ID: 1119099148

View in Genome Browser
Species Human (GRCh38)
Location 14:71863981-71864003
Sequence CTTGTAAAGGACATGCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119099148_1119099152 10 Left 1119099148 14:71863981-71864003 CCTCTAAGCATGTCCTTTACAAG No data
Right 1119099152 14:71864014-71864036 TGCATATGCTTCTTTATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119099148 Original CRISPR CTTGTAAAGGACATGCTTAG AGG (reversed) Intergenic
No off target data available for this crispr