ID: 1119105053

View in Genome Browser
Species Human (GRCh38)
Location 14:71915864-71915886
Sequence CCTTATAAGCAGAGGAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119105050_1119105053 -7 Left 1119105050 14:71915848-71915870 CCACTTTGACTGGTGTCCTTATA No data
Right 1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG No data
1119105049_1119105053 0 Left 1119105049 14:71915841-71915863 CCTTAATCCACTTTGACTGGTGT No data
Right 1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119105053 Original CRISPR CCTTATAAGCAGAGGAAATG TGG Intergenic
No off target data available for this crispr