ID: 1119114084

View in Genome Browser
Species Human (GRCh38)
Location 14:72002251-72002273
Sequence CCAAATGCTGATAAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119114080_1119114084 -8 Left 1119114080 14:72002236-72002258 CCCCAAGTAGGAAGTCCAAATGC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG 0: 1
1: 0
2: 2
3: 47
4: 378
1119114082_1119114084 -10 Left 1119114082 14:72002238-72002260 CCAAGTAGGAAGTCCAAATGCTG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG 0: 1
1: 0
2: 2
3: 47
4: 378
1119114076_1119114084 22 Left 1119114076 14:72002206-72002228 CCTCACTTTCTGCCTATTGAGAG 0: 1
1: 0
2: 0
3: 15
4: 220
Right 1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG 0: 1
1: 0
2: 2
3: 47
4: 378
1119114081_1119114084 -9 Left 1119114081 14:72002237-72002259 CCCAAGTAGGAAGTCCAAATGCT 0: 1
1: 0
2: 1
3: 22
4: 208
Right 1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG 0: 1
1: 0
2: 2
3: 47
4: 378
1119114078_1119114084 10 Left 1119114078 14:72002218-72002240 CCTATTGAGAGATAGGCACCCCA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG 0: 1
1: 0
2: 2
3: 47
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119114084 Original CRISPR CCAAATGCTGATAAAGAAAT TGG Intronic
901912684 1:12473303-12473325 CCCAGTTCTGAAAAAGAAATAGG + Intronic
902208783 1:14889820-14889842 CCAACTGCTCATAAATACATGGG - Intronic
903752860 1:25639316-25639338 CCAAATGATGACAAAGATGTTGG - Intronic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
905938383 1:41842842-41842864 CTAATTGCTGATGAAGAAAGAGG - Intronic
906185049 1:43855949-43855971 CAAACTGTTCATAAAGAAATAGG + Intronic
906863417 1:49388317-49388339 CCAAATACACATAAATAAATGGG + Intronic
908637308 1:66182255-66182277 CCAAATGTTCAGAAAAAAATAGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909272131 1:73636359-73636381 CCAAATTCTTATTATGAAATGGG + Intergenic
909498772 1:76310170-76310192 CCAAATGACGATTAAGAAAAAGG + Intronic
910729175 1:90372291-90372313 CAGAATGTTGATAAAGAAAAAGG - Intergenic
911625262 1:100116883-100116905 CCAAATTAAGATAAAGAAATTGG - Intronic
911821476 1:102429397-102429419 GCAAATGCTAATCAAGAAAAAGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912379013 1:109236600-109236622 CCAAAGGCTGAGAAATAATTCGG - Intronic
913202218 1:116504126-116504148 CCAAAGGCTGATGAAGAACAGGG + Intergenic
916369958 1:164080948-164080970 CAAAGTGCTCATAAAGAAAGTGG + Intergenic
917332041 1:173891095-173891117 CTAAATGCTTTTAAAGTAATGGG - Exonic
917975560 1:180235436-180235458 CCAAATGCTTGGAACGAAATGGG - Intronic
920770837 1:208883509-208883531 CCATATCCTGATAATGAGATGGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923509609 1:234638984-234639006 CAAAATGCAGATAAAGGAATTGG - Intergenic
923868217 1:237963068-237963090 ACACATGCTGACAAAGAAAAAGG - Intergenic
923952120 1:238968042-238968064 AAAAGTGCTGATAAAGAAAAAGG + Intergenic
1062941796 10:1427574-1427596 CCAAATGCTGGTGAAGATGTAGG + Intronic
1063418703 10:5893393-5893415 ACACATAATGATAAAGAAATTGG - Intronic
1063857370 10:10270269-10270291 ACAAAAACTGAAAAAGAAATGGG + Intergenic
1065270175 10:24022461-24022483 CCAAATGCTAACAAAGATGTGGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068681167 10:59821892-59821914 GCAGATGTTGATTAAGAAATTGG - Intronic
1069164667 10:65138693-65138715 ACAACTGCAGAAAAAGAAATGGG - Intergenic
1070454405 10:76596909-76596931 ACAAATGCTGAAAAAGTATTTGG - Intergenic
1071070805 10:81691339-81691361 TCAAGTGCTGGTAAAGAAACTGG - Intergenic
1071315923 10:84397828-84397850 ACAAAGGCTGAAACAGAAATAGG - Intronic
1072597069 10:96883491-96883513 CCAAATGCTGGTGAAAACATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073769068 10:106715523-106715545 CCAAACGCTGATCTAGAAAATGG + Intronic
1073960875 10:108926079-108926101 CAAAAGGCTGAGAAAGAAAGTGG - Intergenic
1074083467 10:110186716-110186738 TCAAATGCTGATAAGGATGTGGG - Intergenic
1074365942 10:112857722-112857744 CCATGTGCTGATGAAGAAAGGGG - Intergenic
1074879698 10:117646057-117646079 CCAAAGACTGATTAAGATATTGG + Intergenic
1075294053 10:121257597-121257619 CCAAGTGCTTATGAAGATATGGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078744567 11:14099093-14099115 CCAATAACTGATGAAGAAATTGG - Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080838928 11:35966521-35966543 CCAAATTCTGATAAAATAAAGGG + Intronic
1085036991 11:73306772-73306794 CCAAATCCTGATGAAGAAGGAGG - Intergenic
1085499234 11:77003659-77003681 CTAAATGCTCATTAGGAAATAGG - Intronic
1086574795 11:88327460-88327482 TAAAATGTTGATGAAGAAATAGG - Intronic
1087690728 11:101317818-101317840 CCAAATGCTGCCAAAACAATGGG - Intergenic
1087819341 11:102693914-102693936 CCAAATGCCCACAAAGAAGTAGG + Exonic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090112743 11:123932935-123932957 ACAAATGGTGGTAAAGCAATTGG - Intergenic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093633387 12:21436394-21436416 GCAAATGCTCAGAAAGAAAATGG + Intergenic
1094163850 12:27421830-27421852 CCAAATGTGTATAAAGAAACTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095621961 12:44267498-44267520 ACAAATAATAATAAAGAAATTGG - Intronic
1095790759 12:46164670-46164692 CCAAATGCGGAGAAAGTAATAGG - Intergenic
1095902871 12:47346445-47346467 TCAAATCCAGATAAAGCAATGGG + Intergenic
1096017407 12:48290057-48290079 ACAAATGCTGATGAAGATGTGGG + Intergenic
1096028472 12:48389146-48389168 CCCAATGCTCACAAAGATATGGG + Intergenic
1097931019 12:65186576-65186598 CCAAATGCATTTAAAAAAATAGG + Intronic
1099248723 12:80225591-80225613 CAAAATGTTGAGAAGGAAATAGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100157455 12:91817535-91817557 CCAAATGCAGGTTTAGAAATAGG - Intergenic
1100882253 12:99031912-99031934 CCTAATGATGAAACAGAAATTGG + Intronic
1100927264 12:99563073-99563095 CCAAAAGCTAATAAAGAACAAGG - Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102492761 12:113298816-113298838 CCTTATGCTGGTAAAGAAAAGGG - Exonic
1103857058 12:123978849-123978871 CTAAATTCTGATATAAAAATGGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105690975 13:22838804-22838826 TCAGATGCTGATAAAGCATTGGG + Intergenic
1106158171 13:27176605-27176627 GCAAATGCTGAAAAGAAAATGGG - Intergenic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1108236171 13:48408170-48408192 CAAAATGCTGAAAAGTAAATTGG - Intronic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1109458226 13:62622153-62622175 CCATATGCAGAGAAAGAAATTGG + Intergenic
1111229018 13:85316264-85316286 CCTAATGCTGATACATAAAGTGG + Intergenic
1111496982 13:89063612-89063634 GGATATGCTGATAATGAAATGGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114867124 14:26609811-26609833 CCACATGCAAATAATGAAATTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114968067 14:27989221-27989243 CCAAATTGTGTTAAATAAATTGG + Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1118118803 14:62812366-62812388 CAATATGTTGATAAAGACATAGG + Intronic
1118463398 14:66008146-66008168 CCAAATTCTGGTAAGAAAATGGG - Intergenic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120149288 14:81015257-81015279 CCTAAGGCTGACAAAGAAGTTGG + Intronic
1120646310 14:87078727-87078749 CCAAATGCTGGGAAAGGATTGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1125248828 15:37675992-37676014 CCAAATTCAGATAAATAAACTGG + Intergenic
1125717366 15:41826986-41827008 GCAGAGGCTTATAAAGAAATGGG + Exonic
1126508081 15:49431302-49431324 TCAAATGCAGATAAAAAACTTGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126584092 15:50266098-50266120 CCTACTGCTGATAAGGAAACAGG - Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126917411 15:53481586-53481608 CCAAATGCTGATAAAAAATCTGG + Intergenic
1128489050 15:68127580-68127602 CCAAATGAGGAGAAAGAAATAGG - Intronic
1129637734 15:77339988-77340010 CCAAATGCTGGCAAAGACATGGG + Intronic
1130696087 15:86132961-86132983 TAAAATGTTGATAAATAAATAGG - Intergenic
1130840854 15:87700104-87700126 TCATATGTTGATGAAGAAATAGG - Intergenic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131614012 15:93994784-93994806 CCAAATACTTTTTAAGAAATAGG + Intergenic
1131823092 15:96292686-96292708 TAAAATGCTGTTAAACAAATTGG - Intergenic
1133085101 16:3356177-3356199 CCAAATGCTGATCAATTTATGGG + Exonic
1135293811 16:21262315-21262337 CGAAATACTTATTAAGAAATAGG + Intronic
1137758589 16:50922149-50922171 CCACATGCTGAAAATGACATTGG - Intergenic
1138052837 16:53799431-53799453 CAAAATGGTGATCAAGACATAGG - Intronic
1138941487 16:61795949-61795971 GCAAATGTTTATACAGAAATAGG - Intronic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139682986 16:68580239-68580261 CCAAAGGCAGAGAGAGAAATGGG + Intergenic
1140971484 16:80017304-80017326 CAAAAAGGTGGTAAAGAAATGGG - Intergenic
1141643084 16:85352805-85352827 CCAGCTGCTGACAAAGAAAGGGG + Intergenic
1143275456 17:5706511-5706533 CCAGATGCTGGTAAAGTAAGTGG - Intergenic
1143505116 17:7359728-7359750 TCAAATGATGATTAAGAATTTGG + Intergenic
1146105399 17:30031018-30031040 TCTAATGCTGAAAAAAAAATTGG - Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149129095 17:53274175-53274197 CCAAATGCTCATAGAAAAATCGG + Intergenic
1150258470 17:63769306-63769328 GCAAATGCACATAAAGAAAAAGG + Intronic
1150851200 17:68705220-68705242 ACAAATGTTTAAAAAGAAATTGG - Intergenic
1150995648 17:70314736-70314758 CCAACAGCTGGTAAGGAAATGGG - Intergenic
1151046567 17:70926772-70926794 CGAAATTCTGAAAAAGAATTAGG - Intergenic
1155236884 18:23829200-23829222 CCAAACTCTGAAAAGGAAATAGG - Intronic
1155552468 18:26980002-26980024 CCAATTGCTTTTAAAGAACTTGG + Intronic
1156109318 18:33704515-33704537 CCAATGGCTGTCAAAGAAATGGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156282047 18:35648885-35648907 CCAAGGGCTGAAAAAGGAATAGG - Intronic
1156394662 18:36688527-36688549 AAACATGCTGCTAAAGAAATAGG + Intronic
1156712951 18:39969084-39969106 CCAAATGTTGAAATACAAATAGG - Intergenic
1156865035 18:41879633-41879655 CCAAATGCTGAAGAGAAAATTGG + Intergenic
1157303706 18:46500520-46500542 TCAAAAGATGATTAAGAAATTGG - Intronic
1157658243 18:49414463-49414485 CCAAATAGTGATAATGAAACAGG + Intronic
1157854162 18:51089379-51089401 CCAAATGGTGATGGAGAAACTGG + Intergenic
1158064275 18:53386779-53386801 CAAGATACTGAGAAAGAAATGGG + Intronic
1158085700 18:53649345-53649367 GCAAATGGTGATAAATTAATTGG + Intergenic
1159438726 18:68450172-68450194 ACATATACTGATAGAGAAATTGG - Intergenic
1159516106 18:69459940-69459962 CTAAATGCTATTAAAGAAATAGG - Intronic
1159612151 18:70538059-70538081 CCACAAGCTGAGAAAGAAAGAGG - Intergenic
1164433521 19:28208461-28208483 CCAAAAGGAGAAAAAGAAATCGG - Intergenic
1164862696 19:31574948-31574970 CCAAATGCTCATTAAACAATTGG + Intergenic
1164924369 19:32117004-32117026 ACAATTGCTGATGAAGAAGTAGG + Intergenic
1165553815 19:36611778-36611800 ACAAGTGCTGGTGAAGAAATTGG - Intronic
1165581338 19:36867153-36867175 CCAAATGTTGGTAAAGATGTGGG - Intronic
1168467423 19:56614699-56614721 AGAAAAGCTGTTAAAGAAATAGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
926447012 2:12955432-12955454 CTAAATGCTTATAAGGGAATGGG - Intergenic
927092124 2:19720088-19720110 CTAAATGCAAAGAAAGAAATCGG + Intergenic
927201467 2:20580750-20580772 TCAAGTGCTGACAAAGAAAGTGG + Intronic
928349993 2:30541861-30541883 CCTAATGCTGACAAGGATATGGG - Intronic
928678309 2:33672202-33672224 CTAAATACTGAAATAGAAATAGG - Intergenic
929181653 2:39046805-39046827 ACTAATGGTGAAAAAGAAATTGG - Intronic
929347376 2:40902175-40902197 CCCAATGATGAGAAAAAAATGGG - Intergenic
929552195 2:42901606-42901628 ACAGAGGCTGATAGAGAAATGGG - Intergenic
930008201 2:46914980-46915002 CCAAAGGGTGATAAGGGAATGGG + Intronic
930544028 2:52744787-52744809 CACACTGCTAATAAAGAAATAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931382995 2:61770772-61770794 ACAAATGATGACAAAGAAATAGG - Intergenic
931863636 2:66385634-66385656 GCAAATGCTTTGAAAGAAATTGG - Intergenic
932465329 2:71919223-71919245 ACAAATGGTGCTAAAGTAATTGG + Intergenic
933121027 2:78538526-78538548 CCAAATGCTGATGAAGATGTAGG + Intergenic
935676665 2:105600381-105600403 CCAAATGTTAATGAAGGAATTGG - Intergenic
936441878 2:112561274-112561296 CCAACTGCAGAAAAAGAGATGGG + Intronic
936829044 2:116618276-116618298 GCAAATGCTGATAGAGCAACTGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
939241751 2:139570250-139570272 ACAAATGAAAATAAAGAAATGGG + Intergenic
939400949 2:141693187-141693209 CTAATTGCTGAAAAAGTAATGGG - Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940436095 2:153657004-153657026 CCACATGCTGATGAAGGAAATGG + Intergenic
940455111 2:153887428-153887450 CCAAGTGCCAATAAATAAATAGG + Intronic
940550513 2:155149893-155149915 ACACATGCTGAGAAACAAATTGG - Intergenic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941842895 2:170106924-170106946 ACACATGCTGAGAATGAAATGGG + Intergenic
941850187 2:170172649-170172671 CCAAGTGCTGAGAAAAATATAGG - Intergenic
944400377 2:199319443-199319465 CCAGATGGTGATAATGAAAGGGG - Intronic
944403587 2:199356590-199356612 CCAAATGCAGATAAATATTTAGG + Intronic
944524641 2:200606181-200606203 CCATATGCAGAAAACGAAATTGG - Intronic
945075597 2:206035936-206035958 CCAAAAGAAGATAAACAAATGGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945927019 2:215816250-215816272 CCAAAAGATTTTAAAGAAATGGG + Intergenic
946615220 2:221501712-221501734 CCAAGTGCTGACAAAAAAACCGG + Intronic
946687745 2:222288792-222288814 CCAAATTCTCTTTAAGAAATAGG - Intronic
946803396 2:223444971-223444993 CAAAATGGGGATAAATAAATAGG + Intergenic
947408052 2:229801697-229801719 TTAAAAGCTGATAAATAAATGGG + Intronic
947409856 2:229825599-229825621 CCAAATGCTTATAAAACCATCGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1168865848 20:1085892-1085914 CCAACTACTGAGAAAGAAACCGG - Intergenic
1170292557 20:14786864-14786886 CCAAATACGTATAAAGAAAGAGG + Intronic
1170782980 20:19442351-19442373 CCAAATGCTGGTGAAGATGTGGG - Intronic
1172220254 20:33269126-33269148 CCCAAGGCTGACAGAGAAATAGG + Intergenic
1174336655 20:49866685-49866707 AAAAATATTGATAAAGAAATGGG - Intronic
1174755696 20:53156199-53156221 CCCATTGCTGATAGAGATATGGG - Intronic
1175471682 20:59234455-59234477 CCAAATACTGTTAAAGAAAGTGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176971040 21:15266099-15266121 CCAATTGGTGATATAGCAATAGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178064472 21:28888738-28888760 GCAAATGGAGACAAAGAAATTGG - Intergenic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1179055634 21:37930123-37930145 CCAAGTGCTGGTAAGGAAACAGG + Intergenic
1179083684 21:38197174-38197196 CCAAATGCTCATAAATCAATGGG - Intronic
1184050876 22:42003492-42003514 CAAACTGCTGATAAATAAAAGGG + Intronic
949358730 3:3209180-3209202 CCAAATGATGCAAAAGAAAGTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951424159 3:22523133-22523155 TCAAGTGCTGGGAAAGAAATAGG + Intergenic
951463947 3:22981175-22981197 TCAAATTCTGATTGAGAAATAGG - Intergenic
951757781 3:26111118-26111140 CCACATGCTGATCAAGAAGAGGG - Intergenic
951931561 3:27973350-27973372 GCAAATTCTGTTAAAGCAATTGG - Intergenic
952002604 3:28803832-28803854 CCAAATGCTGGCAAAGATTTGGG - Intergenic
952138492 3:30451791-30451813 ACAAACGCGGACAAAGAAATAGG + Intergenic
952551114 3:34477832-34477854 CCATATGCAGAAAAAAAAATTGG - Intergenic
952819844 3:37476843-37476865 CCAGATGCTGAGAATGAAAGTGG - Intronic
952853621 3:37749723-37749745 CCAAATGCTGAGACAGAAGAGGG + Intronic
955097302 3:55812156-55812178 CCGATTTCAGATAAAGAAATAGG - Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
956723449 3:72138106-72138128 GGAAATGATGATAAAGAAAAAGG - Intergenic
957515796 3:81249389-81249411 CCAGATGCTGATAGAAAAACAGG - Intergenic
957647638 3:82953747-82953769 GCACATGCTGATATAGAAGTGGG - Intergenic
957834522 3:85569560-85569582 CCAAATGCTGGCAAAGATGTGGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958490710 3:94768454-94768476 TCAAAATATGATAAAGAAATTGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959756097 3:109901160-109901182 TCAAATGCTGATCAAGTCATTGG - Intergenic
959785182 3:110288355-110288377 CTAAATTCTGAGAAACAAATAGG - Intergenic
959843898 3:111010513-111010535 GAAAATGCAGATAAAGAAAATGG + Intergenic
960418296 3:117412317-117412339 GCAAATGCTGATACAGGAATTGG - Intergenic
960745902 3:120888239-120888261 CCAAGGGCTGAAAAACAAATTGG + Intergenic
960900395 3:122548858-122548880 ACCACTGCTGTTAAAGAAATTGG + Intronic
961445556 3:126979399-126979421 CCAAATGCAGACAGAGAAGTTGG - Intergenic
961937061 3:130595980-130596002 CCAAGTGCTGATAAGGATGTGGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964807516 3:160627722-160627744 CCAAATTCTGTAAAACAAATAGG + Intergenic
965355018 3:167663236-167663258 CCAAATGCTGTCAGAGAAAATGG + Intergenic
966272682 3:178127136-178127158 CCATTTGCTGATTATGAAATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967335978 3:188345222-188345244 CCCCATGCTGAAAATGAAATTGG - Intronic
967523448 3:190463562-190463584 ACAAATTCTAATAAACAAATGGG - Intergenic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
969149535 4:5157526-5157548 CCAACTGCTGAGAAAGAAATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971030235 4:22628773-22628795 CCAATTGCTTTTAAAGAACTTGG + Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973601919 4:52550829-52550851 CCAAATTCAGATAAAAAACTTGG - Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975723144 4:77267629-77267651 CCAAGTGCTCATGAGGAAATAGG - Intronic
976848933 4:89522740-89522762 CCAACTGCTGATAAACCATTTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977970423 4:103206794-103206816 CCCAGTGATGATGAAGAAATGGG - Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
978993169 4:115112881-115112903 TAAATTGCTTATAAAGAAATAGG - Intronic
979102583 4:116639361-116639383 CCAGATGCTGACAGAGAAAATGG - Intergenic
979451678 4:120878886-120878908 CCAAATGCTGACAAGGACATGGG + Intronic
980027834 4:127787101-127787123 TCATATGCTAGTAAAGAAATAGG - Intronic
980309411 4:131106054-131106076 ATAAATACAGATAAAGAAATTGG - Intergenic
980330925 4:131410151-131410173 CCAAAGGCAGAGTAAGAAATAGG + Intergenic
980492759 4:133550731-133550753 CCATATACTTATAAAGAAAATGG - Intergenic
980892575 4:138831041-138831063 CCAAATGCTGAGAAACACCTGGG + Intergenic
981446575 4:144846152-144846174 GCAAATGGAGACAAAGAAATTGG + Intergenic
981999853 4:151012259-151012281 GCAAATGCTGCTATAGAATTTGG + Intronic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984259234 4:177424633-177424655 CCAAATCCAGAGAAAGAAGTAGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986493548 5:8318560-8318582 CCAGATGGAGATAAAGCAATGGG + Intergenic
987739145 5:21883116-21883138 GCAAATGGAGACAAAGAAATTGG + Intronic
987748098 5:22003963-22003985 CAAAGTGCTGAGACAGAAATGGG - Intronic
988213211 5:28235897-28235919 CCAAATTTTTATAAAGATATGGG - Intergenic
989520954 5:42399307-42399329 CCAAAGGCAGAGAAAAAAATGGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990636214 5:57730736-57730758 CCTAATGAAGATAAAGACATAGG + Intergenic
990919716 5:60948930-60948952 CCAAGTGTTGATAAGGATATAGG - Intronic
990937494 5:61165791-61165813 CCTGATGCTGTTAATGAAATAGG + Intergenic
991127831 5:63087732-63087754 CCAGATACTGATAGAGGAATAGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992802402 5:80305437-80305459 GCAAATGGTGATGAACAAATTGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993557826 5:89363773-89363795 CCAAATGTTGATAAGAACATAGG + Intergenic
993944806 5:94105460-94105482 CAAAATGTTGCTGAAGAAATCGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995239338 5:109868544-109868566 CTAAATGGTGAAAGAGAAATTGG - Intronic
995613596 5:113937043-113937065 CCAAAGGCTGATGAAGAACATGG + Intergenic
996460983 5:123742804-123742826 ATAAATGTTGGTAAAGAAATTGG + Intergenic
996502345 5:124230761-124230783 CCAAATGCTGGTAGTGAAGTAGG - Intergenic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
997711834 5:136011424-136011446 CCAAGTGCAGAAAATGAAATAGG - Intergenic
998706634 5:144769648-144769670 CATAATGCTGATAAAGTAGTTGG + Intergenic
998766189 5:145490044-145490066 AGAAATACTGAGAAAGAAATTGG - Intronic
1001241348 5:170073210-170073232 ACACATGGTGCTAAAGAAATTGG - Intronic
1001324512 5:170712249-170712271 CCAGATGCAGAAAAAGAAAAGGG - Intronic
1001705172 5:173736347-173736369 CCAAATGCTGGAAAGGAAACAGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004576395 6:16899731-16899753 CCAGATGCTTATAAAGGCATCGG - Intergenic
1004787592 6:18986337-18986359 CCACAGGCTGAGAAAGAAACAGG - Intergenic
1005054290 6:21715603-21715625 CCATCTGATGATAAAGAAAAAGG + Intergenic
1005600367 6:27420645-27420667 CCAAATGCTGATGAAGGATGTGG + Intergenic
1007214021 6:40222039-40222061 CCATATTCAGATAAAGAAATTGG - Intergenic
1008669517 6:53753205-53753227 GAAAATGCTGAGAAAGGAATGGG + Intergenic
1009232190 6:61076470-61076492 CAACATGCTGTTAAAGAAATGGG - Intergenic
1009389735 6:63131360-63131382 CCAAATGGCCATGAAGAAATTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009704384 6:67227024-67227046 GGCAATGCTGATAAAGAAAATGG + Intergenic
1010082537 6:71880986-71881008 CTAGATGCTGACAATGAAATTGG - Intergenic
1010276567 6:73974402-73974424 ACAAATGGTGATAAACAGATGGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011205969 6:84898336-84898358 CCTAATGCTGATGAATAAATGGG - Intergenic
1011974576 6:93280260-93280282 CCAAATGCTGAATTACAAATGGG - Intronic
1012194405 6:96321834-96321856 CTAAATGTTTAAAAAGAAATTGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012965754 6:105670675-105670697 CCATATCCTGAGAAATAAATAGG + Intergenic
1013743037 6:113311446-113311468 CCAAATGTTGGTAAGGACATTGG - Intergenic
1013877297 6:114848190-114848212 CCAAATCCTGATAAAATATTTGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014592227 6:123288185-123288207 TCACATGCAGAGAAAGAAATTGG + Intronic
1014956894 6:127630673-127630695 TGAAAGGCTGATAAAGAAATAGG + Intergenic
1015400490 6:132782656-132782678 CTAAAAGGTGGTAAAGAAATGGG + Intronic
1016364428 6:143300365-143300387 CCAAATGTGGACAAAGAAAACGG - Intronic
1017205313 6:151798982-151799004 CAAATCACTGATAAAGAAATGGG - Intronic
1017332527 6:153216685-153216707 TCAAATACTATTAAAGAAATGGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1019884484 7:3892196-3892218 GCAAAAGCTAATACAGAAATTGG - Intronic
1020598390 7:10241422-10241444 ACAAATGTTGATAGAAAAATAGG - Intergenic
1020749017 7:12115655-12115677 CCAAATGTTCATCAGGAAATTGG + Intergenic
1020772844 7:12417105-12417127 CCAAAGTCTGATTAAAAAATGGG - Intergenic
1021410506 7:20325227-20325249 TCAAATGCTGACAAGGACATAGG - Intergenic
1021928760 7:25558743-25558765 CCTAAGGCTGAAAAAGAACTTGG + Intergenic
1021955158 7:25817044-25817066 TCAAATGCTGAGGAAGAAAAGGG - Intergenic
1022432322 7:30337692-30337714 GCAAATGCAAATAAAAAAATTGG - Intronic
1024226347 7:47329038-47329060 CCAAATGCTGAAAAAAATGTGGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1028768812 7:94591584-94591606 CCAAATGCTGATTTTGAATTTGG - Intronic
1029962953 7:104707943-104707965 ATAAATGCTGAGAAAGAAAGAGG + Intronic
1030636668 7:111957341-111957363 CAAAAGGATGATAAAGAAACTGG + Intronic
1030675704 7:112383563-112383585 CCAAAGGCTGATTATAAAATAGG + Intergenic
1030747539 7:113185621-113185643 AAAAAGGCTGGTAAAGAAATCGG - Intergenic
1030843573 7:114383377-114383399 CCAAAAGGAGATAAACAAATGGG - Intronic
1031192105 7:118565936-118565958 ACAAATGGTGATGAAGTAATTGG + Intergenic
1031217340 7:118911989-118912011 ACAAATGCTGACAAAGATATGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031911260 7:127519126-127519148 CCAACTGCTGAGAAAAAAAAAGG - Intergenic
1032024467 7:128430623-128430645 CCAAAAGCTGGGAAAGGAATAGG - Intergenic
1032605245 7:133343713-133343735 TAAAATACAGATAAAGAAATAGG - Intronic
1033037467 7:137888265-137888287 CAAAATGCTTTTAAAGAAAATGG - Intronic
1033095445 7:138426489-138426511 CCAAATGCTGGGCAAAAAATTGG - Intergenic
1033265552 7:139883434-139883456 CCATATGCTGTTATAGAAAGAGG - Intronic
1033475986 7:141693348-141693370 CCAAATGCTGATGAGGATGTGGG + Intronic
1033801781 7:144910213-144910235 CCAAATGCTCAAAAAGAAAAAGG + Intergenic
1033875122 7:145806698-145806720 ACAAATGCTGCTGAAGCAATTGG - Intergenic
1034053282 7:148006145-148006167 CCAAAGGCTAATAAAAAAACAGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036283271 8:7419370-7419392 GCAAATGGAGACAAAGAAATTGG + Intergenic
1036338199 8:7892151-7892173 GCAAATGGAGACAAAGAAATTGG - Intergenic
1036737006 8:11328977-11328999 CCATATGCAAATAATGAAATTGG - Intergenic
1037661801 8:20934205-20934227 TCAAATGCTGATGAAGATGTGGG + Intergenic
1039251659 8:35672159-35672181 CCAAATGTTCATACATAAATGGG - Intronic
1039395438 8:37221522-37221544 CCAAATGCAAATAAGGAAATGGG + Intergenic
1040583923 8:48722116-48722138 CCAAAACCTGATTTAGAAATGGG + Intronic
1041105494 8:54439547-54439569 GCAAATGCTTATAAATAATTTGG + Intergenic
1042803236 8:72743973-72743995 ACAAAATCTGATAAAGAAATTGG - Intronic
1042827120 8:72990864-72990886 CCAAATGCTGATGAGACAATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044980711 8:97713665-97713687 TCAGATGATGATAAAGAAAAGGG + Exonic
1045203203 8:100008766-100008788 CTAATTACTGATGAAGAAATTGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1046045535 8:108959914-108959936 GCAAAAGATGATAAGGAAATAGG - Intergenic
1047047067 8:121066094-121066116 CCTAATGCTGATGAAAAAGTGGG - Intergenic
1048508263 8:135040339-135040361 GCAAATGCTGAGATAGAGATTGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1049234095 8:141501667-141501689 CCAAAACCAGATAAAGATATTGG + Intergenic
1049519198 8:143079689-143079711 GCAGATGCTGCAAAAGAAATTGG + Intergenic
1051495114 9:17712533-17712555 ACAAATGATGCTAGAGAAATTGG - Intronic
1051682908 9:19625993-19626015 CAAAATTCCTATAAAGAAATGGG - Intronic
1051756190 9:20403389-20403411 CCCAATGAAGATAAAGAGATGGG + Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052342830 9:27380239-27380261 CCAAGTGCAGAAAAAGAGATAGG + Intronic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053320266 9:37091845-37091867 CCAAATGCTGACAAACTAAAGGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055880240 9:80992462-80992484 CCAAATGGTGCTACAGCAATTGG - Intergenic
1057011172 9:91602809-91602831 CCAAATGCTGGTGAGGATATGGG - Intronic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847202 9:118293442-118293464 ACAAATGATGACAAAGTAATTGG - Intergenic
1060649804 9:125315716-125315738 CCAAATGCTTATGAAGGAAGAGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186245466 X:7611960-7611982 AAAAATCCAGATAAAGAAATCGG - Intergenic
1186250711 X:7662804-7662826 CTAATTAATGATAAAGAAATGGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188302783 X:28526182-28526204 CTAAATGCTCATATAGAAATTGG + Intergenic
1188641079 X:32505511-32505533 CCAAAAGCCGACAGAGAAATGGG + Intronic
1188920503 X:35970670-35970692 CCAACACCTGATATAGAAATTGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190382195 X:49850173-49850195 ACAAGTGCTGGTGAAGAAATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191810966 X:65187955-65187977 CCAAAGGCTGAGAAAGATAGTGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193232355 X:79062706-79062728 CACACTGCTGATAAAGACATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1196327125 X:114419804-114419826 CCAAATGCTGACTAAGATATGGG + Intergenic
1196972310 X:121123097-121123119 ACAAATGGTGCTAGAGAAATTGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199273776 X:145918489-145918511 ACAAATGCTGTTGAAGAAATTGG + Intergenic
1201715043 Y:17034963-17034985 TCAATTGCTGATCAAGAAAATGG - Intergenic