ID: 1119119495

View in Genome Browser
Species Human (GRCh38)
Location 14:72061058-72061080
Sequence CCTCCTCCTCTGAAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119119489_1119119495 23 Left 1119119489 14:72061012-72061034 CCTAAAGGCTGCAAATATTCTGG 0: 1
1: 0
2: 0
3: 22
4: 227
Right 1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG 0: 1
1: 0
2: 0
3: 16
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119119495 Original CRISPR CCTCCTCCTCTGAAGGTAGA TGG Intronic
900142009 1:1142640-1142662 CCTCGGCCTCTGAAGGCAGCCGG + Intergenic
901086699 1:6615106-6615128 CCGCCTCCTCGGAAAGCAGATGG - Intronic
902216861 1:14939832-14939854 GCTCCTCCTCTGGAGGCAGAAGG + Intronic
902504661 1:16931329-16931351 GCTCCTCCTCTGGAGGCAGGTGG + Exonic
902538773 1:17137611-17137633 TCTTCACCTCTGAAGATAGAGGG + Intergenic
902539476 1:17143635-17143657 GCTCCTCCTCTAAGTGTAGAAGG - Intergenic
902657876 1:17881979-17882001 CCTCCTCCTCTGCCTGCAGAGGG - Intergenic
903996310 1:27307314-27307336 CCTGCTGCTCTGAGGGGAGAGGG + Exonic
904351952 1:29914182-29914204 CAGCCTCCTCTGTAGGTAGGTGG + Intergenic
904385094 1:30135944-30135966 CAGCCTCCTCTGCAGGTAGGTGG - Intergenic
904628669 1:31824756-31824778 CCCCCTCCTCTGATGTGAGAAGG - Intergenic
905172259 1:36116214-36116236 CCTCCTCCCCTGAGGGAAGCAGG + Intronic
905471084 1:38192386-38192408 CCTCATCCTCTGTGGGTACAAGG + Intergenic
906188197 1:43877810-43877832 GCCCCTTCCCTGAAGGTAGAGGG + Intronic
907281409 1:53349576-53349598 GCTCCTCCTCTGTAGCTTGATGG - Intergenic
910971731 1:92862694-92862716 TCTACTGCTCTGAAGGTAAAAGG + Intronic
914433605 1:147641115-147641137 CAGCCTCCTCTGCAGGTAGATGG + Intronic
915063286 1:153204232-153204254 CCTGTTCCTCTGAAGATAGATGG - Intronic
915273593 1:154772887-154772909 CCACCTCCTGAGAAGGAAGAGGG + Intronic
915427367 1:155837723-155837745 CCTCCTCCTCTGAAGCTGAAGGG + Intronic
915468996 1:156114656-156114678 GGTCCTCCTCTGAAGGGAGGAGG - Intronic
915999867 1:160605557-160605579 CCTACTCCAGTGAAGGTAGCAGG + Intergenic
916472197 1:165135342-165135364 TCTCCTACCCTGAAAGTAGATGG + Intergenic
919582963 1:199400350-199400372 ACTCATTCTCTGAAGGTAGATGG - Intergenic
922295099 1:224243207-224243229 CCTCAGCCTCCCAAGGTAGAGGG - Intronic
922546464 1:226461166-226461188 CTACATCCCCTGAAGGTAGAAGG + Intergenic
922929463 1:229377482-229377504 CCGCCTCCCCTGCAGGGAGAAGG + Intergenic
923184528 1:231558057-231558079 CCTCATCCTGTGAAGGGTGAGGG - Intronic
923243227 1:232106062-232106084 CCTCCTGCTCTGCAGGTGAAGGG - Intergenic
1064222454 10:13453600-13453622 GCTCTTCATCTGATGGTAGATGG - Intronic
1065709338 10:28500429-28500451 CCTCCTCCCCTGAAACTAAAAGG - Intergenic
1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG + Intergenic
1066117573 10:32253972-32253994 CCTCCTCCTCTGCAGGGTAAAGG - Intergenic
1068620395 10:59176157-59176179 CCTCCTCCCCTGAAGGTCCCAGG - Intergenic
1069357733 10:67606956-67606978 CTTCCTCCACAGAAGCTAGAAGG + Exonic
1069769870 10:70891377-70891399 CCTCCACCAGTGAGGGTAGAGGG + Intergenic
1070283505 10:75067378-75067400 CCTCTTCATCTGAAGTCAGAGGG - Intergenic
1070519067 10:77236046-77236068 CCTGCTCCCCTGGAGGTGGATGG - Intronic
1070628132 10:78065842-78065864 CCTCCCCCTCTGCAGGTGGCTGG - Intergenic
1072496660 10:95967933-95967955 CCTCTTTCTCAGAAGGGAGAAGG - Intronic
1073304538 10:102492624-102492646 CCTGCTCTTCTGCAGGAAGAGGG + Intronic
1073501575 10:103943007-103943029 CATCCTCCTCTGCAGCCAGATGG + Intergenic
1076211245 10:128646714-128646736 TGTCCTCCTCTGAAGGAAGGAGG - Intergenic
1077011448 11:380998-381020 CCTCCTCCTCTGAATGGGGAAGG + Intronic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1080030046 11:27650706-27650728 CCTCTTCCTCTGACAGTTGAGGG + Intergenic
1080360744 11:31510102-31510124 TCTCCTCCTCCGAAGGTTTAGGG - Intronic
1081557792 11:44182239-44182261 CCTTCTCCTGTCAAGGTTGAGGG + Intronic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1083940317 11:65891921-65891943 CCGCCTCCTCTGAGGCTGGAAGG + Intergenic
1084249277 11:67883782-67883804 CCAGCTGCTCTGAAAGTAGATGG - Intergenic
1084549327 11:69831441-69831463 CCACCTCCTCAGAAGGTGCATGG + Intergenic
1084823527 11:71711686-71711708 CCAACTGCTCTGAAAGTAGACGG + Intergenic
1085978630 11:81693968-81693990 GCTCCTCTTCTGGAGGTAGTGGG - Intergenic
1086981148 11:93198634-93198656 GCTCCAGCTCTGAAGGCAGAAGG - Intergenic
1087866076 11:103228573-103228595 CCTGCTCCACTGGAGGTAGCAGG + Intronic
1087906534 11:103704053-103704075 CCTACACCTATGAAGGAAGACGG + Intergenic
1089278225 11:117354129-117354151 CCTGCTCCTCGGAAGGCTGAGGG - Intronic
1089771552 11:120806815-120806837 CCCCCTCGTCTGATGGTTGAAGG + Intronic
1090307326 11:125702599-125702621 CCTCCTCCAGTGGAGGTAGCTGG - Intergenic
1090945619 11:131426972-131426994 TCTCCACCTCTGAAGGTCAAAGG - Intronic
1092519055 12:9247663-9247685 CCTCCAGCTCTAAAGGTAAATGG + Intergenic
1092641053 12:10510232-10510254 CCCCTTCCTCTGCAGGTAAAAGG + Intronic
1092882716 12:12900464-12900486 CCTCCTCCCCTTTAGGGAGAAGG - Intronic
1092984350 12:13831148-13831170 CTGCTTCCTCTGAAGGTGGAAGG - Intronic
1096409093 12:51364530-51364552 CCTCCGCCTTTGGGGGTAGAGGG - Intronic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1097978115 12:65709548-65709570 CCTCCGCCTCTGAGGTTAAAGGG + Intergenic
1100544594 12:95589732-95589754 CCTCGGCCTCTGAAAGTAGTGGG + Intergenic
1104553988 12:129783289-129783311 TCTGACCCTCTGAAGGTAGATGG - Intronic
1105506819 13:21017423-21017445 CCTCGGCCTCTCAAGGTACAGGG + Intronic
1106477951 13:30114419-30114441 CCTTCTCCTTTGAAGATAAAGGG - Intergenic
1107112660 13:36714780-36714802 TCTCCTCCTCTCAAGGTAGCTGG - Intergenic
1107384031 13:39888976-39888998 CTTTCATCTCTGAAGGTAGAGGG + Intergenic
1107538243 13:41357673-41357695 TCTGCTCCTCTGTAGTTAGAGGG + Intronic
1110117454 13:71837495-71837517 GCTTCTCCACTGTAGGTAGAAGG + Intronic
1111651145 13:91092443-91092465 CCTCCACCTTTGAATGTAGCAGG - Intergenic
1117917974 14:60698578-60698600 CCTCAGCCTCTGAAAGTACAGGG + Intergenic
1118927347 14:70204842-70204864 CAGCCTCTTCTGCAGGTAGAAGG - Intergenic
1119031526 14:71196582-71196604 CCACCTCCTTTGAAGGTGGTTGG - Intergenic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1119466713 14:74863912-74863934 CTTCCTCCTCTGCACTTAGAAGG + Intronic
1120859049 14:89238082-89238104 TTTCCTCCTTTAAAGGTAGAGGG - Intronic
1121219038 14:92272048-92272070 CCTCTTCCTCTGGAGGAGGAAGG - Intergenic
1127108158 15:55639734-55639756 CCTCCTCCAGTGCAGGAAGATGG + Exonic
1128525177 15:68407457-68407479 CCGCCTCCTTTTATGGTAGATGG + Intronic
1130316538 15:82801420-82801442 CAGCCTTCTCTGATGGTAGACGG + Intronic
1130577029 15:85102166-85102188 CCTCCTTCTCTGGAGGTGGGTGG - Intronic
1130755678 15:86760545-86760567 CCTGCTCCTGTGAATGTAAATGG + Intronic
1131033273 15:89204206-89204228 CCTCCTCATCTGATGATAGTTGG + Intergenic
1133037965 16:3045449-3045471 CCTCCTCCTGGGCAGGCAGATGG - Intergenic
1133416167 16:5608755-5608777 CCCTATCCTCTGAAGGTAGCTGG + Intergenic
1134243105 16:12520249-12520271 CCTCCTCTTCACAAGGCAGATGG + Intronic
1134525806 16:14942435-14942457 CACCCTCTTCTGAGGGTAGAGGG + Intronic
1134581313 16:15373198-15373220 CACCCTCTTCTGAGGGTAGAGGG - Intronic
1134713389 16:16340929-16340951 CACCCTCTTCTGAGGGTAGAGGG + Intergenic
1134721259 16:16384287-16384309 CACCCTCTTCTGAGGGTAGAGGG + Intronic
1134946167 16:18327597-18327619 CACCCTCTTCTGAGGGTAGAGGG - Intronic
1134953430 16:18367741-18367763 CACCCTCTTCTGAGGGTAGAGGG - Intergenic
1135061069 16:19271918-19271940 CCTCCTCCTCTTCAGGTAGGAGG + Intergenic
1135659872 16:24286916-24286938 CCTCCTGCTGTGAAGGAGGAAGG + Intronic
1136510747 16:30737102-30737124 CCTCCTCCTCTTGGGGTAGGCGG - Exonic
1137563998 16:49522009-49522031 CCTCCCCCTCTGGGGTTAGAGGG - Intronic
1138179504 16:54932307-54932329 CCCCCTCCTCAGAAGGCAGCGGG - Intronic
1138190055 16:55007509-55007531 CCCCCTCCTCAGCAGGTACACGG - Intergenic
1141262523 16:82466938-82466960 GCTACTCCTATGAAGGTAGTAGG + Intergenic
1141376238 16:83533411-83533433 CCTCCTCCTCTGTGGGCAGCAGG + Intronic
1142747493 17:1967144-1967166 GCTCCTCCCCAGAAGGAAGAGGG + Intronic
1143177422 17:4964186-4964208 CCTCCTCCTCCAGAGGCAGAGGG - Intronic
1143805515 17:9422812-9422834 TCGCCACTTCTGAAGGTAGATGG - Intronic
1143858412 17:9869892-9869914 CCTCCACTTTTGAAGGCAGAAGG + Intronic
1146628681 17:34454479-34454501 CCACCTCCTCTGATGGGAGTAGG + Intergenic
1147611732 17:41805805-41805827 CCTCCTCCTCTGGGGTTGGATGG + Intronic
1148988317 17:51643744-51643766 CCTCCTCCCCTGAGGGAAGCTGG + Intronic
1149759112 17:59213498-59213520 TGTCATCCTCTCAAGGTAGAGGG + Exonic
1151902631 17:77026989-77027011 CCCCCTCCTCTGAAGATGGCTGG - Intergenic
1152248021 17:79196023-79196045 CAGCCTCCTCTGAAGGCAGAGGG + Intronic
1154206443 18:12341172-12341194 CACCCTCCTTTGAAGGAAGAGGG + Intronic
1155170470 18:23263347-23263369 CCTTCTCCTCTGCAGGGAAAAGG - Intronic
1155291510 18:24347296-24347318 CCAGCTACTCGGAAGGTAGAAGG - Intronic
1163725877 19:18922770-18922792 CCTCCTCCTTTGAAGGGCGGTGG - Intronic
1164406946 19:27957580-27957602 CCTCCTCCTTTGATGCTGGAAGG - Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1165939004 19:39406044-39406066 CCTCATCCTCTGAAAGTACTGGG + Intergenic
926774092 2:16405049-16405071 ACTCCTCTCCTGGAGGTAGAAGG + Intergenic
926776371 2:16427461-16427483 CCGCCGCCTATGAATGTAGATGG + Intergenic
927038540 2:19205093-19205115 CCTCCTCATCTGAAGGATGGAGG + Intergenic
927666412 2:25035990-25036012 CCTACTTCTCTGAAGCTACAGGG - Intergenic
927704223 2:25287062-25287084 CCTCCTGCACTCAAGCTAGAGGG + Intronic
928199152 2:29236218-29236240 CCTCCTCATCTGGAGATGGAGGG + Intronic
928999596 2:37332985-37333007 CCTACTCCGCTGAAGGAAGCGGG + Intergenic
929523379 2:42676150-42676172 GCTCCTCCTCTGAAAGCAAATGG + Intronic
929967370 2:46545194-46545216 CATCCTCCAATGAAGGTAGAAGG - Intronic
930025701 2:47028015-47028037 CCTCCACAGCTGAATGTAGATGG + Intronic
931075272 2:58704070-58704092 TTTCCTCCTCTGAAGGTATATGG - Intergenic
931089562 2:58870923-58870945 CAGCCTCCTTTGAAGGTGGATGG - Intergenic
931442934 2:62304203-62304225 ACTTCTCCTCTGGAGGCAGATGG - Intergenic
932618520 2:73251571-73251593 CTCCCTCCTCTGAGGGCAGAAGG + Intronic
934770972 2:96907446-96907468 CCTCCTCCTCTGAACCTGGTTGG - Intronic
935216650 2:100980247-100980269 CCGCCTCCACTGCAGGTGGAAGG + Intronic
938641172 2:133281983-133282005 CCTGCTCCTCTGAGGATGGATGG - Intronic
941721040 2:168813215-168813237 CTTCCTGCTCTGCAGGCAGAAGG - Intronic
942231008 2:173860851-173860873 CCTCTTCCTCTGAGGGCGGAGGG + Intergenic
942627315 2:177915833-177915855 ACTCCTCCTTTGAAGGGACAGGG - Intronic
943582238 2:189698674-189698696 GCTCCTCCTCTAACGGAAGATGG - Intronic
944061908 2:195578739-195578761 CCTCATCCTCTCCAGGTAGCTGG + Intronic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
948540631 2:238689418-238689440 CCTCCTCCTCTGTAGCCTGAAGG + Intergenic
1170351669 20:15448095-15448117 CCTTCTGCTTGGAAGGTAGAAGG + Intronic
1170548763 20:17457439-17457461 CCTTTTCTTGTGAAGGTAGAGGG - Intronic
1170777052 20:19384565-19384587 CCTATTCATCTGTAGGTAGATGG + Intronic
1172025272 20:31944124-31944146 CCTCATGCTCTGAAGGCAGAAGG - Exonic
1172090593 20:32429386-32429408 CTGACTCCTCTGAAGGTAAACGG + Exonic
1172601576 20:36187523-36187545 CCTCCTGCTCTGAGGGCAGAGGG + Intronic
1172752171 20:37258552-37258574 CCTCCAGCTCTGCAGGTACAGGG - Intronic
1173648786 20:44650297-44650319 CACCCTCCTCAGAAGGTAGGTGG + Intronic
1174181266 20:48676470-48676492 CCTCCCACTCTGTAGGTGGAAGG - Intronic
1175868345 20:62193657-62193679 TCTCCTCCTCAGAAGGCACAGGG + Intronic
1177708265 21:24737316-24737338 ACTCCTGCTCTGATGGTAGTAGG + Intergenic
1178601003 21:33994055-33994077 CTTCCTCCTCTGAGGGCACAGGG + Intergenic
1180096155 21:45556015-45556037 CCTAATCCTCTGAAGGTCGGAGG + Intergenic
1180137424 21:45870830-45870852 CATCCTGTTCTGAAGGCAGAGGG + Intronic
1183102477 22:35592480-35592502 CCTCCTCCTCTGGAGGCACTGGG + Intergenic
1184147491 22:42619874-42619896 GCTCCTCCTCTGGGGGTGGAAGG + Exonic
1185087832 22:48750142-48750164 CCTCCTCCTCTGAGGACAGCAGG - Exonic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
949438919 3:4059343-4059365 CCTCCTCCTATGAGCATAGAAGG - Intronic
952040108 3:29251344-29251366 CCTCCTCAGCTGAAGATGGAGGG - Intergenic
952375564 3:32764370-32764392 CCTCGGGCTCAGAAGGTAGAGGG - Intronic
954450019 3:50566808-50566830 CCTCCTCCCCTGGAAGCAGAGGG + Intronic
954752862 3:52823495-52823517 CCTCCACCTCTGCAGCCAGAGGG - Intronic
954869417 3:53756416-53756438 CCTCCTCCCCTGAGGTGAGATGG - Intronic
957063548 3:75501966-75501988 CCAACTGCTCTGAAAGTAGACGG - Intergenic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959225829 3:103583039-103583061 CCTCCTCCTCTGAAAGTGCTGGG + Intergenic
963474671 3:145789876-145789898 CAACCTCCCCTGAAGGAAGAGGG - Intergenic
963492396 3:146017833-146017855 CCCCCTCCTCTGAAACTAAAAGG + Intergenic
965758161 3:172046154-172046176 CATCCTCATCTGTATGTAGATGG - Intronic
965980249 3:174681437-174681459 CCCTCTCCTCTGCAGGCAGAGGG - Intronic
968234258 3:197022500-197022522 TTTCCTCCTCTGCAGGCAGATGG + Intronic
968551613 4:1226336-1226358 CCTCCTCCTCCCCAGGGAGACGG - Intronic
969480512 4:7444612-7444634 CTTCTTCCTCTGAGGGTAGTGGG + Intronic
969514172 4:7637353-7637375 TCTCCTCTGCTGAAGGTAGTGGG + Intronic
969746178 4:9074096-9074118 CCAACTGCTCTGAAAGTAGACGG + Intergenic
969805536 4:9605514-9605536 CCAACTGCTCTGAAAGTAGACGG + Intergenic
970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG + Intronic
973048103 4:45561369-45561391 CCTCAGCCTCTGAAGGTACCGGG + Intergenic
973197876 4:47466281-47466303 CCTTCTCCTCTGAAACCAGAAGG - Intergenic
974008415 4:56584215-56584237 CCTCCACCTTTCAAGGCAGAGGG + Intronic
975931584 4:79530476-79530498 CCTCTCCCTCTGATGGTGGAGGG - Intergenic
976068546 4:81216239-81216261 CCTCCTCCTCTGAAACTTAATGG - Intergenic
980795703 4:137679891-137679913 CCTCCTCCTCAGAAAGGAGAAGG - Intergenic
983640874 4:169942969-169942991 CCTCATCCTCTGGGGGCAGAAGG + Intergenic
985546775 5:513903-513925 CCTCTCCCTCTGAAGGCAGGCGG + Intronic
986243260 5:5980605-5980627 CCTCTTCCCCTGAAGCCAGAGGG - Intergenic
986634048 5:9802183-9802205 CCTGCTCCCATGAAGGTAGCAGG - Intergenic
987081957 5:14433360-14433382 CCTCCTGCTCTGGAGGGAAAGGG - Intronic
989985256 5:50689753-50689775 CTTCCTCCTCAGTTGGTAGAAGG + Intronic
993638449 5:90373544-90373566 CCACCCCCTCTGAAGTTAGGTGG - Intergenic
994190073 5:96859471-96859493 CATTCTCCTCTGTAGGTGGATGG + Intronic
994338492 5:98598249-98598271 CACCCTCCACTGAAGGGAGAGGG + Intergenic
994987222 5:106952048-106952070 CCTCCACATCTGAAGTCAGAGGG - Intergenic
995418596 5:111937096-111937118 CCCTCTCCTCTGAAGGTGAAAGG - Intronic
995533673 5:113114949-113114971 TCTCCACCACTGAAGGCAGAGGG - Intronic
995964559 5:117888912-117888934 CCTCTTGCTCTGAAGATAAAAGG - Intergenic
997231042 5:132243390-132243412 CCTGCTCCTGTGGAGGTAGCAGG + Intronic
997788491 5:136735721-136735743 CCCCCTCCTCTGAAACTAAAAGG + Intergenic
997966727 5:138363091-138363113 CCTAACCCTCAGAAGGTAGAGGG + Intronic
998098157 5:139409363-139409385 CCTCAGCCTCTGGAGGTAGCTGG + Intronic
998902387 5:146870099-146870121 CCTCCTCCACTTGACGTAGAAGG - Intronic
1001461071 5:171914930-171914952 CATCCTCCTCTTCAGGGAGAAGG - Intronic
1002937644 6:1687345-1687367 CCTCCTCCCCTGGAGGTTGGAGG - Intronic
1003141028 6:3471411-3471433 CGTGCTCCTTTGAAGGAAGAAGG - Intergenic
1004012370 6:11702108-11702130 CTTCCTCCTGTGAAGGATGAAGG - Intergenic
1005152929 6:22773135-22773157 CCTCTTTCTCTTTAGGTAGAAGG + Intergenic
1005601061 6:27426423-27426445 CCTCCTCCTCTGCCTTTAGAAGG + Intergenic
1006134008 6:31884793-31884815 TCTCCTCCTGTGGAGGTAGGAGG + Exonic
1006321868 6:33323907-33323929 CCTCCTCCTCTTCGGGGAGAGGG + Intronic
1006911834 6:37568246-37568268 CCTCCTTGTCTGAAGTTAGTGGG - Intergenic
1007111355 6:39314948-39314970 CTTCCTCCACTCCAGGTAGAGGG - Exonic
1010099161 6:72082664-72082686 GCTCCTACTCTGAGTGTAGAAGG - Intronic
1010315422 6:74443169-74443191 CCTCAGCCTCCCAAGGTAGATGG + Intergenic
1012011202 6:93788146-93788168 CCTCTTCTTTTGAAGGTAGGTGG + Intergenic
1012394996 6:98786016-98786038 CCTCCTCCGCTGGAGGGAAAAGG - Intergenic
1016290654 6:142525413-142525435 CCCCCTCCTGGGAAAGTAGATGG + Intergenic
1018236178 6:161725898-161725920 CCTCCTGCTCTGACAGTATATGG - Intronic
1018247151 6:161834303-161834325 CTTCTTCCTTTGCAGGTAGAAGG + Intronic
1018560532 6:165097588-165097610 CCTCCACCTATGAAGGGCGAAGG - Intergenic
1020705502 7:11538822-11538844 CCTCCTCCTTAGAAGGGAAATGG + Intronic
1021770838 7:23999424-23999446 CCTCCTCATCTCAAGAAAGAGGG - Intergenic
1023689027 7:42766993-42767015 CTTCCACCTCTGCAGCTAGATGG + Intergenic
1026620266 7:71944100-71944122 GCTCCTTCTCAGAAGGAAGATGG - Intronic
1027436829 7:78173401-78173423 CCTCCTCCTCCAAAAGCAGAAGG - Intronic
1028813126 7:95111827-95111849 TCTCCCCCTCTGAGGGGAGAAGG + Intronic
1030455851 7:109772913-109772935 CCTGCTCCGATGGAGGTAGAAGG - Intergenic
1031634902 7:124090844-124090866 CCACCCCAGCTGAAGGTAGAGGG - Intergenic
1032739530 7:134724842-134724864 CCTCCTCTTCTGAGGTTGGATGG + Intergenic
1033286594 7:140046693-140046715 CCACCTAGTCTGGAGGTAGAAGG - Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1035121563 7:156572805-156572827 CCTCCTCCTCCCAAGGGAGCGGG + Intergenic
1035477041 7:159151170-159151192 GCTCCTCATCTGAAGGAAAAAGG + Intergenic
1036772473 8:11588601-11588623 CCTCTGCCCCTGGAGGTAGAAGG + Intergenic
1037157961 8:15728830-15728852 CCTCCTCCTCCGGAAGGAGAAGG - Intronic
1037924873 8:22836330-22836352 CCCCCTGCTCAGAGGGTAGAGGG + Intronic
1038658063 8:29472353-29472375 CTTCCTCCTCTGAGGATTGAGGG - Intergenic
1039393841 8:37205593-37205615 CATGTTCCTCTGAAGGTGGATGG - Intergenic
1039811199 8:41049758-41049780 CCTGCTCCAGTGAAGGTAGCAGG - Intergenic
1045655779 8:104384944-104384966 CCTCCACCTCTGAAGGTTGGTGG + Intronic
1047253961 8:123201712-123201734 CTTCCTCCGCTGAGGCTAGAGGG + Intronic
1048664037 8:136641150-136641172 CCTCCTCCCTTGTAGCTAGAAGG - Intergenic
1048957190 8:139546883-139546905 CCTACCGCTGTGAAGGTAGAGGG - Intergenic
1049140998 8:140954055-140954077 CCTCCTCCTGTGGAGGTTCAAGG + Intronic
1049662383 8:143825313-143825335 GCTCCTCCTCTGGAGGCTGAAGG - Intronic
1050779484 9:9313601-9313623 CCTCCTCCCCTTAAGAGAGATGG - Intronic
1051428582 9:16959599-16959621 TCTCCACCCCTTAAGGTAGATGG - Intergenic
1051785447 9:20737841-20737863 CAGCCTCCTCTGAAGGTCTATGG - Intronic
1052483490 9:29063648-29063670 CCTCCACCTCTGAAAGTGTATGG + Intergenic
1053023841 9:34714714-34714736 CCTCCTCCAGGGGAGGTAGAGGG - Intergenic
1053128932 9:35604792-35604814 CAACCTCCCGTGAAGGTAGAAGG + Intergenic
1055479056 9:76692066-76692088 TCTCATCCTCAGAAGGTAGGTGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057684696 9:97221783-97221805 TCTCCTCCTCCGAAGAGAGATGG + Intergenic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1059299152 9:113298701-113298723 CCTCCTCCCCTTGAGCTAGAGGG + Exonic
1062372511 9:136247374-136247396 CCTCCTACTCTGCAACTAGAAGG - Intergenic
1187207370 X:17196137-17196159 CCTCCTCCTCCCAAGGCAGTAGG - Intergenic
1188031197 X:25266134-25266156 CCTCACCGTATGAAGGTAGAGGG - Intergenic
1188805169 X:34579132-34579154 CCCCCTCCTGTGAATGGAGAAGG + Intergenic
1189406511 X:40730244-40730266 CCTCCTACTCTTAGGGTAGACGG + Intronic
1194112661 X:89854316-89854338 CCCACTCCCCTGAAGGTTGAGGG + Intergenic
1194389384 X:93297421-93297443 CCCCCTCCTCTAAAAGTTGAAGG - Intergenic
1194640243 X:96395170-96395192 CCTCCTACTTAGAAGCTAGAAGG - Intergenic
1194817109 X:98456120-98456142 ACTTTTCCTTTGAAGGTAGATGG + Intergenic
1195516036 X:105776978-105777000 CCTCCACCTGAAAAGGTAGATGG - Intergenic
1195971457 X:110478019-110478041 CCTCCTCCTGTGAAAGTGGGAGG - Intergenic
1195972768 X:110491648-110491670 CCTGCTCCACTGGAGGTAGCAGG + Intergenic
1198270589 X:135052357-135052379 CCTACTCCTCTGAGGCTACACGG - Intergenic
1198383457 X:136105452-136105474 CCTCCTTCTTTGAAGGGAGGAGG + Intergenic
1200465314 Y:3509127-3509149 CCCACTCCCCTGAAGGTTGAGGG + Intergenic