ID: 1119103308

View in Genome Browser
Species Human (GRCh38)
Location 14:71900393-71900415
Sequence CTGGGAGACCAAAAGCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119103308_1119103309 -6 Left 1119103308 14:71900393-71900415 CCTACTGGCTTTTGGTCTCCCAG No data
Right 1119103309 14:71900410-71900432 TCCCAGATTCCTCTCATTTTCGG No data
1119103308_1119103315 30 Left 1119103308 14:71900393-71900415 CCTACTGGCTTTTGGTCTCCCAG No data
Right 1119103315 14:71900446-71900468 ATTCATCTTGTTTTTGTATGTGG No data
1119103308_1119103311 -5 Left 1119103308 14:71900393-71900415 CCTACTGGCTTTTGGTCTCCCAG No data
Right 1119103311 14:71900411-71900433 CCCAGATTCCTCTCATTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119103308 Original CRISPR CTGGGAGACCAAAAGCCAGT AGG (reversed) Intergenic
No off target data available for this crispr