ID: 1119092933

View in Genome Browser
Species Human (GRCh38)
Location 14:71801416-71801438
Sequence CTGTGGGATGGGATGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119092933_1119092940 -9 Left 1119092933 14:71801416-71801438 CCATCCCCCATCCCATCCCACAG No data
Right 1119092940 14:71801430-71801452 ATCCCACAGCCTTCCCTCCCTGG No data
1119092933_1119092941 -8 Left 1119092933 14:71801416-71801438 CCATCCCCCATCCCATCCCACAG No data
Right 1119092941 14:71801431-71801453 TCCCACAGCCTTCCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119092933 Original CRISPR CTGTGGGATGGGATGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr