ID: 1119119705

View in Genome Browser
Species Human (GRCh38)
Location 14:72063228-72063250
Sequence TCCTTTTCGGTCCCCTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119119705_1119119707 -10 Left 1119119705 14:72063228-72063250 CCAGTAAAGGGGACCGAAAAGGA 0: 1
1: 0
2: 1
3: 21
4: 169
Right 1119119707 14:72063241-72063263 CCGAAAAGGAGCAGCCATTGAGG 0: 1
1: 0
2: 2
3: 16
4: 177
1119119705_1119119708 -3 Left 1119119705 14:72063228-72063250 CCAGTAAAGGGGACCGAAAAGGA 0: 1
1: 0
2: 1
3: 21
4: 169
Right 1119119708 14:72063248-72063270 GGAGCAGCCATTGAGGAGAGAGG 0: 1
1: 2
2: 2
3: 49
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119119705 Original CRISPR TCCTTTTCGGTCCCCTTTAC TGG (reversed) Intronic
901427195 1:9189841-9189863 TCCTTTTCAGTCTCCTCTGCTGG + Intergenic
902912210 1:19608120-19608142 TTCTTTTCCTTCCCCTTTCCAGG - Intronic
904617891 1:31759818-31759840 TCCTTCTAGGTCCCCTTCCCGGG - Intronic
904730653 1:32588512-32588534 TCCTTCTCAGTCTCCTTTGCTGG - Intronic
904809878 1:33156532-33156554 TCCTTCTCGGTCTCCTTGGCTGG + Intronic
906198292 1:43943357-43943379 TCCTTTTTGGTTTCCTTCACTGG - Intergenic
906404563 1:45531465-45531487 TCTTTTTATCTCCCCTTTACGGG - Intergenic
907217272 1:52875051-52875073 TCCTTCTCAGTCTCCTTTTCTGG - Intronic
907393472 1:54173990-54174012 TCATTCTCAGTCCCCTTTCCTGG - Intronic
907747305 1:57226053-57226075 TCCTTCTCAGTCCCTTTCACTGG + Intronic
908689231 1:66758755-66758777 TCCATTTTGGTCACTTTTACTGG - Intronic
911458559 1:98159653-98159675 TTCTTCTGGGTCCCTTTTACTGG - Intergenic
912446724 1:109741998-109742020 TCCTTTTCAGACTCCTTTGCTGG - Intronic
912560136 1:110545334-110545356 TCCTTCTCAGTCTCCTTTGCTGG + Intergenic
914678305 1:149920751-149920773 TCCTTTGTAGTCCCCTTTGCTGG + Intergenic
915506492 1:156360182-156360204 TCCTTCTCCGTCTCCTTTGCTGG + Intronic
917218538 1:172703097-172703119 TTCTTTTCCCTCTCCTTTACTGG - Intergenic
917921190 1:179751293-179751315 TCCTTCTCTGTCTCCTTTTCAGG - Intronic
917959482 1:180130945-180130967 TCCTTCTCAGTCTCCTTTACTGG - Intergenic
918120363 1:181532843-181532865 TCCTTGTCTATCTCCTTTACTGG + Intronic
919342933 1:196336886-196336908 TCCTCTTTGGTCTCCTTTGCTGG + Intronic
920534264 1:206727513-206727535 TCCTCTTAGGCCCCCCTTACTGG + Intronic
921063530 1:211606689-211606711 TCCCTTTCTGTCTCCTTTACTGG + Intergenic
921107946 1:212001826-212001848 TCCTTTTCAGGCCCCTTTGCTGG + Intronic
921576871 1:216845570-216845592 TCCTGTTCTGTGCCCTTTCCTGG + Intronic
922985643 1:229864233-229864255 TCCTTCTCCTTCCCCTTAACAGG + Intergenic
923186177 1:231575773-231575795 TGCTTCTCAGTCTCCTTTACTGG + Intronic
923789260 1:237097584-237097606 TCCATTTTGGTCTCCTATACTGG - Intronic
1063686166 10:8239111-8239133 TTCTCTTTGGTCCCCTTTTCTGG + Intergenic
1067367833 10:45651700-45651722 TCCATTTCTGTTCCCTATACTGG + Intronic
1068206613 10:53863310-53863332 TCCTTCTCAGTCTCCTTCACTGG - Intronic
1069651699 10:70053709-70053731 TCCCCTTCGGTTCCCTTTCCGGG + Intronic
1070118129 10:73549145-73549167 TCCTTATCAGTCTCCTTTGCTGG + Intronic
1071102442 10:82054666-82054688 TCGTTTTCATTCCCCTTTGCTGG - Intronic
1071497657 10:86179864-86179886 TCCTCTTCTCTCCACTTTACGGG - Intronic
1071807876 10:89143948-89143970 TCCTTTTCAGTCTCATTTACAGG + Intergenic
1072893560 10:99346360-99346382 TCCTCCTCAGTCTCCTTTACTGG + Intronic
1073993944 10:109294695-109294717 TTCTTTTCTGTCCCATTTTCAGG - Intergenic
1075771405 10:124940352-124940374 TCAGTTTTGGTCTCCTTTACAGG + Intergenic
1077621537 11:3729283-3729305 TGCTTCTCAGTCCCCTTTACTGG - Intronic
1077763425 11:5129740-5129762 TGCTTTTTGGTCTTCTTTACAGG - Intergenic
1080587711 11:33696660-33696682 TCCTTTTCATTCTCCTTTGCAGG + Intergenic
1081538449 11:44012899-44012921 TCCTTCTTGGTGTCCTTTACTGG + Intergenic
1086079763 11:82890892-82890914 TCCTTCTCAGTCTCCTTAACTGG + Intronic
1087130055 11:94661120-94661142 TCTTTCTCGGTCCCCTTTGCTGG + Intergenic
1087613217 11:100458549-100458571 TCCTTCTTGGTCTCCTTTGCTGG - Intergenic
1088136359 11:106560528-106560550 TCCTTTTCAGTCTCTTTAACTGG - Intergenic
1089083292 11:115795650-115795672 TCCTTTTATCTCCCCTTTTCGGG - Intergenic
1090382050 11:126334201-126334223 TCTGTTTCTGTCCCCTATACTGG - Intronic
1093396042 12:18683725-18683747 TCCTTTCCTGACCCCTTTTCAGG - Intronic
1095861231 12:46920048-46920070 TTCTTTTCAGTCCACTTTTCAGG + Intergenic
1098298383 12:69028062-69028084 TCCTTCTCAGTCTCCTTTCCAGG + Intergenic
1100661732 12:96707094-96707116 TCCTTTTCTGTCTTCTTTGCTGG - Intronic
1102039933 12:109794232-109794254 TCCTTCTGGGTCCCCTGTAGGGG - Intronic
1106871883 13:34030581-34030603 TCCTTTTCAGTCTCCTTTGCTGG - Intergenic
1107904645 13:45050894-45050916 TCCTTCTCTGTCTCCTTTACTGG + Intergenic
1108211467 13:48143757-48143779 TCCTTTGCGGTCTTCTTTGCTGG - Intergenic
1108243596 13:48492745-48492767 TCCTCTTCAGTCTCCTTTGCTGG + Intronic
1110583389 13:77158752-77158774 TCTTTTTCAGTCCCCCTTACAGG + Intronic
1110594751 13:77307892-77307914 TCCTTCTCAGTCTTCTTTACTGG + Intronic
1112065467 13:95788091-95788113 TACATTTCTGTCTCCTTTACTGG - Intronic
1112065471 13:95788166-95788188 TACATTTCTGTCTCCTTTACTGG - Intronic
1112284418 13:98091598-98091620 TAGTTTTCAGTCCCCTTTCCAGG + Intergenic
1114401191 14:22412379-22412401 TCCTTCTCAGTCCCCCTTGCTGG + Intergenic
1117112282 14:52470870-52470892 TCCTTTTTGTTCCCTTTTGCAGG + Intronic
1117848512 14:59940039-59940061 TCCTTTTCAGTCTCCTCTGCAGG - Intronic
1119119705 14:72063228-72063250 TCCTTTTCGGTCCCCTTTACTGG - Intronic
1120586969 14:86323725-86323747 TCCATTTTGATCTCCTTTACCGG - Intergenic
1126406739 15:48330665-48330687 CCCTTTTCGGTCTCCTTAACTGG - Intergenic
1128764383 15:70242157-70242179 TCCTTCTCGGTCTCCTTTGCAGG - Intergenic
1130054612 15:80511768-80511790 TCCTTCTCAGTCTCCTTTGCTGG - Intronic
1135543504 16:23350388-23350410 TCCTCTTGTGTCCCCTTCACAGG - Intronic
1139008688 16:62605892-62605914 TCCTTTTCTATCTGCTTTACTGG + Intergenic
1148041092 17:44707965-44707987 TCCTCCTCAGTCCCCTTTGCTGG - Intergenic
1148491779 17:48028083-48028105 TCCTATTTGGTACCCTTTCCAGG + Intronic
1149115568 17:53091243-53091265 TCCTTTTCTGTCTCATTTGCTGG - Intergenic
1150245627 17:63672702-63672724 TCCTTTTCTGTGTCCTTCACAGG - Intronic
1151147877 17:72058194-72058216 TCTCTTTCGGTCCCCTGTACAGG + Intergenic
1151995800 17:77608243-77608265 TCCTTCTCGGTCTCCTTCGCTGG - Intergenic
1153592197 18:6685379-6685401 TCTTTTTCAGTCTTCTTTACTGG + Intergenic
1157383295 18:47240211-47240233 CACTTTTCAGTCCCCTTCACTGG - Intronic
1158012390 18:52743819-52743841 TCTTTTTCTCTTCCCTTTACAGG - Intronic
1158971791 18:62674904-62674926 TCCATGTCTTTCCCCTTTACTGG + Intergenic
1165913706 19:39245161-39245183 TTCTTTTCAGTCCCCTCTTCTGG + Intergenic
1165917255 19:39268463-39268485 TTCTTTTCAGTCCCCTCTTCTGG - Intergenic
927965684 2:27266350-27266372 TTATTTTCAGTCCCCTTTGCTGG + Intronic
928982890 2:37154890-37154912 TCCTTTTCTGTCTCCTTTCCTGG + Intronic
929826682 2:45314251-45314273 TCCTTCTTGGTCTCCTTTGCTGG - Intergenic
932178060 2:69620726-69620748 TCCTTCTCTGTCACCTTTAAGGG + Intronic
932792472 2:74667731-74667753 TCCTTCTCAGTCTCCTTGACAGG + Intronic
932824839 2:74929788-74929810 TCCTTTTCAATCTCCTTTGCAGG - Intergenic
943957706 2:194213979-194214001 TCCTTCTCGGTCTTCTTTGCTGG - Intergenic
944801503 2:203241521-203241543 TCCTTCTCAGTCTCCTTTGCTGG - Intronic
945092282 2:206186611-206186633 TCCCTTTCTGTCCCCTCTAAGGG - Intronic
945874725 2:215266716-215266738 TCCTTTCCTGTCTCCTTCACTGG + Intergenic
947409173 2:229817219-229817241 TCATTTTCTGTCAGCTTTACTGG + Intronic
1168752342 20:291701-291723 TCCTTTTCAGTCTCCTTTGCTGG + Intergenic
1169534229 20:6520140-6520162 TCCGTTTCTGTCCTCTTCACTGG - Intergenic
1170528905 20:17269351-17269373 TGCTTTTCTGTCTCCTTTGCTGG - Intronic
1170560485 20:17553089-17553111 TCCTTTTCAGGCTCCTTTGCTGG - Intronic
1170656459 20:18291481-18291503 TCCTCCTCTGTCTCCTTTACTGG + Intronic
1170793662 20:19528105-19528127 TCCTTTTTTGTCCTCTTTAAAGG + Intronic
1172192614 20:33071072-33071094 TCCCTTTGGGTCCATTTTACAGG + Intronic
1172965455 20:38831218-38831240 TCCTTGGGGGTCCCCTTTAAGGG + Intronic
1173142612 20:40497407-40497429 TCGCTCTTGGTCCCCTTTACAGG - Intergenic
1174665779 20:52256490-52256512 TCCTTTTAGGTCTCCTTTTTAGG + Intergenic
1175477139 20:59284754-59284776 TCCTTTTCAGTCCCCTTTTCTGG + Intergenic
1175698873 20:61123251-61123273 TCCTCTCCTGTCCCCTTTCCAGG - Intergenic
1176261624 20:64184896-64184918 ACCTTGTCGGTCACCTGTACAGG - Intronic
1177576220 21:22959818-22959840 TCCTTTTCGGACACCTGTGCTGG - Intergenic
1178006079 21:28220703-28220725 TCCTTTTCTTTGGCCTTTACAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1182162928 22:28141256-28141278 TCTTTTTCAGTCCCCTTACCTGG + Intronic
950624002 3:14231006-14231028 TCCTTCCCAGTCCCCTTTGCTGG + Intergenic
952982191 3:38745859-38745881 TCCTTTTCAGTCTCCTCTGCTGG + Intronic
953461753 3:43086981-43087003 TCCTTTTCTGTCTCTTTTAAGGG - Intronic
956546702 3:70411129-70411151 TACTTTTAGATCTCCTTTACAGG - Intergenic
961209677 3:125116145-125116167 TCCTGTGTGGTCCCCTTTAGGGG + Intronic
962228122 3:133633434-133633456 TCCTTCTCAGTCTCCTTTGCTGG + Intronic
963746038 3:149126063-149126085 TCCTCCTCTGTCTCCTTTACTGG - Intergenic
964122240 3:153196923-153196945 TCCATCTCTGTCCCCTTTACTGG - Intergenic
964378137 3:156069614-156069636 TCCTTTTCGGTCATCTTGCCCGG + Intronic
964720142 3:159762912-159762934 TCCTTTAAGGTCCCCTTGATTGG + Intronic
965731900 3:171780527-171780549 TTTTTTTTGGCCCCCTTTACTGG - Intronic
969224717 4:5788005-5788027 TCCTTCTCAGTCTCCTTTGCTGG + Intronic
973811021 4:54570402-54570424 TGCTTTTCTGTCCCCTCTAGGGG - Intergenic
976326356 4:83776168-83776190 TCCTTTACAATCCCCTTCACGGG - Intergenic
979998990 4:127466713-127466735 CCCTTTTCCCTTCCCTTTACTGG + Intergenic
980664012 4:135904688-135904710 TCCTTCTCAGTCACCTTGACTGG - Intergenic
983235176 4:165171076-165171098 TCCTTTCCTCTCCCCTTCACAGG - Intronic
983995771 4:174179934-174179956 TCCTTTTCAGTTCTCTTTGCTGG - Intergenic
984065771 4:175045908-175045930 TCCATTTTTGTCCCCTTTAGAGG + Intergenic
984218780 4:176947778-176947800 CCCTTTTTTGTCCCCTTTAGTGG + Intergenic
985528446 5:419952-419974 TCCTTGTGGATCCCCTTTTCTGG + Intronic
987167306 5:15214256-15214278 TCCTTTGCTGTCCTCTTTAGTGG - Intergenic
987485737 5:18523300-18523322 TCCATATTGATCCCCTTTACAGG - Intergenic
989102414 5:37835139-37835161 TCCTGTCCAGTCCCCTCTACTGG + Intronic
989540825 5:42616759-42616781 TCTTTCTTGGTCTCCTTTACTGG - Intronic
991350610 5:65716951-65716973 TTCTTTTCTGTCCCCTTTTCTGG - Intronic
992331499 5:75721501-75721523 TCCTTCTCAGTCTCCTTTGCTGG - Intergenic
992557148 5:77915208-77915230 TCCTTTCCAATCACCTTTACGGG - Intergenic
995725767 5:115179433-115179455 GCCTTTTCGGGCCTCTTTCCAGG - Intronic
995852673 5:116562568-116562590 TCCTTTTCCTTCCCCTTTCGAGG - Intronic
998364171 5:141618430-141618452 TCTTTTTTGGTCCCCTCTTCTGG - Intronic
1001715932 5:173815993-173816015 TCCCTTTCTGTCTCCTTTTCAGG - Intergenic
1006220114 6:32482572-32482594 TCCCTCTCAGTCCCCTTTGCTGG + Intergenic
1006229413 6:32570325-32570347 TCCCTCTCAGTCCCCTTTGCTGG + Intronic
1006289661 6:33125023-33125045 TGCTTTTTGGTCTCCTTCACGGG - Intergenic
1007959132 6:45942752-45942774 TCCTTTTGGGGCCCCTTTTGGGG + Intronic
1010303005 6:74283273-74283295 TCCTTTTGGATCCCCATTTCTGG + Intergenic
1012624042 6:101384628-101384650 TCCTTTTCAGTCTCCTTTGTGGG - Intergenic
1013976335 6:116083035-116083057 TCCTTCTCAGTCTCCTTTGCTGG - Intergenic
1015008352 6:128311861-128311883 TCCTTTTCCTTCCCATTTAAGGG + Intronic
1016756157 6:147689547-147689569 TCCTTTTCAGTTCCTTTGACTGG - Intronic
1016963018 6:149691622-149691644 TTCTTCTCTGTCCCCTTTGCAGG + Intronic
1017519627 6:155190423-155190445 TCCTCACCGGTCCCCTTTAGGGG + Intronic
1020754627 7:12186619-12186641 TCCTTTCCTTTCCCCCTTACTGG - Intergenic
1022199521 7:28103157-28103179 TCCTTCTTGGTCTCCTTTACTGG + Intronic
1028525564 7:91781815-91781837 TCCATTTAGGTACCCTTGACTGG - Intronic
1030292495 7:107886584-107886606 TCCTTTTCAGTCTCCTTCATTGG - Intergenic
1031055315 7:116986902-116986924 TCCTTCTCAGTCTCCTTTGCCGG - Intronic
1031611006 7:123827227-123827249 TCCTTCTCAGTCTTCTTTACTGG - Intergenic
1032521242 7:132546962-132546984 TCCTTTTGGGCTCCCTTTCCTGG - Intronic
1032677812 7:134147734-134147756 TCCTTTTCTGTCCACTTTGAGGG - Intronic
1033310330 7:140256632-140256654 TGCATTTCGGTCACCTTTATTGG + Intergenic
1034233453 7:149550617-149550639 TCCCTTTCAGTCCCCTCTTCTGG + Intergenic
1037165459 8:15822673-15822695 TCCTTCTCTGTCCCCTTTGCTGG - Intergenic
1037199488 8:16234669-16234691 TCCTTTTCTGTCTCCTTCTCTGG - Intronic
1039296403 8:36160369-36160391 TCCTTTCCCGTCTCCTTTGCTGG - Intergenic
1039926594 8:41939255-41939277 TACTTTTCTTTTCCCTTTACTGG - Intronic
1041894265 8:62905767-62905789 TCCTTTTTGGTCTCTTTTGCTGG + Intronic
1042741669 8:72054625-72054647 TCTACTTCGGTCCCCTTTGCAGG + Intronic
1045230582 8:100302711-100302733 ACCTTTTCTGTCTCCTTTACTGG - Intronic
1045392243 8:101726954-101726976 TCCTTTTTGTTCTCCTTTACTGG - Intronic
1045817396 8:106292767-106292789 TCCTTCTCAGTTCCCTTTCCTGG - Intronic
1048223740 8:132565888-132565910 TCCTCTTCTGTCCCCTTCTCAGG + Intergenic
1048571216 8:135658539-135658561 TCCTTCTTGGTCTCCTTTTCTGG - Intergenic
1048621975 8:136143714-136143736 TCTTTCTCGGTCTCCTTTTCTGG - Intergenic
1050055749 9:1652099-1652121 TCATTTTCCTTTCCCTTTACTGG - Intergenic
1050321731 9:4459390-4459412 TCCTTTTCAGTCTCTTTTACAGG - Intergenic
1060033865 9:120238233-120238255 TCCTTCTCAGTCTCCTTTGCTGG + Intergenic
1060769368 9:126320266-126320288 TCCTTTTTGGCCCTCTTTAAGGG - Intergenic
1186216077 X:7302724-7302746 TCCTTCTCCTTCCCCTTTTCGGG + Intronic
1186338518 X:8618253-8618275 TCCTTTTCCTTCCCATTTCCAGG + Intronic
1187367815 X:18678773-18678795 TCCTTTTTGGTCACTTTTGCTGG + Intronic
1188250748 X:27890988-27891010 TCCTTTTTTGTCCCTGTTACTGG - Intergenic
1190321967 X:49184914-49184936 TCCTTATATGTCCCCTTTTCAGG + Intronic
1191776570 X:64821222-64821244 TCCTTCTCAGTCTCCTTTGCTGG - Intergenic
1194583846 X:95709264-95709286 TCCTTCTCCGTCTCCTTCACTGG + Intergenic
1196174735 X:112628223-112628245 TCCTCTTCAGTCTCCTTTCCAGG + Intergenic
1196678764 X:118448757-118448779 ACCTTTTCAGTCTCCTTTTCTGG - Intronic
1196752177 X:119127952-119127974 TCCTTCTGGGTCGCCTTTGCTGG + Intronic