ID: 1119111872

View in Genome Browser
Species Human (GRCh38)
Location 14:71982306-71982328
Sequence AAAAATAAACAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3663
Summary {0: 1, 1: 1, 2: 15, 3: 358, 4: 3288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119111872_1119111876 -10 Left 1119111872 14:71982306-71982328 CCTCCCTCCTTCTGTTTATTTTT 0: 1
1: 1
2: 15
3: 358
4: 3288
Right 1119111876 14:71982319-71982341 GTTTATTTTTTATTAAGTTCTGG 0: 1
1: 1
2: 17
3: 429
4: 2618
1119111872_1119111878 26 Left 1119111872 14:71982306-71982328 CCTCCCTCCTTCTGTTTATTTTT 0: 1
1: 1
2: 15
3: 358
4: 3288
Right 1119111878 14:71982355-71982377 AATATAGAAGACATCATTTACGG 0: 1
1: 0
2: 2
3: 30
4: 363
1119111872_1119111877 -9 Left 1119111872 14:71982306-71982328 CCTCCCTCCTTCTGTTTATTTTT 0: 1
1: 1
2: 15
3: 358
4: 3288
Right 1119111877 14:71982320-71982342 TTTATTTTTTATTAAGTTCTGGG 0: 1
1: 9
2: 287
3: 1870
4: 10170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119111872 Original CRISPR AAAAATAAACAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr