ID: 1119115280

View in Genome Browser
Species Human (GRCh38)
Location 14:72014822-72014844
Sequence AGACGGGTATGGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119115280 Original CRISPR AGACGGGTATGGAGGGAAGC GGG (reversed) Intronic
900031150 1:373965-373987 AGACGGGGATGGAGGGGGGATGG - Intergenic
900291996 1:1927560-1927582 AGAGGGGCCTGGAGGGAAGCAGG + Intronic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
903156768 1:21450295-21450317 AGACAGGTAAGGAGGAAAGCAGG - Intronic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
905281800 1:36854029-36854051 AGATGGGTAGGGAGGCAGGCGGG + Intronic
906106158 1:43293854-43293876 AAACGGGAAGGGAGGAAAGCTGG + Intergenic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906681870 1:47732341-47732363 AGACATGTAGGGAGGTAAGCAGG - Intergenic
907011528 1:50968357-50968379 AGACGGTTGTGGAGGGCCGCAGG - Exonic
910501155 1:87892003-87892025 AGATGGGTATGGATTGAATCTGG - Intergenic
910934430 1:92475931-92475953 AGAAGGGAGTGGAGGCAAGCAGG + Exonic
911427662 1:97740934-97740956 AGAGAGGTAGAGAGGGAAGCTGG - Intronic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
913992796 1:143630383-143630405 AGAGAGGTAAGGAGGAAAGCAGG + Intergenic
914960769 1:152204463-152204485 AGATGGGGAGGGAGTGAAGCAGG - Intergenic
917725226 1:177821386-177821408 AGAAGGGGAGGCAGGGAAGCGGG + Intergenic
918449457 1:184644803-184644825 TGACGGGTATGAGGGGAGGCAGG - Intergenic
919119158 1:193317199-193317221 AGAAGGCTAGAGAGGGAAGCAGG + Intergenic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
922399791 1:225240563-225240585 AGACAGGTATGGAAGGATGAAGG - Intronic
922857178 1:228784881-228784903 TGACTGGTGTGGTGGGAAGCAGG - Intergenic
923452441 1:234131444-234131466 AGACTGGGATGGGGGGAAGGGGG - Intronic
924113282 1:240721532-240721554 AGACTGGGTTGGAGGGAAGACGG + Intergenic
1063865464 10:10360470-10360492 AGACAGGAAGGGAGGGAAGGAGG + Intergenic
1063966124 10:11347243-11347265 AGACAGGAATGGAGGTAGGCAGG + Intergenic
1064134836 10:12741728-12741750 TGCCGGGAAGGGAGGGAAGCAGG + Intronic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1067216608 10:44309427-44309449 AGAGGGGGAGGGAGGGAAGGAGG + Intergenic
1067284656 10:44898870-44898892 AGACAGGGATGGAGGAAGGCAGG - Intergenic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1072683411 10:97522814-97522836 AGAGGGGTCTGGAGGGAGCCAGG + Intronic
1072760056 10:98049223-98049245 AGTCAAGGATGGAGGGAAGCAGG + Intergenic
1072766280 10:98097423-98097445 AGACGAGTCTGGTGGGACGCAGG - Intergenic
1075539954 10:123304024-123304046 AGAAGGGTTGGGTGGGAAGCAGG - Intergenic
1075597648 10:123743799-123743821 AGACAGGACTGGAGAGAAGCAGG + Intronic
1075614475 10:123881453-123881475 AGAGGGGAAGGAAGGGAAGCAGG + Intronic
1077227452 11:1444639-1444661 AGAGGGGGAGGGAGGGAAGCTGG - Intronic
1078759264 11:14238658-14238680 GGTCAGGTCTGGAGGGAAGCGGG - Intronic
1079886261 11:25993195-25993217 ATACGGGTTGGGAGGGGAGCTGG - Intergenic
1080879186 11:36303101-36303123 AGAAGGAAGTGGAGGGAAGCAGG + Intronic
1081968317 11:47182776-47182798 AGAGGGGTAAGCAGGAAAGCTGG + Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084297970 11:68225596-68225618 AGAATGGAATGGAGGCAAGCAGG + Intergenic
1084472407 11:69370763-69370785 AGACAAGCATGGAGGGAAGGTGG - Intergenic
1084576108 11:69988966-69988988 AGACAGGGAAGGAGGGAAGTAGG + Intergenic
1085287075 11:75370032-75370054 AGAAGAGGAAGGAGGGAAGCAGG - Intergenic
1086092060 11:83014787-83014809 AGAAGGGGAGGGAGGGAGGCAGG + Intronic
1088451186 11:109982906-109982928 AGACTGGTCTGAAGGCAAGCAGG + Intergenic
1088979714 11:114851296-114851318 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1090328513 11:125910035-125910057 AGAATGGGATGTAGGGAAGCTGG - Intronic
1090609180 11:128454992-128455014 AGCAGGGTATGGATGGAAGGCGG - Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091321398 11:134654944-134654966 AGAAAGGAAGGGAGGGAAGCGGG - Intergenic
1091618476 12:2067625-2067647 TGACGTGGATGGAAGGAAGCAGG + Intronic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1092051951 12:5477725-5477747 AGAAGGAAATGGAGGGAAGAGGG - Intronic
1092896255 12:13013447-13013469 GGACGGGTAAGCAGGGAAACTGG + Intergenic
1093682146 12:22014801-22014823 AAACGGGTATGGGGAGAATCTGG + Intergenic
1096073220 12:48787545-48787567 AGACTGGTATGGCAGGAAACAGG + Intronic
1096681047 12:53255480-53255502 AGAAGGGTGGGGAGGGAAGGAGG + Intergenic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1097092949 12:56521938-56521960 AGACGGGGAGGGAGGGAGGAGGG - Exonic
1097181396 12:57173999-57174021 AGAAGGGTAGGGAGGGTGGCTGG + Intronic
1100065738 12:90641575-90641597 AGACAGGGAGGGAGGGAAGAAGG + Intergenic
1100420207 12:94425032-94425054 AGACGGGGAGGGAGGGAGGAGGG + Intronic
1100447617 12:94675922-94675944 AGAGGGGCATGGAGGAAGGCGGG - Intergenic
1100528474 12:95442347-95442369 AGATGGGTATGGGTGGAAGCTGG - Intergenic
1102781474 12:115569799-115569821 AGAGGGAAATGCAGGGAAGCTGG - Intergenic
1103516888 12:121513993-121514015 AGACGGGTGTGGGGAGGAGCAGG - Intronic
1104772874 12:131375161-131375183 AGAGAGGGATGGAGGGAAGATGG + Intergenic
1107299066 13:38946639-38946661 GGAAGGGACTGGAGGGAAGCAGG - Intergenic
1107839066 13:44436956-44436978 AGGCGGGGAAGCAGGGAAGCGGG - Intronic
1110552900 13:76828008-76828030 AGAAGGGAAGGGAGGGAAGGAGG + Intergenic
1110552946 13:76828131-76828153 AGAGGGGAAGGGAGGGAAGGAGG + Intergenic
1110834966 13:80073178-80073200 AGAGGGGAAGGCAGGGAAGCTGG - Intergenic
1110846488 13:80195684-80195706 AGACGGAGAGGGAGGGAAGAAGG + Intergenic
1111099551 13:83565448-83565470 AGAAGGGTAAGGAGGAAAACAGG - Intergenic
1111176778 13:84606082-84606104 GGAAGGGTAAGGAGTGAAGCTGG + Intergenic
1117107133 14:52409443-52409465 AGACGGGGGTAGAGGGGAGCAGG - Intergenic
1118336602 14:64858611-64858633 AGACAGGAAAGGAGGGAAGAAGG + Intronic
1118807008 14:69246554-69246576 AGAAGGGTAATGAGGGAAGCAGG + Intergenic
1119055056 14:71410906-71410928 AGACAGGTATGGAGGGAGGGGGG - Intronic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1120141673 14:80936413-80936435 AGACAGGGAAGGAGGGAAGGAGG + Intronic
1120686378 14:87542678-87542700 TGAAGGGTTTGGAGGAAAGCAGG + Intergenic
1120864743 14:89286181-89286203 AGAGGAGTAGGGAGGGAAGAAGG + Intronic
1121228754 14:92341044-92341066 AGATGAGTATGCAGGGAGGCCGG + Intronic
1122204318 14:100141122-100141144 AGACAGGTGTGGGGGAAAGCTGG - Intronic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122447554 14:101781054-101781076 AGACGGCTAGGGAGGAAGGCTGG - Intronic
1122718689 14:103710041-103710063 AGACGGGGGAGGATGGAAGCTGG + Intronic
1122753001 14:103953223-103953245 AGAAGGGTATGGAGAAGAGCTGG - Intronic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123754552 15:23386779-23386801 AGGCAGCTATGGTGGGAAGCAGG - Intergenic
1124347808 15:28934098-28934120 AGACGGGGGTGGAGGAGAGCAGG + Intronic
1125763831 15:42119565-42119587 AGACAGGGAGAGAGGGAAGCAGG + Intergenic
1126835961 15:52665106-52665128 CGAGGGGAATGGAGGGAGGCAGG + Intronic
1127319686 15:57831042-57831064 ACAAGGGTGTGGAAGGAAGCGGG + Intergenic
1127379947 15:58422278-58422300 AGCAGGGAATGGCGGGAAGCCGG - Intronic
1128270805 15:66307790-66307812 AGATGGAGATGGAGGGAAGGTGG + Intronic
1129020550 15:72513798-72513820 AGAGGGGGAGGGAGGGAAGGAGG - Intronic
1129875343 15:78971778-78971800 GGACGGGTATGGAGGGGACAGGG + Intronic
1130743200 15:86623242-86623264 GGACGGGTTTGGAGGAAGGCAGG + Intronic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131330630 15:91496012-91496034 AGAGAGGGATGGAGGGAAGGAGG - Intergenic
1131793329 15:95988380-95988402 AGAAGGGAAGGGAGGGAAGAGGG + Intergenic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1133839301 16:9394145-9394167 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1134461817 16:14436210-14436232 AGGCAGCTATGGTGGGAAGCAGG + Exonic
1136397561 16:30001424-30001446 AGAAGGGAATGGGGGGTAGCGGG - Exonic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138412962 16:56854076-56854098 TGGCGGGTATGGAGGGCATCTGG + Intergenic
1141427212 16:83952075-83952097 AGGCAGGGAGGGAGGGAAGCAGG - Intronic
1146183142 17:30709704-30709726 AGCCGGGGCTGGGGGGAAGCTGG - Intergenic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1148945668 17:51260103-51260125 AGGAGGGTATGTAGGGAAGTGGG - Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1151464537 17:74276058-74276080 AGACTGGGAAGGAGGCAAGCTGG - Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1152553821 17:81043233-81043255 AAACGGGTATGGGGGGACCCAGG - Intronic
1152948503 17:83211748-83211770 AGACGGGGATGGAGGGGGGATGG + Intergenic
1153560692 18:6369341-6369363 GGACGGGCAGGGAGGGATGCTGG + Intronic
1156553787 18:38044969-38044991 GGAGGGGTAAGGAGGAAAGCTGG + Intergenic
1156911136 18:42412379-42412401 AGACTGGGATGGAGGGCAGAAGG - Intergenic
1161296972 19:3525060-3525082 AGACGGGTGTTGTGGGCAGCAGG + Intronic
1161777574 19:6271998-6272020 GGACGGAGAGGGAGGGAAGCCGG - Intronic
1162555811 19:11384757-11384779 AGAGGGGGAAGGAGGGAAGGAGG - Intronic
1162861313 19:13507353-13507375 AGACTGGTGTGGAGGGTTGCGGG + Intronic
1162975653 19:14206070-14206092 AGCCGGGGCTGGGGGGAAGCGGG + Exonic
1163837094 19:19581689-19581711 AGACCTGTTTGGTGGGAAGCAGG + Intronic
1164609147 19:29620597-29620619 AGACAGCTATGGAGGGAATGGGG - Intergenic
1164854174 19:31507709-31507731 GGACAGGTGAGGAGGGAAGCTGG - Intergenic
1165796641 19:38523703-38523725 AGAAGGATAGGGAGGAAAGCAGG - Intronic
1166201217 19:41238979-41239001 AGAAGGGGATGGAGGGATACAGG + Intronic
1166387158 19:42388866-42388888 AGATGGGTTTGGGGGGAATCAGG - Intronic
1167309231 19:48727352-48727374 AGAGTGGTCTGGAGGGATGCAGG - Intronic
1167511248 19:49896354-49896376 AGACCGGTGAGGAGGGAGGCAGG - Intronic
1168349606 19:55668595-55668617 GGACGGGTCTGGAGGGAGGCAGG - Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926744834 2:16142664-16142686 TGAAGGGTATGAAGGAAAGCAGG + Intergenic
927081404 2:19634307-19634329 AGAGGGGGATGGAGCGAGGCTGG - Intergenic
927213948 2:20655676-20655698 AGACGAGTATGGGGGGACTCTGG + Intergenic
928084753 2:28339090-28339112 GGAGGGGTATGGATGGCAGCGGG - Intergenic
930391384 2:50765740-50765762 AGCACGGTAAGGAGGGAAGCAGG + Intronic
933480748 2:82854133-82854155 AGACAAGGCTGGAGGGAAGCAGG - Intergenic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
942197610 2:173537267-173537289 AGCAGGGTATGGGGGCAAGCAGG - Intergenic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
945929733 2:215842809-215842831 AGAGGGGCAGGGATGGAAGCTGG - Intergenic
946227099 2:218269874-218269896 AGTCGGGTGTGGAGGGGAGCGGG + Intronic
947334480 2:229067601-229067623 AGAGGAGTATGGATGGAGGCAGG - Intronic
948691293 2:239706789-239706811 AGAGAGGTAGGGAGGGGAGCAGG - Intergenic
948827465 2:240579564-240579586 AAGCGGGTATGGAGGGCACCTGG + Exonic
1168803693 20:660742-660764 AGAGGGGTGTGAAGGGAAGGCGG + Intronic
1168843978 20:929483-929505 AGATGGGAATGGAGGTGAGCAGG + Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1168974362 20:1953088-1953110 AGAGGGGGATGGAGGGAGGGAGG + Intergenic
1169248974 20:4045946-4045968 AGAAAGGGATGGAGGGAAGCAGG - Intergenic
1172767037 20:37356452-37356474 AGATGGGCCTGGAGAGAAGCAGG + Intronic
1172807767 20:37625052-37625074 AGAGGGGTATGAAGCAAAGCAGG + Intergenic
1173172599 20:40739701-40739723 AGGCAGGTGTGGAGGGAGGCGGG - Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173304935 20:41839139-41839161 AGAAGGGAAGGGAAGGAAGCAGG + Intergenic
1174686919 20:52465131-52465153 AGACGGTCAGGGAGGGAAGCTGG - Intergenic
1176515546 21:7780813-7780835 AGGCAGGCATGCAGGGAAGCCGG - Intergenic
1178086615 21:29118727-29118749 AGATGAGTATGGAGGAAAGGAGG + Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178649574 21:34410825-34410847 AGGCAGGCATGCAGGGAAGCCGG - Intergenic
1180859044 22:19066641-19066663 AGCCCTGTAGGGAGGGAAGCTGG + Intronic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1182962165 22:34485444-34485466 AGAAGGGAAAAGAGGGAAGCAGG + Intergenic
1183250757 22:36728832-36728854 AGAGAGGTGTTGAGGGAAGCAGG - Intergenic
1183561972 22:38582211-38582233 AGAGGGGATAGGAGGGAAGCTGG - Exonic
1183578193 22:38705907-38705929 AGCCTGGGAGGGAGGGAAGCCGG + Exonic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184293171 22:43508923-43508945 AGATGGGGATGGAGGGATGGGGG - Intergenic
1184391614 22:44206531-44206553 AGACAGGGTGGGAGGGAAGCGGG - Exonic
1185062410 22:48613938-48613960 AGCCGGGGGTGGTGGGAAGCGGG - Intronic
1185299220 22:50070746-50070768 GGACGGGTCCGCAGGGAAGCAGG + Intronic
949734774 3:7159536-7159558 AGAGGGGGAAGGTGGGAAGCAGG - Intronic
949826232 3:8168594-8168616 AGAGGGGTATGGAATGAAGGTGG - Intergenic
951473365 3:23079597-23079619 AGCCTGATATGGAGGGAAACAGG - Intergenic
953312377 3:41891332-41891354 AGACGGGACTGGAGGGAGGGAGG + Intronic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
956643371 3:71435198-71435220 AGAAGGGAAGGAAGGGAAGCAGG + Intronic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
962367015 3:134793552-134793574 AGACGGGTAGGAGGAGAAGCAGG + Intronic
962715914 3:138125931-138125953 AGAGGGGTGGGGAGGGAGGCCGG + Intronic
965514681 3:169608307-169608329 ATAGGGGTATGCAGGAAAGCTGG - Intronic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
968235967 3:197030089-197030111 AGTCGGGGCTGGAGGGCAGCTGG + Intergenic
969058268 4:4415446-4415468 AGATGGGTATGGGGGGCGGCAGG + Intronic
969212986 4:5701945-5701967 AGGGGGCTATGGAGGGGAGCTGG - Intronic
969462253 4:7334950-7334972 AGACGGGTGTGGAGGGAGGGAGG + Intronic
969694560 4:8727357-8727379 AGACAGACACGGAGGGAAGCCGG - Intergenic
970708676 4:18836264-18836286 AGATGGGGATGGATGGTAGCTGG + Intergenic
971196565 4:24475805-24475827 AGAGGGGTAAGCAGGGAAGGAGG - Intergenic
972789471 4:42357259-42357281 AGAGGGGGAGGGAGGGAGGCGGG + Intergenic
972967117 4:44524262-44524284 AGACAGGAAGGGAAGGAAGCTGG + Intergenic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
976482669 4:85563025-85563047 AGAAGGGAAGTGAGGGAAGCAGG + Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
981514019 4:145587739-145587761 AGAAGGGGAAGTAGGGAAGCAGG + Intergenic
982125402 4:152179867-152179889 AAACGGGAATGGAGGGATTCTGG + Intergenic
982500746 4:156151751-156151773 AGATGGGAATGGAGGTGAGCAGG + Intergenic
985273400 4:188216158-188216180 AGACAGGGAAGGAGGGAAGGAGG - Intergenic
985273443 4:188216289-188216311 AGACAGGGAAGGAGGGAAGGAGG - Intergenic
985273480 4:188216396-188216418 AGACAGGGAAGGAGGGAAGGAGG - Intergenic
985754841 5:1707481-1707503 AGACGGCAAGGGAGGGGAGCTGG + Intergenic
986469844 5:8062772-8062794 AGACAGTCCTGGAGGGAAGCAGG + Intergenic
988974974 5:36506270-36506292 AGAAGAGAATGGAGGGAAGGGGG + Intergenic
990331271 5:54728304-54728326 AGAAGGATAAGGAGGGAAGGAGG + Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
991493792 5:67208545-67208567 GAAGGGGTCTGGAGGGAAGCAGG + Intergenic
992249944 5:74866495-74866517 AGCCGGGGCTGGAGGGAGGCAGG - Intronic
992939869 5:81751271-81751293 AGTCGGGGAGGGAGGGAAGGAGG - Intronic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
995127091 5:108589016-108589038 AGAGGGGCGTGGAGGGGAGCGGG + Intergenic
995183361 5:109249010-109249032 AGAAGGGGAGTGAGGGAAGCAGG + Intergenic
996979367 5:129471393-129471415 AGAGGGATAGGGAGGGAAGGAGG + Intronic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997955132 5:138273521-138273543 AGACAGATATGGAAGGAAGGAGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998638924 5:143987501-143987523 AGAAGGGAAGGGAGGGAAGGAGG - Intergenic
1000012843 5:157248956-157248978 AGACGTGTGTGGAGGCCAGCCGG - Exonic
1000614677 5:163413917-163413939 AGAGGGGAAGGGAGGGAAGGAGG + Intergenic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002665084 5:180817115-180817137 AGAGGGGTATGGAGGGAGAAGGG + Intergenic
1002742670 5:181444903-181444925 AGACGGGGATGGAGGGGGGATGG + Intergenic
1002889664 6:1321262-1321284 AGAGGGGTCTGCAGGGAACCTGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004624357 6:17360845-17360867 AGACAGGGAGGGAGGGAAGTGGG + Intergenic
1004664616 6:17738390-17738412 AGAAGGGTATGGAGGGACAGTGG + Intergenic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005825431 6:29628925-29628947 AAACAGGTAGGGAGGGAAGGGGG + Intronic
1007747114 6:44049988-44050010 AGCAGGGTGGGGAGGGAAGCAGG + Intergenic
1008742416 6:54625338-54625360 AGACTGGTATGAAGGCATGCAGG + Intergenic
1010776214 6:79888979-79889001 AGACGGGGGGGGAGGGAAGGAGG + Intergenic
1010899751 6:81411920-81411942 AGACTGGTATGTAGGGAAAATGG + Intergenic
1011765299 6:90612971-90612993 AGAAGGGTTTGGAGAGAGGCAGG + Intergenic
1013072810 6:106744188-106744210 AGACGGGCACAGAGGGAAGTGGG - Intergenic
1014999189 6:128192927-128192949 AGAGGGGGAAGGAGGGAAGGAGG + Intronic
1015194126 6:130506656-130506678 AGACAGAGATGGAGGGAAGCAGG + Intergenic
1015201636 6:130588224-130588246 AGATGGGATTGGAGGGTAGCAGG + Intergenic
1019247805 6:170720642-170720664 AGACGGGGATGGAGGGGGGATGG + Intergenic
1019281582 7:203024-203046 AGAGGGAGATGGAGGGAAGGTGG + Intronic
1019346519 7:533423-533445 AGACGTGGGTGGAGGGAAGGAGG + Intergenic
1019632604 7:2057939-2057961 AAAGGGGCATGGAGAGAAGCAGG + Intronic
1019742487 7:2681783-2681805 AGACAGGGATGGAGGGAGGAGGG + Intronic
1021719486 7:23491733-23491755 AGCCGGGGAGGGAGGGAAGTAGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023849135 7:44140597-44140619 AGACGGGGAGGAGGGGAAGCAGG + Intronic
1026019670 7:66697483-66697505 AGAAGGGAAGGGAGGGGAGCTGG - Intronic
1026162642 7:67883259-67883281 AGACGGGGAGGGAGGGAGGGAGG - Intergenic
1027141933 7:75663749-75663771 AGACGGGAATGGAAGGGAGTGGG + Intronic
1028716419 7:93976274-93976296 TGAAGGGGTTGGAGGGAAGCAGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032987963 7:137359744-137359766 AGACAGGAATGGAGGCAGGCAGG + Intergenic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034474835 7:151276198-151276220 AGAGGGGTATCCAGGGAAGACGG + Intronic
1035028548 7:155842985-155843007 AGACGTGGATGAAGGTAAGCTGG - Intergenic
1035036829 7:155901106-155901128 AGCCGGGTATTGAGAAAAGCTGG - Intergenic
1035500312 8:87222-87244 AGACGGGGATGGAGGGGGGATGG - Intergenic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1039466656 8:37789388-37789410 AGCCGGGTAAAGAGGGCAGCAGG - Intronic
1039525888 8:38216015-38216037 AGACTGGGATGGAGGAAAGAGGG - Intergenic
1041947970 8:63468205-63468227 AGATGGGAAGGGAGGGAGGCAGG - Intergenic
1042627393 8:70773269-70773291 ATATGGATATGCAGGGAAGCAGG + Intronic
1044666572 8:94639585-94639607 AGACGCGTGTCAAGGGAAGCTGG - Intergenic
1044850230 8:96420129-96420151 AGACAGGGATGGAGGGAACTAGG + Intergenic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048466099 8:134665832-134665854 AGAGGGGTATGGAGGGGCACAGG - Intronic
1048852453 8:138657981-138658003 TTACGAGGATGGAGGGAAGCAGG - Intronic
1049003742 8:139841920-139841942 AGACAGGGCAGGAGGGAAGCTGG + Intronic
1049997776 9:1047796-1047818 AGACGGGTGTGTAGGGAGGGTGG + Intergenic
1053302043 9:36959170-36959192 AGAAGGGTCTGGTGGGAAGAGGG - Intronic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059138398 9:111829488-111829510 AGACAGGGAGGGAGGGAAGGAGG - Intergenic
1060835649 9:126753514-126753536 AGACGTGTCTGGACAGAAGCAGG - Intergenic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061274325 9:129560850-129560872 AGACTGGGGTGGAGGGAACCTGG + Intergenic
1062454261 9:136628389-136628411 AGACGGTTGTGGAGGCCAGCTGG + Intergenic
1062494993 9:136827452-136827474 AGGCGGGACTGGAGGGGAGCCGG - Intronic
1203608577 Un_KI270748v1:76122-76144 AGACGGGGATGGAGGGGGGATGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186420308 X:9420322-9420344 AGAGGGGGATGAAGGGAAGGAGG - Intergenic
1187041857 X:15604717-15604739 AAAGGGGTAAGGATGGAAGCAGG + Intergenic
1188520178 X:31030076-31030098 AGAAGGGGAAGGAGGAAAGCAGG + Intergenic
1189550449 X:42087238-42087260 AGAAGGGAATGGAGGAAAGTGGG - Intergenic
1189644632 X:43114744-43114766 AGACAGGAATGGGGTGAAGCAGG - Intergenic
1189984650 X:46543572-46543594 AGAGGTGGATGCAGGGAAGCAGG - Intronic
1190713744 X:53087565-53087587 AGAGGGAGATGGAGGGAGGCAGG - Intronic
1194721560 X:97346414-97346436 AGACGGAGAAGGAGGGAAGGGGG - Intronic
1195416785 X:104628987-104629009 AGACGGGTATGGATAGAAATGGG + Intronic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1198631356 X:138642209-138642231 AGAGGGTGAGGGAGGGAAGCAGG + Intronic
1199679512 X:150215383-150215405 AGAGGGGGAAGGAGGGAAGGAGG + Intergenic
1199695719 X:150341666-150341688 AGAGGGGGAAGGAGGGAAGGAGG - Intergenic
1201256410 Y:12112289-12112311 AGAGGGAGATGGAGGGAAGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic