ID: 1119099722

View in Genome Browser
Species Human (GRCh38)
Location 14:71868768-71868790
Sequence CAGTAGGACGAGAGGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119099722_1119099740 19 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099740 14:71868810-71868832 CCGGGGCATTCCTAATGATGGGG No data
1119099722_1119099736 17 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099736 14:71868808-71868830 CCCCGGGGCATTCCTAATGATGG No data
1119099722_1119099738 18 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099738 14:71868809-71868831 CCCGGGGCATTCCTAATGATGGG No data
1119099722_1119099728 1 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099728 14:71868792-71868814 ACTTCTTCCACCCCCTCCCCGGG No data
1119099722_1119099729 2 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099729 14:71868793-71868815 CTTCTTCCACCCCCTCCCCGGGG No data
1119099722_1119099727 0 Left 1119099722 14:71868768-71868790 CCCCTTGGCCTCTCGTCCTACTG No data
Right 1119099727 14:71868791-71868813 CACTTCTTCCACCCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119099722 Original CRISPR CAGTAGGACGAGAGGCCAAG GGG (reversed) Intergenic
No off target data available for this crispr