intergenic
1114835257 14:26196357-26196379 CCTGTGCCTGCATGGGAATGTGG + Intergenic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1118683618 14:68269012-68269034 CCCCTGCCAGCATGTCTTTGGGG + Intronic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1121027412 14:90626776-90626798 CCGGGGCTGGCATGTGGTTGGGG - Intronic
1121944256 14:98104234-98104256 GGGGTGCATGCATCTGTTTGAGG - Intergenic
1125150546 15:36526444-36526466 TGGGTGCATGCATGTGTGTGTGG - Intergenic
1125241971 15:37586275-37586297 GGGGTGCCGTCATGTGTTTGGGG - Intergenic
1125502339 15:40247536-40247558 CCAGTGTCAGCTTGTGTTTGGGG + Intronic
1131972101 15:97903450-97903472 TCGGTGCCTGCAATTGGTTGGGG + Intergenic
1133113523 16:3563550-3563572 CCTGTCCCTGCAGGAGTTTGTGG - Exonic
1133916596 16:10114540-10114562 CCGGTGCCTGCGGGTTTCTGGGG - Intronic
1134863389 16:17582035-17582057 TGTGTGCATGCATGTGTTTGTGG + Intergenic
1141562229 16:84877228-84877250 CCACGGCCTGCATGTGTTGGCGG - Intronic
1142066259 16:88064733-88064755 CTGGTGCCTTCATGCGGTTGGGG + Intronic
1142679066 17:1534980-1535002 CCAGTGACTGCGTGTGTGTGCGG - Intronic
1142679081 17:1535057-1535079 CCAGTGACTGCGTGTGTGTGCGG - Intronic
1143405093 17:6671937-6671959 CCTGTGGCTGCTTGTCTTTGAGG + Intergenic
1145411783 17:22671795-22671817 CGGATGTCTGCATGTGTGTGTGG + Intergenic
1146179389 17:30687564-30687586 CGGGTGCCAGCATGTTTGTGGGG - Intergenic
1147177339 17:38664078-38664100 CTGTTGCCTGCGTGGGTTTGTGG - Intergenic
1147237080 17:39065878-39065900 CTGGAGCCTGCATGTGCCTGTGG - Exonic
1147257925 17:39193122-39193144 CGCGTGCCTGCATGTGTGTTGGG - Intronic
1151328404 17:73392723-73392745 CCGGTTCCTGCAAATGTCTGTGG + Intronic
1151365906 17:73616357-73616379 CCTGAGCCTGCATGTGTGTGTGG - Intronic
1152521597 17:80859751-80859773 CTTGTGCGTGCATGTGTGTGTGG + Intronic
1152819903 17:82432216-82432238 CAGGTCCCTGCACGTGTGTGTGG + Intronic
1152885110 17:82845059-82845081 CCGGTGCCAGTGTGTGTTGGGGG + Intronic
1152888205 17:82864912-82864934 CGGGGGCCTGCTTGTGTTGGGGG + Intronic
1155938552 18:31779735-31779757 CGGGTGCAGGTATGTGTTTGTGG - Intergenic
1156373416 18:36491142-36491164 CCTGGGGCTGCATGTGTTTGCGG + Intronic
1157544818 18:48539935-48539957 CCGGTGACTGATTGTGTCTGTGG + Intronic
1160037135 18:75311562-75311584 CAGGTGCCTGCATGAGTTTCTGG - Intergenic
1160934167 19:1585350-1585372 CCAGGGCCTGCCTGGGTTTGGGG - Intronic
1161264694 19:3358894-3358916 CCGGTGACTGCAGGTGTCCGGGG - Intergenic
1161688457 19:5716309-5716331 CTGGTGCCTGCAAAAGTTTGAGG - Intronic
1165064630 19:33221761-33221783 CCGGCTCCTGCAGGGGTTTGTGG - Intronic
1165342426 19:35222592-35222614 CCTGTGCCTGCAACTGCTTGGGG + Intergenic
1165771642 19:38383919-38383941 CCTGAGCCAGCATGTGATTGAGG + Intergenic
925092946 2:1169645-1169667 CCGGAGCCTGCAGGTTTTAGTGG - Intronic
932791636 2:74658593-74658615 CCCAAGCCTGCCTGTGTTTGAGG - Intronic
937297438 2:120818090-120818112 CCTGTGCCTGCATCTGGTTGAGG + Intronic
938695882 2:133835165-133835187 CAGGTGCCTGCCTGTGGTTAGGG + Intergenic
938943234 2:136187697-136187719 CAGGTGTGTGTATGTGTTTGAGG + Intergenic
942370106 2:175274963-175274985 CAGGTGGCTGCATGTGTTTTTGG + Intergenic
944886961 2:204072803-204072825 CCGGCACCTGCATCTCTTTGGGG - Intergenic
945103168 2:206282364-206282386 CCGGTGGCTGCATGGATGTGGGG + Intronic
948460841 2:238129229-238129251 CAGGTGCCGGCAGGTGTGTGGGG + Intronic
948638028 2:239352783-239352805 CCGGTACTTGTATGTGTTGGTGG - Exonic
948653874 2:239464975-239464997 CCGGTGCCTGCCACTGTCTGGGG + Intergenic
1168908094 20:1422979-1423001 CCGATGCCTGCATGTGCTATGGG + Intergenic
1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG + Intronic
1170639686 20:18140452-18140474 CCAGGGCCTGCGTATGTTTGTGG - Intronic
1171299620 20:24048881-24048903 CATGTGCATGCATGTGTGTGTGG - Intergenic
1172783803 20:37452561-37452583 CAGGCACATGCATGTGTTTGGGG + Intergenic
1174361519 20:50031805-50031827 CAGGTGCCTGGACGTGTGTGTGG + Intergenic
1174371865 20:50095683-50095705 CCTGTGTCTGCTTGTGTTTAAGG - Intronic
1175105255 20:56610422-56610444 CCAGGGTCTGCATGTGTCTGTGG - Intergenic
1175115041 20:56676173-56676195 CCGGTGGCCCCAGGTGTTTGTGG - Intergenic
1176288503 21:5032141-5032163 CCTGTGCCTGCTTGTGGTCGTGG + Exonic
1178803071 21:35815161-35815183 CCAGGGCCTGCAGGAGTTTGTGG - Intronic
1179008486 21:37534713-37534735 ATGATGCCTGCATTTGTTTGAGG + Intergenic
1179868680 21:44231334-44231356 CCTGTGCCTGCTTGTGGTCGTGG - Exonic
1180193792 21:46181894-46181916 CCCGTTCCTGCATGTGATTTGGG - Intronic
1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG + Intergenic
950021519 3:9791271-9791293 CCGGCGCCTGCGTGTGCTTGAGG - Exonic
950787627 3:15449579-15449601 CCCAGGCCTGCATGTGTTTCAGG + Intronic
953909681 3:46885511-46885533 CCTGTGCCTCTATGTGTGTGTGG + Intronic
954205388 3:49055275-49055297 CCTGAGCATGCATATGTTTGTGG - Intronic
955357261 3:58241361-58241383 CCTGTGGCTGGATGGGTTTGGGG + Intronic
957819435 3:85351662-85351684 CAGCTGCCTGCAAGTGTTTCTGG + Intronic
958167339 3:89893508-89893530 CTGGTTACTGCATGTGATTGGGG + Intergenic
958558916 3:95717983-95718005 CCAGTGCCTGCCTGTATTTGGGG - Intergenic
965670518 3:171143134-171143156 CAGATGCCTCCATGTGTTAGCGG - Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
975031427 4:69622803-69622825 CCGCTGGATGAATGTGTTTGAGG - Intronic
983995409 4:174175946-174175968 CCGGGCCCTGCATGGGGTTGAGG - Intergenic
985564088 5:606634-606656 CCGGCCCCTGCATGTGTTCAGGG + Intergenic
985624711 5:979232-979254 CATGTGCATGCGTGTGTTTGCGG - Intergenic
985786442 5:1897809-1897831 CTGGTGCCTGCCTGTGCCTGAGG + Intergenic
993620247 5:90159960-90159982 CTGGTGCCTTCATGTGGTTGGGG - Intergenic
994449544 5:99924622-99924644 ACTATGCCTGGATGTGTTTGTGG + Intergenic
997732179 5:136189756-136189778 CCAGTCCTTGCATTTGTTTGTGG + Intergenic
1006297987 6:33178526-33178548 TCGGTGTCTGCCTGTGTTGGGGG - Intronic
1006880094 6:37331767-37331789 CAGGTGTCTGCATGTGTGTGTGG + Exonic
1008962120 6:57276763-57276785 GTGGTGCATGCATGTATTTGGGG + Intergenic
1013126795 6:107191965-107191987 AGGGAGGCTGCATGTGTTTGGGG + Intronic
1018172797 6:161155025-161155047 CCGCTGCCAGCATGTCCTTGAGG + Intronic
1019352440 7:561196-561218 CCTGTGTGTGCATGTGTGTGGGG - Intronic
1019561615 7:1662126-1662148 CAGTTGCCTGAGTGTGTTTGGGG - Intergenic
1020022525 7:4877734-4877756 CCGGTGCTTTCGGGTGTTTGGGG - Exonic
1020998807 7:15301090-15301112 TCAGTGATTGCATGTGTTTGTGG + Intronic
1022993921 7:35734160-35734182 CCGGTGCTCCCATGAGTTTGAGG - Intergenic
1024035691 7:45505977-45505999 CCCATGCCTCCATGTGGTTGGGG - Intergenic
1026051698 7:66952476-66952498 GCAGTCCCTGCCTGTGTTTGGGG + Intronic
1028490268 7:91403689-91403711 CAGGTGCCAGCATGTGGATGGGG + Intergenic
1032011260 7:128349697-128349719 CTGGTGGTTGGATGTGTTTGTGG + Intergenic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG + Intergenic
1039610917 8:38918714-38918736 CATGTGTCTGCATGTGTATGAGG - Intronic
1046769120 8:118100882-118100904 CTGGGGCTTGCATGTGTGTGGGG - Intronic
1047254699 8:123206690-123206712 CAGGGGCCAGAATGTGTTTGCGG - Intronic
1049450884 8:142660862-142660884 CCAGTGGCTGGATGTGCTTGTGG - Intronic
1049813435 8:144586657-144586679 CCGGTGCCTGGAAGTGGGTGTGG - Intronic
1056000102 9:82206258-82206280 CCAGTGCCTGCATATCTTTTGGG + Intergenic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057493261 9:95539486-95539508 CGGGGGTCTGTATGTGTTTGTGG + Intergenic
1058983971 9:110195073-110195095 CCTGTGTGTGCATGTGTGTGTGG - Intronic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1189099819 X:38177090-38177112 TCTGTGCATGCATGTGTTTTAGG + Intronic
1192866403 X:75137569-75137591 CACATGCCTGCATATGTTTGTGG + Intronic
1193865475 X:86725787-86725809 CTGGTGCCTGCAATTGGTTGTGG + Intronic
1197631695 X:128868563-128868585 CCTGTCCCTGCATCTGTTTAAGG - Intergenic
1197886191 X:131220768-131220790 TCCGTGCATGCATGTGTGTGTGG - Intergenic
1199737858 X:150701625-150701647 CCAGAGCCTGTATGTGTTAGAGG - Intronic
1200918369 Y:8591242-8591264 TTGATGTCTGCATGTGTTTGTGG + Intergenic
1200963089 Y:9012706-9012728 CGGATGTCTGCATGTGTGTGTGG + Intergenic
1202056479 Y:20837782-20837804 CCTGTGCTTGCATGTTTTTGTGG - Intergenic