ID: 1119125292

View in Genome Browser
Species Human (GRCh38)
Location 14:72119906-72119928
Sequence TTCCGGTAGCAGAATGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119125289_1119125292 4 Left 1119125289 14:72119879-72119901 CCTTGGCAAATGAAGTCAGCAAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1119125292 14:72119906-72119928 TTCCGGTAGCAGAATGAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1119125288_1119125292 11 Left 1119125288 14:72119872-72119894 CCTGAAACCTTGGCAAATGAAGT 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1119125292 14:72119906-72119928 TTCCGGTAGCAGAATGAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119125292 Original CRISPR TTCCGGTAGCAGAATGAGCC TGG Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904041836 1:27589939-27589961 CTCTGGAGGCAGAATGAGCCTGG - Intronic
908480163 1:64531842-64531864 TTCAGGTAACGGAATGAGTCTGG - Intronic
910563933 1:88622225-88622247 TTCTGGTATCAGAATGATGCTGG - Intergenic
910805392 1:91185157-91185179 TTTTGGTAGCAGAATGATGCTGG + Intergenic
912275366 1:108252410-108252432 TTTTGGTATCAGAATGAGGCTGG + Intergenic
912292858 1:108441939-108441961 TTTTGGTATCAGAATGAGGCTGG - Intronic
913708496 1:121453944-121453966 TTCTGGTATCAGAATGATGCTGG + Intergenic
914728939 1:150353421-150353443 TTCCTGGAGCAGAATGAAGCAGG + Intergenic
920012807 1:202881792-202881814 TGCCTGAAGCATAATGAGCCGGG - Intronic
920646489 1:207807702-207807724 TCCTGATAGCAGAATGAGGCTGG - Intergenic
923413829 1:233735240-233735262 TTCCGGTAACATTTTGAGCCAGG + Intergenic
1071552001 10:86573420-86573442 TTCAGATAGCAGCCTGAGCCAGG + Intergenic
1071999619 10:91181851-91181873 TTTTGGTAGCAGAATGATGCTGG + Intronic
1073785131 10:106880791-106880813 TTTCGAAAGCAGAATAAGCCGGG + Intronic
1074579812 10:114708362-114708384 TTTCTGTGGCAGAAGGAGCCTGG - Intergenic
1077828516 11:5837070-5837092 TTCCGGTATCAGGATGATGCTGG + Intronic
1080138189 11:28883212-28883234 TTTTGGTATCAGAATGATCCTGG - Intergenic
1080440003 11:32284282-32284304 TTTTGGTAGCAGAATGATTCTGG - Intergenic
1085857867 11:80196346-80196368 TTCTGGGAGCAGAATGGGTCTGG + Intergenic
1086405492 11:86495874-86495896 TTCCAGTACCATGATGAGCCAGG - Intronic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1091767042 12:3128207-3128229 TTGGGGTGGCAGACTGAGCCAGG + Intronic
1105749253 13:23407099-23407121 TTCGGGTGGCAGAATGAGGATGG - Intronic
1108160935 13:47638468-47638490 TTTTGGTAGCAGAATGATGCTGG - Intergenic
1110549211 13:76792905-76792927 GGCAGGAAGCAGAATGAGCCAGG + Intergenic
1119125292 14:72119906-72119928 TTCCGGTAGCAGAATGAGCCTGG + Intronic
1120960381 14:90119298-90119320 TTTTGGTATCAGAATGACCCCGG - Intronic
1132212233 15:100032750-100032772 TTCTGTTACCAGAATGAGCTGGG + Intronic
1133565661 16:6991186-6991208 TTCCAGTTACAGAATGAGGCAGG + Intronic
1135916353 16:26608794-26608816 TTCCAGTAGCAGTATGACCATGG - Intergenic
1143067761 17:4263538-4263560 TTCCGGATGCAGAACGTGCCAGG + Intronic
1146079328 17:29762803-29762825 TTGCTGTAGCATAATGAGACTGG - Intronic
1148991822 17:51672837-51672859 TTCCGGGAGAAGACTGAGACTGG - Intronic
1152633163 17:81419713-81419735 TTCCGGAAGCAGCGGGAGCCGGG + Intronic
1155122129 18:22831955-22831977 TTCCGGTAGTAGCAAGAGCAAGG + Intronic
1156087025 18:33417999-33418021 TTTTGGTAGCAGAATGATGCTGG - Intronic
1156316381 18:35972615-35972637 TTCCGGAAGCAGCTTGAGTCCGG + Exonic
1157114385 18:44849469-44849491 TTCCTTCAGCAGTATGAGCCCGG + Intronic
1158795626 18:60842696-60842718 TTTTGGTATCAGAATGATCCTGG - Intergenic
1159006271 18:63015731-63015753 TGCTGGTAGTAGAATGCGCCTGG + Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1164740678 19:30573361-30573383 CCAGGGTAGCAGAATGAGCCTGG - Intronic
1167843356 19:52139914-52139936 TCCCGGAAGCAGATTGCGCCAGG - Exonic
927906509 2:26862550-26862572 TTCCTGGGGCAAAATGAGCCAGG - Intronic
928097685 2:28414499-28414521 TCCAAGCAGCAGAATGAGCCAGG + Exonic
928478760 2:31658871-31658893 TTTCAGTAGCAGAATGATGCTGG - Intergenic
934602731 2:95670541-95670563 TTCTGGTAGCAGAATCTGCTGGG + Intergenic
936812331 2:116417065-116417087 TTTCGGTATCAGAATGATGCTGG - Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169678344 20:8180439-8180461 TTTTGGTAGCAGAATGATGCTGG + Intronic
1175527472 20:59645408-59645430 TTCAGGCAGGAGAAAGAGCCAGG - Intronic
1177011134 21:15730667-15730689 TTCCCGTAGCAGACGGTGCCAGG + Intronic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
951814163 3:26735044-26735066 TTATGGTGGCAGAATGTGCCTGG - Intergenic
951843026 3:27054964-27054986 TTTGGGTATCAGAATGATCCTGG + Intergenic
963921382 3:150909304-150909326 TAGCGGTGGCAGAATGAGTCAGG + Intronic
970422156 4:15915409-15915431 ATCTAGTAGCAGAATGATCCAGG - Intergenic
972368838 4:38401644-38401666 TTTTGGTAGCAGAATGACGCTGG + Intergenic
974603521 4:64120468-64120490 TTTCGGTATCAGAATGATGCTGG + Intergenic
976621246 4:87129762-87129784 TACCAGTAGCAGAATGAACTAGG - Intronic
978418729 4:108506735-108506757 TTTTGGTATCAGAATGATCCTGG - Intergenic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
988485810 5:31667435-31667457 TTCCGGAAGAAAAATGAGGCAGG + Intronic
989969597 5:50506604-50506626 TTCTGGTATCAGAATGATGCTGG - Intergenic
993634036 5:90322715-90322737 TTTTGGTATCAGAATGATCCTGG + Intergenic
995646766 5:114321360-114321382 TTCTGGTAGCAGCATGGGGCAGG + Intergenic
1000134502 5:158333837-158333859 TTTCGGTATCAGAATGATGCTGG + Intergenic
1002582773 5:180220062-180220084 TTTTGGTATCAGAATGAGGCTGG + Intergenic
1002615118 5:180448159-180448181 TTTTGGTAGCAGAATGATGCTGG + Intergenic
1002890258 6:1325865-1325887 TTCAGGCAGCAGAATGAGCTGGG - Intergenic
1004068661 6:12276282-12276304 TTCCAGTAGCAGAAAGAGAAAGG + Intergenic
1005909907 6:30300090-30300112 TTCTGGTATCAGAATGATGCTGG + Intergenic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1009034265 6:58097537-58097559 TGCAGGAAGCAGAATTAGCCAGG - Intergenic
1012640234 6:101601420-101601442 TTTTGGTAGCAGAATGATGCTGG + Intronic
1018149716 6:160926496-160926518 TTCCGGCAGGATGATGAGCCAGG - Intergenic
1018570061 6:165200283-165200305 TTTTGGTAACAGAATGAGGCTGG - Intergenic
1020952135 7:14693509-14693531 TTCCTGTATCAGCAGGAGCCAGG - Intronic
1032130216 7:129221775-129221797 TTCTGGAAGCTGAATGAGCCGGG + Intergenic
1032451475 7:132035427-132035449 TTACGGTAAAAGAATGAGCATGG - Intergenic
1035015915 7:155765925-155765947 TTCTGGTTGCAGAATCTGCCTGG + Intronic
1038267757 8:26049456-26049478 TTCCGGGTGCAGAACGAGCGAGG + Intergenic
1044466532 8:92513175-92513197 ACCAGGCAGCAGAATGAGCCAGG - Intergenic
1045691998 8:104769020-104769042 TTTCGGTTGCAGAATGAGGATGG - Intronic
1046171513 8:110514137-110514159 TTCTGGTATCAGAATGATGCTGG + Intergenic
1046842128 8:118871036-118871058 ACCAGGTAGCAGAAAGAGCCTGG + Intergenic
1047056831 8:121174319-121174341 TTGAGGTAGCAGCATGAGCCAGG - Intergenic
1047924165 8:129666396-129666418 TTCTTGCAGGAGAATGAGCCTGG - Intergenic
1052614146 9:30816416-30816438 TTCTGGTAGGAAAATGAGTCAGG + Intergenic
1055132976 9:72796378-72796400 TTTTGGTAGCAGAATGATACTGG - Intronic
1055537594 9:77265282-77265304 TTTTGGTAGCAGGATGAGGCTGG + Intronic
1191215431 X:57928282-57928304 TTCAGGCAGCAGAGGGAGCCTGG + Intergenic
1196537577 X:116865781-116865803 TTTTGGTATCAGAATGATCCTGG + Intergenic
1196551076 X:117025989-117026011 TTTTGGTAGCAGAATGATGCTGG + Intergenic