ID: 1119110637

View in Genome Browser
Species Human (GRCh38)
Location 14:71970762-71970784
Sequence GTTCCCCATTTACCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119110637_1119110639 11 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110639 14:71970796-71970818 AGTGTTGGTAGAAGCAACTGAGG 0: 1
1: 0
2: 2
3: 15
4: 184
1119110637_1119110640 12 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110640 14:71970797-71970819 GTGTTGGTAGAAGCAACTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1119110637_1119110642 18 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110642 14:71970803-71970825 GTAGAAGCAACTGAGGGGCATGG 0: 1
1: 0
2: 2
3: 27
4: 284
1119110637_1119110645 25 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110645 14:71970810-71970832 CAACTGAGGGGCATGGGAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 384
1119110637_1119110643 19 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110643 14:71970804-71970826 TAGAAGCAACTGAGGGGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 174
1119110637_1119110638 -4 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110638 14:71970781-71970803 GAACTAGACAATTACAGTGTTGG 0: 1
1: 0
2: 1
3: 8
4: 106
1119110637_1119110644 22 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110644 14:71970807-71970829 AAGCAACTGAGGGGCATGGGAGG 0: 1
1: 0
2: 2
3: 34
4: 256
1119110637_1119110641 13 Left 1119110637 14:71970762-71970784 CCAGCTGGGGGTAAATGGGGAAC 0: 1
1: 0
2: 3
3: 10
4: 93
Right 1119110641 14:71970798-71970820 TGTTGGTAGAAGCAACTGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119110637 Original CRISPR GTTCCCCATTTACCCCCAGC TGG (reversed) Intronic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
901740642 1:11339575-11339597 GTTCCCCACCCAGCCCCAGCTGG - Intergenic
902570981 1:17346861-17346883 TTTCCCCCATCACCCCCAGCAGG + Intronic
904204203 1:28842223-28842245 GTTCGCCATATTGCCCCAGCTGG + Intronic
908179304 1:61588410-61588432 CTTCCCCATTAACTCCCAGAGGG + Intergenic
910034904 1:82777821-82777843 CTTCCCCATGTTCCCCCAGCTGG - Intergenic
910207697 1:84764523-84764545 CTTCCCCATTTCTCCCCAGCAGG - Intergenic
911030048 1:93478080-93478102 GTTCCCCATTTATCCCTAACTGG - Intronic
912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG + Intergenic
918093443 1:181316492-181316514 GTTCCCAATTTACCCCCAGAAGG - Intergenic
923281496 1:232447336-232447358 GTTGTCTATCTACCCCCAGCTGG + Intronic
1064373226 10:14772495-14772517 GATGCCCATTTACCCACATCAGG + Intronic
1067156392 10:43784507-43784529 TTTCCCCATCTACCCACACCTGG - Intergenic
1068670768 10:59720758-59720780 TCTCCCCATTTTCCCTCAGCAGG - Intronic
1073284545 10:102379831-102379853 ATTGCACATTTACCCCCACCAGG + Exonic
1073805756 10:107096034-107096056 ATTCCCCATTTCCATCCAGCTGG + Intronic
1074981954 10:118627006-118627028 GGGCCCCATTGACCTCCAGCTGG - Intergenic
1076741354 10:132487322-132487344 GTTCACGGTTTACCTCCAGCTGG + Intergenic
1078773764 11:14375267-14375289 GTTCCCCATTATTCTCCAGCTGG - Intergenic
1080314478 11:30934425-30934447 GCTCTCCATATACCCCAAGCTGG - Intronic
1084954817 11:72685555-72685577 GTTTCCCATGCACCCCCCGCTGG + Exonic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1091824110 12:3497135-3497157 GCTGCCCATTTTCCCCCTGCTGG - Intronic
1094671529 12:32574804-32574826 ATGCCTCATTTTCCCCCAGCTGG - Intronic
1100423607 12:94460579-94460601 GTTCCCCATGTGACCCCAGGTGG - Intergenic
1100855325 12:98752650-98752672 GATCCCCAGTTAGCCCCAGGAGG + Intronic
1100918481 12:99455284-99455306 TTTCCCCCTTTACTCTCAGCAGG - Intronic
1101963012 12:109264302-109264324 GCTCCCCATCTACCACCAGGTGG + Exonic
1102245525 12:111353363-111353385 GTTGCCCAATGGCCCCCAGCTGG - Intergenic
1113044975 13:106146051-106146073 GTTCCCCTTTCACCCTCAGGAGG - Intergenic
1114583162 14:23784182-23784204 ATTCCCCCTTTTCCCCCAGTTGG - Intergenic
1117673114 14:58127793-58127815 GCTCCCCATTTCCCGCTAGCTGG + Intronic
1119110637 14:71970762-71970784 GTTCCCCATTTACCCCCAGCTGG - Intronic
1120807182 14:88765370-88765392 GTTCCCCCTTGACAGCCAGCAGG - Intronic
1121753629 14:96382012-96382034 CTTCTCCACTTACCCCCAACAGG - Intronic
1121863825 14:97343810-97343832 CTTCCCCTTCTACCACCAGCTGG - Intergenic
1123978232 15:25573413-25573435 GTATCCCCTTTACCCTCAGCTGG + Intergenic
1126408617 15:48348966-48348988 GGTCTCCCTTTGCCCCCAGCAGG - Intergenic
1133957380 16:10456586-10456608 GTCTCCCATTTAGCCCCTGCCGG + Intronic
1137769658 16:51005801-51005823 GTTCCACAATTCCCTCCAGCTGG + Intergenic
1138010298 16:53373200-53373222 GTTCCAGACTCACCCCCAGCTGG + Intergenic
1138446793 16:57069814-57069836 GTTGCCCTTTGACCCCCACCAGG + Exonic
1142254281 16:89006499-89006521 GTTCCCCAGAGACCCCCACCTGG - Intergenic
1142596949 17:1034544-1034566 CTTCCCCAGTTGCCTCCAGCTGG - Intronic
1142625423 17:1188722-1188744 GTTCCCATCTCACCCCCAGCTGG + Intronic
1142945126 17:3420234-3420256 GTTACCCATTTTCCCCCTTCCGG + Intergenic
1143582706 17:7835952-7835974 GTTCCCCACCTCCCCCCAGCTGG + Intergenic
1145274709 17:21422598-21422620 GCTCCCCTTTCACCCACAGCTGG + Intergenic
1145312561 17:21708496-21708518 GCTCCCCTTTCACCCACAGCTGG + Intergenic
1146826697 17:36029262-36029284 GTGCCTCATTTACCACCATCTGG - Intergenic
1150257669 17:63761217-63761239 GTTTCCTACTTACCCTCAGCTGG + Exonic
1150270467 17:63861143-63861165 GTTCCCAATTTCCCCTCATCTGG - Intergenic
1150288282 17:63966288-63966310 GGTCCCTATCTGCCCCCAGCTGG - Intronic
1150971154 17:70029653-70029675 GTTCTCCATACTCCCCCAGCTGG - Intergenic
1151585500 17:75005942-75005964 GTTCACCATGTATCCCTAGCTGG - Intergenic
1153664241 18:7353973-7353995 GTTCCCCATATACATCCAGATGG - Intergenic
1157121711 18:44917611-44917633 CCTCCCCATCCACCCCCAGCAGG + Intronic
1158656323 18:59338714-59338736 GTGCCCCATTTACCCTTTGCTGG - Intronic
1164722967 19:30445479-30445501 GTTCCGCACTTACCACCAGGTGG + Exonic
1167636837 19:50660144-50660166 CTCCCCCCTTTACCCACAGCAGG + Intronic
938588947 2:132718992-132719014 GTTCAGACTTTACCCCCAGCAGG - Intronic
940728412 2:157361809-157361831 TTGCCCCTTTTACCCACAGCTGG - Intergenic
946110732 2:217413019-217413041 GTTCCTCAGTTAGCCCCAGCTGG - Intronic
948428741 2:237904908-237904930 GTCCCCCAGCTACCCCCGGCTGG - Intronic
948804505 2:240447647-240447669 GACCCCCTTTGACCCCCAGCAGG - Intronic
1170944353 20:20877461-20877483 TTTCACCATTTTCCCCAAGCTGG - Intergenic
1172205669 20:33161203-33161225 GCTCCGCATGTAACCCCAGCAGG + Intergenic
1179050290 21:37883404-37883426 TTACCCCTTTTAGCCCCAGCAGG + Intronic
1179531037 21:42019897-42019919 GTCCCTCATTTACCTCCTGCAGG + Intergenic
1179793933 21:43771445-43771467 GATCCCCGTTTACCCCCAGCAGG + Intergenic
1181864820 22:25846657-25846679 GTACCACATTTACATCCAGCTGG - Intronic
1184119598 22:42441299-42441321 GTCCCCCATTTCCTTCCAGCTGG + Intergenic
1184273956 22:43399872-43399894 GGTCCCCATGTGGCCCCAGCAGG + Intergenic
949891398 3:8736269-8736291 TTTCCCAATTTACCTCCACCAGG + Intronic
950454925 3:13087026-13087048 CTCCCTCATTCACCCCCAGCTGG + Intergenic
952685556 3:36143941-36143963 GTTGCCCATTCCCCTCCAGCTGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
964877859 3:161389808-161389830 GTTCCTCATTTACCAGCAGTGGG - Intergenic
965057811 3:163744527-163744549 GTGCCCCTTTGATCCCCAGCTGG + Intergenic
967453342 3:189651828-189651850 TTTCCCCTTTTAGCCACAGCTGG - Intronic
967732925 3:192922803-192922825 GTGCCCGATTTGCCCCAAGCAGG - Intergenic
977257307 4:94755451-94755473 GTACCCCATTTTCTCCCACCTGG + Intergenic
979927327 4:126583443-126583465 GTAACCCCTTTACCCCCTGCAGG + Intergenic
982343787 4:154333420-154333442 GTTCTCCATTCACCCGCGGCTGG - Exonic
984854823 4:184186012-184186034 GTTAGCAATTTACCCTCAGCTGG + Intronic
993594965 5:89842714-89842736 TTTCTCAATTTACCTCCAGCTGG + Intergenic
997884540 5:137618277-137618299 GCTCCCCATTTGCACCTAGCTGG - Exonic
1003071656 6:2949771-2949793 GCTCCCCATTTACTCGGAGCAGG + Intronic
1005583119 6:27251646-27251668 GTTCCCCACTTTCCCCTAGCGGG - Intronic
1005982424 6:30846483-30846505 CTTCCCCACCTACCCCCACCTGG - Intergenic
1015877120 6:137834026-137834048 GTTCCTCATTTACCTTCTGCCGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019689916 7:2404578-2404600 GTCCCCCACTTACCCCCACGCGG + Intronic
1021168473 7:17369430-17369452 TTTTCACATTTACCCTCAGCAGG + Intergenic
1036648993 8:10630158-10630180 GTCCTCCCTTGACCCCCAGCTGG + Intronic
1051770245 9:20569948-20569970 GCTCCTCATTTGCCCCCAGCTGG + Intronic
1052909989 9:33872196-33872218 GTTCCCCATGTTCCCCAGGCTGG - Intronic
1056228499 9:84520939-84520961 GTTGCCCATTTACCCTCACCAGG - Intergenic
1057126142 9:92617665-92617687 GTCCCCCGGTAACCCCCAGCGGG - Exonic
1060471617 9:123952638-123952660 GTTCCCCATTTACTCCCAGGGGG + Intergenic
1062554383 9:137107402-137107424 CTTCAACCTTTACCCCCAGCCGG + Exonic
1062713429 9:137989158-137989180 GTTCCCCCTTTACCCCTTGGAGG - Intronic
1190717976 X:53120229-53120251 TTTCGCCATGTTCCCCCAGCTGG + Intergenic
1195324542 X:103747574-103747596 GTACACCAATTACCCTCAGCAGG - Intergenic
1199609534 X:149600928-149600950 GTTGCCAAAGTACCCCCAGCAGG - Intronic
1199629582 X:149768426-149768448 GTTGCCAAAGTACCCCCAGCAGG + Intergenic