ID: 1119121705

View in Genome Browser
Species Human (GRCh38)
Location 14:72085462-72085484
Sequence GTCCCAGCCCAGAGATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119121700_1119121705 0 Left 1119121700 14:72085439-72085461 CCTGGGCCCAGATATGAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG 0: 1
1: 1
2: 0
3: 10
4: 118
1119121704_1119121705 -7 Left 1119121704 14:72085446-72085468 CCAGATATGAGACAGGGTCCCAG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG 0: 1
1: 1
2: 0
3: 10
4: 118
1119121697_1119121705 20 Left 1119121697 14:72085419-72085441 CCATCTGGAAGCACTGAGTACCT 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG 0: 1
1: 1
2: 0
3: 10
4: 118
1119121703_1119121705 -6 Left 1119121703 14:72085445-72085467 CCCAGATATGAGACAGGGTCCCA 0: 1
1: 0
2: 1
3: 12
4: 257
Right 1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG 0: 1
1: 1
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119121705 Original CRISPR GTCCCAGCCCAGAGATTTGT TGG Intronic
900430336 1:2598388-2598410 GTTCCACCCCAGAGAGTTATGGG + Intronic
900640651 1:3686628-3686650 GTCCCAGGCCACAGACTTATTGG + Intronic
900953836 1:5874826-5874848 GCCCCAGCCCAGATCTGTGTCGG - Intronic
901446670 1:9312625-9312647 GTGCCAGCACGGAGTTTTGTTGG + Intronic
902028596 1:13403826-13403848 GTCTGAGCCTAGAGATTTGTGGG - Intergenic
902780016 1:18698944-18698966 GACACGGCCCAGAGATTTGGGGG + Intronic
905731090 1:40299956-40299978 TTCCCAGCCCATAGCTCTGTAGG - Intergenic
907831636 1:58069997-58070019 ATCCCAGCCCAGAGATTTTGGGG + Intronic
908002868 1:59698174-59698196 GTTCCAGCCCAAAGATTATTAGG + Intronic
912102132 1:106222725-106222747 ATCCCAGCCCAGAAATCCGTGGG + Intergenic
916570860 1:166026371-166026393 GTCCCAGCCCTGACATTTACTGG + Intergenic
919810386 1:201405535-201405557 TGCCCAGCCCAGAGACTTGTGGG + Exonic
921446841 1:215256659-215256681 GTCCCAGCCCCTATATTTGCAGG - Intergenic
923101255 1:230819592-230819614 CACGCAGCCCAGAGTTTTGTTGG + Intergenic
1071275725 10:84053379-84053401 TTTCCAGCTCAGAGATCTGTGGG + Intergenic
1073250577 10:102118425-102118447 GCCCAAGCCCAGGGGTTTGTGGG - Intronic
1075584984 10:123651077-123651099 GGCCCAGCCCAGAGGTTGCTTGG + Intergenic
1076108471 10:127843705-127843727 TTCCCAGCACAGAGATTAGAAGG - Intergenic
1078483758 11:11703378-11703400 TTCCTAGCCCAGGGAGTTGTTGG - Intergenic
1083006799 11:59354872-59354894 GTCACAGCCCCTAGATTTGTTGG - Intergenic
1084416569 11:69035933-69035955 GTCCGAGCCCAGAGGCCTGTGGG - Intergenic
1084498933 11:69523299-69523321 GCCCCAGCCCAGAGACTGGATGG + Intergenic
1090400319 11:126444718-126444740 GTCTCAGCCCTGAGAGTGGTGGG - Intronic
1091986660 12:4915147-4915169 TACCCAGCCCAGAGAATGGTGGG + Exonic
1094656095 12:32420616-32420638 GTCCCAACCAGGAGATATGTGGG - Intronic
1099370593 12:81825159-81825181 TTCCCAGCCTACAGAATTGTGGG + Intergenic
1102781132 12:115565823-115565845 GTTCCAGCCCTTAGTTTTGTGGG - Intergenic
1103126897 12:118431374-118431396 GATCCAACCCAGAGATTTTTGGG + Intergenic
1104434344 12:128743761-128743783 GCCTCACCCCAGACATTTGTGGG - Intergenic
1109021046 13:57093766-57093788 ATCACTGCCCAGAGATTTCTTGG + Intergenic
1117656460 14:57961206-57961228 GTCCCAGTGCAGATTTTTGTGGG - Intronic
1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG + Intronic
1119764970 14:77182285-77182307 GTCCCAGCCCAGAGAGTGGGCGG - Intronic
1120432309 14:84434495-84434517 TGCCCAGCCCAGAGGTTAGTGGG - Intergenic
1121474358 14:94182901-94182923 GTCCCAGCCTATATATTTTTAGG + Intronic
1124075396 15:26439061-26439083 GTCCCAGCTAATAGATTTGCTGG - Intergenic
1128526921 15:68418869-68418891 GCCCCAGCCCAGAGAGTGTTTGG + Intronic
1128634267 15:69293228-69293250 GGCCCAACCCAGAGAACTGTAGG + Intergenic
1128910931 15:71514099-71514121 GCCCTAGCCCTGAGATCTGTTGG - Intronic
1129319107 15:74763958-74763980 GGCCCTGCCCAGAGTTTTGGGGG + Intergenic
1132212150 15:100032125-100032147 GTCCCAGGCCTGAGATTTTCTGG - Intronic
1133222604 16:4325183-4325205 CTCCCCGCCCAGGGACTTGTGGG - Intronic
1134851383 16:17481730-17481752 GTACCACCCCAGAGACTTGGTGG - Intergenic
1138740986 16:59310005-59310027 GTCCCAGACCAGTGTTATGTGGG - Intergenic
1140589373 16:76333139-76333161 ACCCTAGCCCAGAGATTTCTAGG - Intronic
1141363545 16:83420438-83420460 GTCTCTGCCCAGAGATCTATGGG - Intronic
1146787627 17:35732736-35732758 GTGGCAGCTCAGAGATTTCTAGG - Intronic
1147732198 17:42610615-42610637 GTCCCTACCCAGCGAGTTGTGGG - Intronic
1147771635 17:42872228-42872250 GTCCCAGTCCAGGGATTTGGAGG - Intergenic
1150146842 17:62776308-62776330 ATCCCAGCTCAGTGAATTGTTGG - Intronic
1151192358 17:72407765-72407787 GGCCCAGCCAAGGGATGTGTGGG + Intergenic
1151594895 17:75072010-75072032 GTCCCAGCTTAGAGATTGGTGGG + Intergenic
1155044200 18:22089198-22089220 ATCCCAGCCCAGAGCATTCTTGG - Intronic
1157311330 18:46555543-46555565 TTTCCAGCCCATAGACTTGTTGG - Intronic
1158530153 18:58253300-58253322 GTCCCAGCCCAGTGATAGTTTGG + Intronic
1159235613 18:65669090-65669112 GTCCCAGCCCAGAAGCTTGAGGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160948900 19:1656299-1656321 GTCCCAGCCCAGGGCTCTGTGGG - Intergenic
1167057835 19:47123854-47123876 CTGCCAGCCCAGAGATATTTTGG - Intronic
1167245278 19:48369366-48369388 GTCACAGCCCAGGGTTTTGGGGG + Intronic
1168092838 19:54096877-54096899 GTCCCAGCCCAGCGATGTCCTGG - Exonic
925279077 2:2670119-2670141 GTCCCAGCTCAGGGACTTGAGGG - Intergenic
932595189 2:73088982-73089004 GTCCGAGCCCAGCGAGGTGTTGG + Exonic
934529870 2:95078303-95078325 ATCCCAGCTCAGAGAGTTGAGGG - Intergenic
941421403 2:165286736-165286758 GTTTCAGCCCTGAGATTTTTGGG + Intronic
942206498 2:173624830-173624852 TTCCCAGCTCACAGCTTTGTTGG - Intergenic
943144652 2:184026566-184026588 GTCCCAAGTTAGAGATTTGTTGG - Intergenic
947808480 2:232984465-232984487 GTCCGATGCCAGAGAGTTGTAGG + Intronic
1169415743 20:5414829-5414851 CTCCCACCCCTGATATTTGTAGG + Intergenic
1169515424 20:6311550-6311572 GTCTCAGGCCAGAGATTGGAGGG + Intergenic
1170886521 20:20344218-20344240 GTCCCACCTCAGAGAGCTGTGGG + Intronic
1173234719 20:41234212-41234234 GCCTCAGCCCACAGTTTTGTGGG - Intronic
1178807716 21:35853150-35853172 TTCACAGTCCAGAGCTTTGTGGG + Intronic
1183030564 22:35101026-35101048 GGCCCATGCCATAGATTTGTTGG - Intergenic
1184405629 22:44298919-44298941 CTCCCAGCCCAGGGCTCTGTTGG - Intronic
1185222384 22:49635673-49635695 CTGCCAGCCCAGAGGTTTATGGG + Intronic
952816707 3:37452804-37452826 GTCCCAGCCCAGAGCGTGGGGGG + Intronic
953090873 3:39724956-39724978 GTCCAATCCCAGAGATCTGGTGG + Intergenic
956442986 3:69298367-69298389 GGCCCAGGCCAGAGATGAGTGGG - Intronic
962947136 3:140182480-140182502 GTCCGAGCTCAGAGAGCTGTGGG - Intronic
964985356 3:162731934-162731956 GTACCAGCCCAGAGACTGGTAGG - Intergenic
966945837 3:184776634-184776656 GCCCCAGCCCAGAGGTTGGGCGG + Intergenic
968335788 3:197912331-197912353 TGCCCAGCCCATAAATTTGTAGG + Intronic
969885506 4:10211854-10211876 GCCCCAGCTCAGAAATCTGTAGG - Intergenic
974903154 4:68025703-68025725 GTCACAGCCCAGATACTTGGTGG - Intergenic
976903826 4:90211246-90211268 CTGCAAGCCCAGAAATTTGTGGG + Intronic
977882052 4:102216400-102216422 GTCACAGCCCAGAGATATCCTGG - Intergenic
978051140 4:104201864-104201886 TTTCCTGCCAAGAGATTTGTTGG + Intergenic
980352499 4:131700218-131700240 CTCCAGGCCTAGAGATTTGTGGG - Intergenic
981331592 4:143515081-143515103 GTCGGAGCCCAAAGATTTCTGGG + Intronic
982350170 4:154406838-154406860 GTCTCAGTCCCAAGATTTGTTGG - Intronic
986632150 5:9784253-9784275 GTCCCAGCCTGGGGATTTGGGGG - Intergenic
986644521 5:9903633-9903655 GTACCAGCCCAGAGCCTGGTAGG - Intergenic
990866247 5:60383617-60383639 GTCCCAGTTCAGAGAGTTGGCGG + Intronic
990874062 5:60464617-60464639 GCCCCATCCCTGAGATCTGTGGG - Intronic
992683988 5:79181437-79181459 CTCCAAGCCCAGATATCTGTGGG + Intronic
995797896 5:115961608-115961630 GTTCCAGCCCAGGAATTTCTGGG + Intergenic
996325475 5:122267864-122267886 GTACCAGCCCAGAGCTGGGTAGG + Intergenic
998208689 5:140177231-140177253 TTCCCAGCCCTGAAATTTATTGG + Intronic
999274129 5:150317595-150317617 TTCCCAGCCCAGACAGTTGCTGG - Intronic
1000293601 5:159893777-159893799 ATACCAGTCCAGAGATTTGGGGG + Intergenic
1000983128 5:167838276-167838298 GTTCCAGCCGAGATATTTATGGG + Intronic
1001011280 5:168100994-168101016 GGCACAGCCCAGAGAGCTGTCGG - Intronic
1002211075 5:177599900-177599922 GTCCCAGCCCAGTGATTTGTTGG + Intergenic
1002318359 5:178360182-178360204 GACCAAGCACAGAGATTTCTCGG + Intronic
1004178657 6:13362552-13362574 GTTCCAAACCAGAGATTTGCTGG - Exonic
1007315347 6:40983796-40983818 ATCCCAGTCCAGAGATTGATAGG + Intergenic
1017816846 6:158022326-158022348 ATGCCAGCCCAGAGCCTTGTGGG + Intronic
1018227402 6:161641528-161641550 GTCCCATCCCCGAGTTTTCTGGG + Intronic
1024601854 7:50988941-50988963 CTCCCAGCACACAAATTTGTTGG - Intergenic
1025724683 7:64045840-64045862 TTTCCAGCCCAGAGACTTTTTGG + Intronic
1026336097 7:69395189-69395211 GGCCCTGCCCAGAGATTGCTTGG - Intergenic
1026383043 7:69818300-69818322 CTGCCAGCCAAGAGAGTTGTAGG + Intronic
1031937591 7:127751691-127751713 TGCCCAGCCCACAGATTTGCTGG - Intronic
1034445495 7:151111925-151111947 GTCCCAGCCTGGAGCTTTTTAGG + Intronic
1034449769 7:151131033-151131055 GGCTCAGCCCAGAGTTCTGTCGG - Intronic
1035281993 7:157784426-157784448 GACCCAGCCCTGAGCCTTGTGGG - Intronic
1036929307 8:12938684-12938706 GTCACAGCCCAGCTTTTTGTTGG + Intergenic
1039367282 8:36943331-36943353 GTTCCAGCTCAGATAGTTGTAGG - Intergenic
1052094219 9:24364860-24364882 GTCACAGATCAGAGAGTTGTAGG + Intergenic
1052225331 9:26078162-26078184 CTCCCCGCCCAGAGTTCTGTAGG + Intergenic
1055122431 9:72677279-72677301 GTCCCAGCTCAGAGACCTTTAGG + Intronic
1057295137 9:93830327-93830349 GTCCCAGCCAGGAGAGGTGTGGG + Intergenic
1057980009 9:99650862-99650884 GTGCCAGCCAAGAGCTTTGTAGG - Intergenic
1186559026 X:10590525-10590547 TTCCCAGCCCAAAGACTTTTTGG + Intronic
1189406300 X:40728078-40728100 TTCCCAGCCCTGAGATCTGCTGG - Intronic
1191864858 X:65695751-65695773 GTGCCAGCTCATAGATTTGGGGG - Intronic
1192205540 X:69093663-69093685 CTCCCTGCCCAGAGGTATGTGGG + Intergenic
1192254283 X:69442775-69442797 GCCCCACCCCAGAGAGATGTAGG + Intergenic
1194408068 X:93522520-93522542 ATCCCAGACCAGTGATCTGTAGG - Intergenic