ID: 1119098908

View in Genome Browser
Species Human (GRCh38)
Location 14:71861396-71861418
Sequence CCACCTTACTTCTGCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119098906_1119098908 -10 Left 1119098906 14:71861383-71861405 CCACAATGTGTTACCACCTTACT No data
Right 1119098908 14:71861396-71861418 CCACCTTACTTCTGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119098908 Original CRISPR CCACCTTACTTCTGCAAAAT TGG Intergenic
No off target data available for this crispr