ID: 1119102293

View in Genome Browser
Species Human (GRCh38)
Location 14:71891232-71891254
Sequence CTTCCCAAATTCCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119102293_1119102304 28 Left 1119102293 14:71891232-71891254 CCCAGGGCCAGGAATTTGGGAAG No data
Right 1119102304 14:71891283-71891305 CCTCTCCCTTAGTTGCCGTCAGG No data
1119102293_1119102300 -8 Left 1119102293 14:71891232-71891254 CCCAGGGCCAGGAATTTGGGAAG No data
Right 1119102300 14:71891247-71891269 TTGGGAAGGGCTCGACTGGGTGG No data
1119102293_1119102301 2 Left 1119102293 14:71891232-71891254 CCCAGGGCCAGGAATTTGGGAAG No data
Right 1119102301 14:71891257-71891279 CTCGACTGGGTGGTTCTCACTGG No data
1119102293_1119102302 3 Left 1119102293 14:71891232-71891254 CCCAGGGCCAGGAATTTGGGAAG No data
Right 1119102302 14:71891258-71891280 TCGACTGGGTGGTTCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119102293 Original CRISPR CTTCCCAAATTCCTGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr