ID: 1119109922

View in Genome Browser
Species Human (GRCh38)
Location 14:71961954-71961976
Sequence ATTCATTGACTATTAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119109922_1119109924 5 Left 1119109922 14:71961954-71961976 CCCAGCTTTAATAGTCAATGAAT 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1119109924 14:71961982-71962004 TAGAAAATCTTTACCTATGTAGG 0: 1
1: 0
2: 1
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119109922 Original CRISPR ATTCATTGACTATTAAAGCT GGG (reversed) Intronic
903503889 1:23818973-23818995 AAGCACTCACTATTAAAGCTAGG + Intronic
907436530 1:54453000-54453022 ACTCATTGACTTTGACAGCTTGG + Intergenic
910201771 1:84707442-84707464 ATTCTTTGACCACTAAAGTTTGG + Intergenic
910386536 1:86689410-86689432 ATTCTTTGATAATAAAAGCTTGG - Intergenic
910719543 1:90271090-90271112 ATTCATTGACCTTTATAGATAGG + Intergenic
910869710 1:91821973-91821995 GTTCATAGACTATTAGAGCTGGG - Intronic
912114926 1:106394278-106394300 GTTCATTTACTCATAAAGCTGGG - Intergenic
912367342 1:109145358-109145380 ATTCATTGAAATTTAAGGCTGGG + Intronic
913089019 1:115463610-115463632 ACTCATAGCCTATTAAAGCTTGG + Intergenic
916945520 1:169722342-169722364 ATTCACTGTCTTTTTAAGCTGGG - Intronic
917951554 1:180042813-180042835 ATTCATAGATTGTTATAGCTGGG + Intronic
918645625 1:186901242-186901264 ATGCATTCTCTATTAAAGCCAGG - Intronic
919265203 1:195254172-195254194 ATTCAAAGACAATAAAAGCTAGG + Intergenic
921499565 1:215884696-215884718 CCTCATTGACTTTTAAAGATGGG - Intronic
921567968 1:216743282-216743304 ATTCATTTGCTGTTAATGCTGGG + Intronic
921874173 1:220175547-220175569 ATTTAATGTCTCTTAAAGCTTGG + Intronic
922604829 1:226883449-226883471 ATTCATTAACCATTAAGTCTTGG + Intronic
1062776985 10:159190-159212 ATTGATTTACTATTACAGATAGG + Intronic
1065001301 10:21339873-21339895 TTTCATTGACTATTATATCTTGG - Intergenic
1065684804 10:28273607-28273629 ATTCAGAGACTATAAAAGCAAGG + Intronic
1066225910 10:33383213-33383235 ATTTGTAGACTATTAAGGCTGGG - Intergenic
1066508465 10:36068534-36068556 ATTAATTAAGTTTTAAAGCTGGG - Intergenic
1075652799 10:124140251-124140273 ATTGATTGACTATTTACCCTGGG + Intergenic
1079426650 11:20349261-20349283 CTTGTTTGACTAGTAAAGCTAGG - Intergenic
1079725121 11:23870948-23870970 ATGAATTGACTATTAAATGTCGG - Intergenic
1081099185 11:38981032-38981054 ATTCATTGACTGTACAAGCAAGG - Intergenic
1081420180 11:42866941-42866963 ATTCATTCACTCTTAATGCTTGG + Intergenic
1081559359 11:44198693-44198715 ATTTATAGCCTATTAAAGCCAGG + Intronic
1084095825 11:66910632-66910654 ATTCTTTGACAATTAACTCTGGG - Intronic
1085197745 11:74682699-74682721 ATTCAATGACTATAGAAGCCAGG + Intergenic
1091388596 12:111226-111248 ATTCACAGAAAATTAAAGCTTGG + Intronic
1093547100 12:20361240-20361262 ATTCATTAATTATTAAGGATTGG + Intergenic
1093949116 12:25144186-25144208 ATTAATTGACTATTAATGGAAGG + Intronic
1095274819 12:40268354-40268376 ATACATTCAATATTTAAGCTTGG - Intronic
1097788891 12:63792780-63792802 ATTAAATGACTAGTAAAGATGGG + Intronic
1098272889 12:68786076-68786098 ATTCATTTACTTTTAGAGATAGG - Intronic
1098425587 12:70362481-70362503 AATTATTTACTACTAAAGCTGGG + Intergenic
1098965853 12:76787482-76787504 ATACATTGACTATTAAAAAATGG + Intronic
1099059412 12:77887599-77887621 ATTTATTTTCTATTAAATCTTGG - Intronic
1099453906 12:82841267-82841289 ATTTCTTGATTATTAAAGTTTGG + Intronic
1100338350 12:93654629-93654651 ATTCATTAATTATTAAGGCAGGG + Intergenic
1103430373 12:120879716-120879738 ACTCATTAACTATAAAATCTTGG + Intronic
1105630415 13:22158028-22158050 ATTGTTTCACTATTAAAGATGGG - Intergenic
1106169754 13:27279071-27279093 ATTTATTTATTTTTAAAGCTGGG - Intergenic
1108784054 13:53872928-53872950 GTTTATTCACTAGTAAAGCTAGG + Intergenic
1109261106 13:60145811-60145833 ATTTATAGATTTTTAAAGCTGGG + Intronic
1109836645 13:67867224-67867246 ATTCAATGCCTATGAAATCTCGG + Intergenic
1110542533 13:76721971-76721993 ATTCATTGACTATCTGGGCTTGG - Intergenic
1112321465 13:98411648-98411670 ACCCATTGACTGTTAAAGCCAGG - Intronic
1112674222 13:101679586-101679608 ATTCACTGACTTTTTAAACTTGG + Intronic
1113221802 13:108112708-108112730 AATCATTGATTATTGTAGCTGGG + Intergenic
1114857214 14:26462990-26463012 GTTCTTTGACTATTAAAGATAGG + Intronic
1114988445 14:28260124-28260146 ATTCATTGCTTGTCAAAGCTAGG - Intergenic
1118091636 14:62487058-62487080 ATTGAATGACTATAAAAGATTGG + Intergenic
1119109922 14:71961954-71961976 ATTCATTGACTATTAAAGCTGGG - Intronic
1120707714 14:87761658-87761680 ACTCATTAAATCTTAAAGCTTGG - Intergenic
1125242754 15:37595208-37595230 ATACATTGAAAATTAAAGATGGG - Intergenic
1125447480 15:39773216-39773238 ATTGTTTGACTAATAAATCTTGG - Intronic
1126344781 15:47681660-47681682 AGTGATTGACTAATAAAGGTTGG - Intronic
1127830672 15:62748242-62748264 ATTAATTCACTATTTCAGCTCGG - Intronic
1127897018 15:63310051-63310073 ATTAATTGAGCATTAAAGCCAGG - Intergenic
1133382525 16:5343158-5343180 ATTCATTGGCTACTCAAGATGGG + Intergenic
1133726288 16:8540540-8540562 TTTCATTGACTATCCAACCTTGG - Intergenic
1138237413 16:55396440-55396462 AGTCAGTGATTATTAAAGTTGGG + Intronic
1138718976 16:59056662-59056684 GTTCATTGGCTATCAGAGCTTGG - Intergenic
1139797451 16:69495225-69495247 TTTCAGTGACTATAAAATCTTGG + Intergenic
1144218824 17:13081564-13081586 ATAAATTGACTACTAAAGCATGG + Intergenic
1145737583 17:27243821-27243843 GTTCTTGGACTTTTAAAGCTGGG + Intergenic
1146692848 17:34888476-34888498 ATTCAGTTGCTATTAAAGCAAGG - Intergenic
1150011006 17:61503548-61503570 GTTAATTTATTATTAAAGCTGGG - Intergenic
1153361746 18:4205651-4205673 TTTCATTGACATTTAAGGCTGGG - Intronic
1153601673 18:6786915-6786937 ATTCATTCACAATTGAAGTTGGG + Intronic
1155889710 18:31251848-31251870 ATTCATCTATTATTTAAGCTGGG - Intergenic
1158086347 18:53656156-53656178 AATCATTGACTTTGAAACCTGGG - Intergenic
1158604771 18:58885903-58885925 TTTCATAGCCTTTTAAAGCTGGG + Intronic
1159457422 18:68678375-68678397 GTTGATTGACAGTTAAAGCTGGG + Intronic
1164097655 19:22026068-22026090 ATATGTTGACTATTATAGCTAGG - Intergenic
1164200609 19:23015069-23015091 ATATGTTGACTATTATAGCTAGG - Intergenic
1165020264 19:32918630-32918652 ATTTAGTGACTGTTCAAGCTGGG - Intronic
928248797 2:29656311-29656333 ATTCATAGAATATTAGAGTTAGG - Intronic
929375420 2:41281139-41281161 ATTCATTCCATATTAAACCTAGG + Intergenic
929913948 2:46118008-46118030 TTTCATGGACTATTAGAGCTAGG - Intronic
931328522 2:61254040-61254062 AATCATTGATTTTTAAAGTTTGG - Intronic
932511033 2:72291112-72291134 TTTCTTTGTCTATAAAAGCTGGG - Intronic
933341372 2:81029972-81029994 ATTCATTCACCATTCAATCTTGG + Intergenic
939691341 2:145265373-145265395 TTTCATTGGCTATTTAAGTTTGG + Intergenic
939872826 2:147543826-147543848 ATTCATTAGCTATTCCAGCTTGG - Intergenic
940288633 2:152056590-152056612 ATTAATTGCCTAGCAAAGCTGGG - Intronic
941281714 2:163560153-163560175 ATCCTTTTACTGTTAAAGCTTGG - Intergenic
943328568 2:186531388-186531410 ATTATTTGACTGTGAAAGCTTGG - Intergenic
943589209 2:189777710-189777732 AATCATTCATTTTTAAAGCTGGG + Intronic
945238119 2:207651828-207651850 TTTCCTTGACTATTACAACTTGG - Intergenic
947074472 2:226327371-226327393 ATTCTTTGACAATTAAAAATGGG - Intergenic
947354745 2:229280489-229280511 ATTTATTTACTGTTAAAACTGGG - Intergenic
948093612 2:235316067-235316089 AATGATTGACTATTGAAGCAGGG - Intergenic
948347891 2:237314505-237314527 ATGCATTCACTATAAAACCTAGG + Intergenic
1170448734 20:16459206-16459228 ATTCATTGACTAATATAGAGAGG + Intronic
1173420374 20:42895876-42895898 ATTCAGTGACTGCTAAAACTGGG - Intronic
1173636323 20:44561756-44561778 ATTAAATGTATATTAAAGCTGGG - Intronic
1173743928 20:45421889-45421911 ATTCATAGACTCTTTAAGGTAGG + Intronic
1176969064 21:15244952-15244974 ATTTATTGAATTTTAAACCTTGG - Intergenic
1177846574 21:26295364-26295386 ATTCATTCATTCTTATAGCTGGG + Intergenic
1180929655 22:19580222-19580244 ATTCATTTACTATCAAAGTTGGG + Intergenic
1181411068 22:22720094-22720116 ATTCACTCACTAATAAAGATGGG + Intergenic
1183220244 22:36507354-36507376 ATTCATGGAATATGAGAGCTAGG - Intergenic
949972095 3:9416859-9416881 ATTGATTGTTGATTAAAGCTGGG + Intronic
952126463 3:30306287-30306309 ATTCATTGACTTTTAAGACAAGG + Intergenic
952747613 3:36795745-36795767 ATTCAATGACTAATCAAGATAGG + Intergenic
954794828 3:53156219-53156241 ATACATTTTCTATTAAAGCAAGG - Intronic
956276235 3:67504439-67504461 ATTCCGTGAGAATTAAAGCTGGG - Intronic
956394220 3:68807672-68807694 AATCACTGTCTATTAAAGTTAGG + Intronic
957389395 3:79543584-79543606 ATTGATTTACGATTAATGCTGGG + Intronic
958566177 3:95814012-95814034 ATTTATTGACTTTTTAACCTGGG - Intergenic
958576381 3:95953897-95953919 TTTCATTAACTATCAAAACTAGG + Intergenic
958784031 3:98577303-98577325 ATTCTTTGACTATTTCAGCAGGG + Intronic
960037199 3:113113879-113113901 ACTCAGAGACTCTTAAAGCTGGG - Intergenic
963740273 3:149072489-149072511 CTTAATTGACTATTTAAACTAGG + Intronic
964478757 3:157120956-157120978 ATTCAGTGACTAGTAAATTTTGG + Intergenic
965346220 3:167554354-167554376 ATTGATTGACTATAAAATTTGGG + Intronic
966754181 3:183353321-183353343 ATTCCTTCATTATTAAAGCACGG - Intronic
967354631 3:188554613-188554635 AGTCATAGACTATTAAACTTGGG - Intronic
968413900 4:411971-411993 ATTCATTTATTAATAAAACTTGG + Intergenic
969403277 4:6971319-6971341 ATTCCTTGACTAGTAACGCCGGG - Intronic
970857206 4:20662540-20662562 ATTCATTGATTTATAAGGCTTGG + Intergenic
971608763 4:28694203-28694225 ATTCACTAAATATTGAAGCTAGG - Intergenic
972702351 4:41506682-41506704 ATTAATTGACTATTAAGAATAGG + Intronic
972800232 4:42467389-42467411 AGTCATCCACTTTTAAAGCTTGG - Intronic
974466913 4:62269650-62269672 ATTAATTGGCTCTTAAAGCATGG + Intergenic
974960911 4:68698832-68698854 ATTAATGGAATATCAAAGCTTGG + Intergenic
978067492 4:104423206-104423228 AATAAATGACTATTAGAGCTAGG - Intergenic
980383090 4:132051405-132051427 ATTAATTTAGTATTAAAGTTTGG - Intergenic
980608052 4:135119535-135119557 ATTCATAGAATTTTTAAGCTAGG - Intergenic
982881648 4:160726397-160726419 GTTCAATGATTATCAAAGCTTGG - Intergenic
983444662 4:167834395-167834417 TTTTATTGGCTATTCAAGCTTGG + Intergenic
983654393 4:170067508-170067530 AATCACTGACTATATAAGCTAGG - Intronic
983657397 4:170097406-170097428 TTTCATTGACATTTAAAACTTGG - Intergenic
986922241 5:12700350-12700372 ATTCAGTGAAGATTAAAGTTTGG - Intergenic
990334609 5:54759832-54759854 ATTCATTGAATATTTAACATGGG + Intergenic
991273764 5:64818976-64818998 ATTAATTGACCATAAAACCTAGG - Intronic
992705520 5:79387414-79387436 ATTTATAGAAAATTAAAGCTGGG - Intronic
993689164 5:90977979-90978001 ATTCATTGATTAATAAACGTAGG - Intronic
997061013 5:130502955-130502977 ATTCATTAACTTTTAAAACTTGG - Intergenic
997093663 5:130886155-130886177 ATTCATTGAAGAATAAAGGTTGG - Intergenic
999874106 5:155783240-155783262 CTTCATACACTATTAAAGCTTGG + Intergenic
1000511152 5:162184804-162184826 ATTCATTCACTTTTATGGCTGGG + Intergenic
1000874785 5:166622753-166622775 ATTCATTAAGTATTACAGGTCGG + Intergenic
1000941521 5:167368209-167368231 TTTCATTTACTATTAGAACTAGG + Intronic
1003759418 6:9159888-9159910 TTACATTTACTATTATAGCTTGG + Intergenic
1004807281 6:19217421-19217443 ATTCATTGAGTATTAATCCATGG + Intergenic
1006870518 6:37247074-37247096 ATTCATTGCCAGTTTAAGCTGGG - Intronic
1008137327 6:47791992-47792014 ATTCCCTGACAGTTAAAGCTAGG + Intronic
1008391868 6:50961428-50961450 ATTTATTGACTATTAAAATGTGG - Intergenic
1010030907 6:71269601-71269623 ATTCATTAACTATTCTGGCTGGG + Intergenic
1010880748 6:81167365-81167387 AGGCATTGACTGTCAAAGCTAGG - Intergenic
1012519064 6:100098481-100098503 ATACATTCACTATTAAAGGCAGG - Intergenic
1012601395 6:101101941-101101963 ATTCATTGACTCTAAATGCGTGG + Intergenic
1012946551 6:105472377-105472399 ACTCACTGACTATTAAAACCAGG + Intergenic
1014106405 6:117568249-117568271 ATTAAATGACAATTATAGCTTGG - Intronic
1018667215 6:166149644-166149666 ATTCATTGACTTTTTATGTTGGG - Intergenic
1020690978 7:11354306-11354328 ATGCATTTACTATTATATCTTGG - Intergenic
1021447773 7:20751617-20751639 ATTCATGTACAATTTAAGCTAGG + Intronic
1022359009 7:29641783-29641805 ATTCATTGACTATTACAAGCTGG - Intergenic
1024021053 7:45370313-45370335 ATTCCTTGATTATTCAATCTTGG + Intergenic
1026128516 7:67600801-67600823 GCTCTTTGACTAATAAAGCTGGG - Intergenic
1027434136 7:78146308-78146330 ATTCATTCACTATTACTACTTGG + Intronic
1027666736 7:81049405-81049427 ATCCTTTGAGTCTTAAAGCTTGG + Intergenic
1027986969 7:85305368-85305390 GTTTATTGAAGATTAAAGCTTGG - Intergenic
1028089567 7:86681474-86681496 ATTCATTCCTTATTAATGCTAGG - Intronic
1028445660 7:90920452-90920474 CTTCATTGTCTCTTCAAGCTAGG + Intronic
1030088085 7:105834343-105834365 CATCATTGACTTTGAAAGCTTGG + Intronic
1030636994 7:111961420-111961442 ATTCACTCACTATGAAAGCATGG - Intronic
1032745916 7:134785893-134785915 ATTCATAGAATTTTTAAGCTGGG + Intronic
1034317546 7:150147280-150147302 ATTCATCCAATCTTAAAGCTAGG - Intergenic
1034569219 7:151941649-151941671 ATTCAAAGACTTTTACAGCTAGG + Intergenic
1034775208 7:153819946-153819968 ATTCATCCAATCTTAAAGCTAGG + Intergenic
1034857056 7:154560586-154560608 ATTAAGTGAATTTTAAAGCTGGG + Intronic
1035478586 7:159162715-159162737 CTTATTTGACTATTACAGCTAGG + Intergenic
1036799656 8:11780681-11780703 ATTCATAGATTATAAAAACTGGG - Intronic
1037175177 8:15938764-15938786 AATCAATGACTTTTAATGCTGGG - Intergenic
1039209239 8:35193291-35193313 ATCAATTGACTATTAATGCATGG + Intergenic
1040883135 8:52230227-52230249 ATTGTTTGACTATTGAAGATTGG - Intronic
1041365484 8:57099143-57099165 ATTGATTTATTATTAAAACTAGG - Intergenic
1041952436 8:63518605-63518627 TTTCTTTGACTATCAAAACTTGG + Intergenic
1042067969 8:64899792-64899814 CTTCATTTACTATTGAAGCTTGG + Intergenic
1042252892 8:66774662-66774684 ATTGATTAACAATTTAAGCTCGG + Intronic
1043658016 8:82697020-82697042 ATTCATTATTTCTTAAAGCTAGG - Intergenic
1045956087 8:107909553-107909575 ATTTATTGACCTTTAAAGCTGGG - Intronic
1046665060 8:116992406-116992428 ATTCTTTGCCTATTGAATCTTGG - Intronic
1046755271 8:117966546-117966568 TTTCTTTGACTTTTAAAGCCAGG + Intronic
1046903099 8:119543765-119543787 ATTCATTGACTTTTAAATGTTGG + Intergenic
1048613700 8:136051530-136051552 ATTGATTGATTATTAAAACATGG - Intergenic
1053289468 9:36870523-36870545 CTTCATTAACTATTAAATTTAGG - Intronic
1054976867 9:71157142-71157164 ATTCATTTTCTATTAATGTTTGG - Intronic
1057960536 9:99451954-99451976 AATCATAGACTTTTAGAGCTAGG + Intergenic
1059380430 9:113919363-113919385 ATTCATTAAATATTCAAGCGAGG - Intronic
1059851987 9:118352494-118352516 ATTAATTTACTATGAAAGCAGGG - Intergenic
1059916781 9:119112529-119112551 AAACATAGACTATTAAAGATAGG + Intergenic
1186048714 X:5565898-5565920 ATTTATTGAGTATGTAAGCTGGG + Intergenic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1187428674 X:19202315-19202337 GTTCATTGGCTTTGAAAGCTGGG + Intergenic
1188328401 X:28836606-28836628 TTTCATTGGCTATGAAAACTAGG - Intronic
1189040218 X:37534819-37534841 ATTCATTGGCTCATAAAGCCAGG - Intronic
1194037253 X:88891105-88891127 AGTCATTGACTAGAAAAGTTAGG + Intergenic
1195463250 X:105151618-105151640 TTTTATTGACTATTGAAGTTGGG + Intronic
1197238178 X:124091758-124091780 ATTCATTGCCTATCAGTGCTTGG + Intronic
1197931476 X:131700404-131700426 ATTCATTGATTATTAATTTTTGG + Intergenic
1200319372 X:155170583-155170605 CTTGATTGACTAGTAAACCTAGG + Intergenic
1202025153 Y:20513812-20513834 GTTCATTTACTATTAAAGAAAGG + Intergenic