ID: 1119126179

View in Genome Browser
Species Human (GRCh38)
Location 14:72129490-72129512
Sequence CAAACTACTCCAACACTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1292
Summary {0: 1, 1: 8, 2: 62, 3: 285, 4: 936}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119126174_1119126179 15 Left 1119126174 14:72129452-72129474 CCTCACCCTGGCTGTGCCAAGTT 0: 1
1: 0
2: 0
3: 30
4: 272
Right 1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG 0: 1
1: 8
2: 62
3: 285
4: 936
1119126173_1119126179 22 Left 1119126173 14:72129445-72129467 CCACACACCTCACCCTGGCTGTG 0: 1
1: 0
2: 5
3: 50
4: 412
Right 1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG 0: 1
1: 8
2: 62
3: 285
4: 936
1119126175_1119126179 10 Left 1119126175 14:72129457-72129479 CCCTGGCTGTGCCAAGTTTCTAT 0: 1
1: 0
2: 3
3: 12
4: 180
Right 1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG 0: 1
1: 8
2: 62
3: 285
4: 936
1119126178_1119126179 -1 Left 1119126178 14:72129468-72129490 CCAAGTTTCTATGGCTGCACAAC 0: 1
1: 0
2: 2
3: 10
4: 159
Right 1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG 0: 1
1: 8
2: 62
3: 285
4: 936
1119126176_1119126179 9 Left 1119126176 14:72129458-72129480 CCTGGCTGTGCCAAGTTTCTATG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG 0: 1
1: 8
2: 62
3: 285
4: 936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119126179 Original CRISPR CAAACTACTCCAACACTTAG TGG Intronic
900773139 1:4561820-4561842 CAAACCACTCTAACACTTCGTGG + Intergenic
901412268 1:9092767-9092789 CAAATTACTCAAACACTTGCAGG + Intergenic
901734527 1:11304112-11304134 CAAACCACCCCAAGACTTAGTGG + Intergenic
901735311 1:11308597-11308619 CAAACCACCCCAAGACTTAGTGG - Intergenic
901773586 1:11543856-11543878 CAAACCACTTCAACAACTAGTGG + Intergenic
902106923 1:14045226-14045248 CAAATTACCCCAACACTTAGTGG - Intergenic
902998263 1:20244681-20244703 CAAACAACTCCAAAACTAGGTGG - Intergenic
903054240 1:20624280-20624302 CAAGTTACTCCAACATTTAGTGG + Intergenic
903766521 1:25738474-25738496 CAAATTACTCCAAAACTTGGGGG + Intronic
904283597 1:29438696-29438718 AAAACTACTTCAAAACCTAGGGG - Intergenic
904903170 1:33873805-33873827 CATATTACTCCAAAGCTTAGTGG - Intronic
904944724 1:34190845-34190867 CAAACCACCCCAAAGCTTAGTGG + Intronic
905251547 1:36652063-36652085 CAAACCACTCCAAAACTCAGTGG - Intergenic
905762952 1:40575864-40575886 CAAATTACCCCAAAACTTAGTGG + Intergenic
906155274 1:43610354-43610376 CAAATTACCCCAAAACTTAGTGG + Intronic
906220777 1:44077416-44077438 CAAATTACTCCAAAACTCGGTGG + Intergenic
906292560 1:44628937-44628959 CAAACCATCCCAAAACTTAGTGG + Intronic
906387017 1:45378683-45378705 CAAGCTACCCCAAAACTTAGTGG - Intronic
906523792 1:46482487-46482509 CAAATTACCCCCAAACTTAGTGG - Intergenic
906554752 1:46700171-46700193 CAAATTACCCCAAAACTTAGTGG - Intronic
906756695 1:48324296-48324318 CAAACTATTCCAAAAAATAGAGG + Intronic
907036210 1:51218647-51218669 CAAACTACCCCAAAGCTTAGTGG + Intergenic
907109535 1:51914106-51914128 CCAACCACTCCAAAACTTACAGG - Exonic
907703866 1:56816109-56816131 CAAACCACCCCAAAACTGAGTGG + Intronic
907952853 1:59200697-59200719 CAAACCACCCTAACATTTAGTGG + Intergenic
908260167 1:62334161-62334183 CAAATTACCCCAAAACTTAGAGG - Intergenic
908360362 1:63363300-63363322 CAAATTACTCCAAAATTTAGCGG - Intergenic
908376506 1:63547584-63547606 AAAACTACCCCAAAACTCAGTGG + Intronic
908490560 1:64639781-64639803 CAAATTATTCCAACACTCTGTGG + Intronic
908752107 1:67433803-67433825 CAAACTATTCTAACAGTTTGGGG + Intergenic
908908360 1:69042533-69042555 CAAACTATTCCAAAAAATAGAGG + Intergenic
908946055 1:69498793-69498815 CAAATAACTCCAACACATTGTGG + Intergenic
908997433 1:70172840-70172862 CAAACCACTCCAAAACATAATGG - Intronic
909030935 1:70539132-70539154 CAAACCACCTCAAAACTTAGTGG + Intergenic
909147218 1:71951156-71951178 CACACTGCTCCAATAATTAGAGG + Intronic
909385157 1:75046543-75046565 CAAACTATTCCAAAAAATAGAGG + Intergenic
909674564 1:78225017-78225039 CAAATTACCCCAAAACTTGGTGG - Intergenic
909687851 1:78371265-78371287 TAAACCACACCAAAACTTAGTGG + Intronic
909746270 1:79100724-79100746 CAAACAACTCCAAAATGTAGTGG - Intergenic
909793870 1:79708265-79708287 CAAACTACCCTGAAACTTAGTGG - Intergenic
909809155 1:79908935-79908957 CAAACCAGCCCAAAACTTAGTGG + Intergenic
910112654 1:83699249-83699271 CAAACCACCCCAAAACTCAGTGG - Intergenic
910274912 1:85438697-85438719 CAAATTATTCCAAAACGTAGTGG - Intronic
910377007 1:86583385-86583407 CAAACCATCCCAAAACTTAGTGG - Intergenic
910434464 1:87191170-87191192 CAAACTTCCCCAGAACTTAGTGG - Intergenic
910465150 1:87491257-87491279 CAAATTACTCTAAAACTTAGTGG + Intergenic
910470080 1:87543084-87543106 CAAACTACTTCAACAAATAGAGG - Intergenic
910547673 1:88436946-88436968 CAAACTATTCCAAAAAATAGAGG + Intergenic
910585880 1:88879033-88879055 CAAACTACCTCAAAACTTAGTGG - Intronic
910665676 1:89723774-89723796 CAAACCAGCCCAAAACTTAGCGG + Intronic
910733479 1:90425051-90425073 CAAACTACTCCAAAAAATAGAGG + Intergenic
911170462 1:94765928-94765950 CAAATTACTCCAAAATGTAGTGG - Intergenic
911191768 1:94955649-94955671 AAAACTACCCTAAAACTTAGTGG + Intergenic
911193907 1:94974745-94974767 CAAATTATTCCAAAACTTCGTGG + Exonic
912036318 1:105320627-105320649 CAAACTATTCTAAAACATAGAGG - Intergenic
912151856 1:106869175-106869197 CAAACTACTCAAAAACTTTGTGG - Intergenic
912177964 1:107183949-107183971 CAAACTATCCCAAAACTTAGTGG + Intronic
912178056 1:107184798-107184820 AAAACCACTCCAAAATTTAGTGG + Intronic
912358900 1:109078328-109078350 CAAATTACCCCAAAACTTAGTGG + Intergenic
912389287 1:109290963-109290985 CAAACCACTTCAAAATTTAGTGG + Intergenic
912600845 1:110931814-110931836 CAAACAACTCCAACAAAAAGGGG - Intergenic
912895091 1:113577970-113577992 CAGACTACCCTAAAACTTAGTGG + Intronic
912962198 1:114206411-114206433 CAAATGACCCCAAAACTTAGTGG + Intergenic
912973055 1:114302084-114302106 CAAACCATTCTAACACTTAGTGG - Intergenic
913022564 1:114803042-114803064 TAAACTACTCCAAAACGTAGTGG + Intergenic
913146693 1:115998330-115998352 CAAAGTACTCCAAAAAATAGAGG - Intronic
914359982 1:146926329-146926351 CAAATTGCTCCAAAACTTAGTGG + Intergenic
914464749 1:147916972-147916994 CAAATCACTCTAAAACTTAGTGG + Intergenic
914493769 1:148173566-148173588 CAAATTACTCCAAAACTTAGTGG - Intergenic
914856573 1:151356160-151356182 CAAACTACCCCAAAACTTAGTGG - Intergenic
915946723 1:160158117-160158139 CAAACTACCCTAAAACTTAGTGG + Intronic
916911462 1:169352020-169352042 CAAACTATTCCAAAAAATAGAGG + Intronic
917364383 1:174213422-174213444 CAAACTATTCCAAAAAATAGAGG + Intronic
917486024 1:175455301-175455323 CAAACCACCCCAAAACTTAGTGG - Intronic
917679118 1:177348229-177348251 CAAACTACCCCAAACCTTAAAGG - Intergenic
917839387 1:178965101-178965123 CAAGCCACCCCAACATTTAGTGG - Intergenic
918018377 1:180659908-180659930 CACACTACTCCAAAAAATAGAGG - Intronic
918092283 1:181307996-181308018 CAAACCACCCCAAAACTCAGAGG + Intergenic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
918605962 1:186426251-186426273 CAAACAACCTCAAAACTTAGTGG + Intergenic
918724948 1:187908912-187908934 CAAACTACCCCAAAATTTAGGGG - Intergenic
918748855 1:188244343-188244365 GAAACTACTGCAACACAGAGTGG + Intergenic
918865785 1:189897611-189897633 CAAACTACCCTAAAACTCAGTGG - Intergenic
918936446 1:190928436-190928458 CAAACCACCACAACACTTAGTGG + Intergenic
919240924 1:194914819-194914841 CAAAGTACCCCAAAACTTAGTGG + Intergenic
919562324 1:199137328-199137350 CAAATTACCACAAAACTTAGTGG + Intergenic
919569595 1:199230351-199230373 CAAATCACTCCAAAACATAGTGG + Intergenic
919672856 1:200353670-200353692 CAAACTATTCAAACATTTATTGG + Intergenic
920007334 1:202842999-202843021 CAGACTACCCCAAAACTTAGTGG - Intergenic
920287675 1:204892323-204892345 CAAGCCACCCCAAAACTTAGTGG + Intronic
921079701 1:211729256-211729278 CAGATTACCCCAACATTTAGTGG + Intergenic
921099251 1:211914055-211914077 CAAACTATCCCAAAATTTAGTGG - Intergenic
921195146 1:212749299-212749321 CAAAATAATCCATCACTTAAGGG + Intronic
921457055 1:215384323-215384345 CAAACTATTCCAAAAAATAGAGG + Intergenic
921694310 1:218190217-218190239 CAAACTATCCCAAAACTTAATGG + Intergenic
921746645 1:218748045-218748067 CAAACTATTCCAAAAAATAGAGG + Intergenic
921794997 1:219332503-219332525 AAAACTACCCCAAAACTTAGTGG - Intergenic
921819204 1:219597063-219597085 CAAATTACTCCAACACTTAGTGG - Intergenic
922008295 1:221554312-221554334 CAAACCACCCCAAATCTTAGTGG - Intergenic
922596443 1:226817205-226817227 CAAACTACCCCAAAACTCAGTGG + Intergenic
922999140 1:229991719-229991741 CAAATCACCCCAAAACTTAGTGG + Intergenic
923558155 1:235018128-235018150 CAAATTACCCCAAAACTTAATGG + Intergenic
924287164 1:242499712-242499734 CAAACCACCCCAAAACTTGGTGG + Intronic
924832234 1:247609307-247609329 CAAACTATTCCAACAAATAGAGG + Intergenic
1063502173 10:6564739-6564761 CAAACTGCTCCCAAACTTAGTGG - Intronic
1063687061 10:8247032-8247054 CAAATTACTCCAAAATTTAGTGG + Intergenic
1063687350 10:8249680-8249702 CAAACTTCTCCAACATGTGGTGG - Intergenic
1063738922 10:8795525-8795547 CAAATTACTCCAAAACCTAGTGG - Intergenic
1063836577 10:10021457-10021479 CAAACAACCCCAAATCTTAGTGG - Intergenic
1063863680 10:10340899-10340921 CAAACCACTTCAGAACTTAGTGG + Intergenic
1063887347 10:10593200-10593222 CAAATCACCCCAAAACTTAGTGG + Intergenic
1063978284 10:11434102-11434124 CAAATTACCCCCAAACTTAGTGG - Intergenic
1064452749 10:15457881-15457903 CAAACCACTCAAAAACCTAGTGG - Intergenic
1064636420 10:17372733-17372755 CAAATTACTCCAAAACTTAGTGG + Intronic
1064696490 10:17971377-17971399 CAAACTATTCCAAAAAATAGAGG - Intronic
1064879228 10:20031549-20031571 CAAACAACTCCAAAACTTGATGG + Intronic
1065019060 10:21487689-21487711 CAAGCCACTCCAAAGCTTAGTGG + Intergenic
1065381168 10:25091919-25091941 CAAACTATTCCAAAAAATAGAGG - Intergenic
1065661739 10:28010730-28010752 CAAACTGCCCCAAAACTCAGTGG + Intergenic
1065906969 10:30263922-30263944 CAAACTATTCCAAAAAATAGAGG + Intergenic
1066203160 10:33161154-33161176 CAAACTATCCCCAAACTTAGTGG + Intergenic
1066315146 10:34238505-34238527 CAAACATCTCCCACACATAGGGG + Intronic
1066526896 10:36290658-36290680 CAAACTATTCCAAAAAGTAGAGG - Intergenic
1066650309 10:37648926-37648948 CAAACCACTTCAAAAGTTAGGGG + Intergenic
1067016827 10:42763233-42763255 CAAACTATTCCAAAAAATAGAGG + Intergenic
1067551507 10:47239675-47239697 CATTCTACTCCAAAACTTAGTGG - Intergenic
1067798994 10:49344472-49344494 CAAACTATTCCAAAAAATAGAGG + Intergenic
1068002954 10:51358014-51358036 TAAATTACGCCAAAACTTAGTGG + Intronic
1068006177 10:51394114-51394136 CAAACCACTCCAAAACTTACCGG + Intronic
1068189148 10:53627502-53627524 ATAACTACCCCAAAACTTAGTGG - Intergenic
1068757603 10:60672064-60672086 CAAATTACACCAACACTTAGCGG - Intronic
1068894847 10:62188078-62188100 GAAACAACCCCAAAACTTAGTGG + Intronic
1069390075 10:67926045-67926067 CAAATTACCCCAAAACTTATTGG - Intronic
1069614112 10:69795647-69795669 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1069751134 10:70745667-70745689 CACACCACTCCAAAACTTAGTGG + Intronic
1070176581 10:73975652-73975674 CAAACCACTCCAAAATTCAGTGG - Intergenic
1070364001 10:75718164-75718186 CAAAATGCCCCAACACCTAGTGG + Intronic
1071108993 10:82132615-82132637 TAAACTATTCCAAAAATTAGAGG - Intronic
1071239246 10:83685961-83685983 CAAACCACTCCCAAACTTAATGG + Intergenic
1071371391 10:84955185-84955207 CAAGCCACTCCAAAACTCAGTGG + Intergenic
1071375012 10:84993594-84993616 TAAACTACCCCAGCACTTAATGG + Intergenic
1071605964 10:86989982-86990004 CAAACTATTCCAAAAAATAGAGG - Intergenic
1071667565 10:87575918-87575940 CAAACTATTCCAAAAAATAGAGG - Intergenic
1071731112 10:88249425-88249447 CAAATTACCCCAAAACTCAGTGG + Intergenic
1071810235 10:89171904-89171926 CAAACCACCCCAAAACTTAGGGG + Intergenic
1071879571 10:89881249-89881271 CAAACTATTCCAAAAAATAGAGG - Intergenic
1071964063 10:90834441-90834463 CAAACTACTGCAAAACCTTGCGG + Intronic
1071985352 10:91044872-91044894 CAAACTACCCCAAAACTTAATGG + Intergenic
1072033276 10:91541224-91541246 CAAACCACCCCAAAATTTAGTGG - Intergenic
1072037879 10:91580813-91580835 CAAATTACACCAACACGTAATGG - Intergenic
1072158429 10:92744674-92744696 CAAATTACCCCAAAACTTGGTGG + Intergenic
1072205056 10:93196198-93196220 CAAATCACCCCAAGACTTAGTGG - Intergenic
1072291456 10:93969399-93969421 AAAACTACCCCAAAACTTAGAGG + Intergenic
1072385352 10:94920175-94920197 CAAACTATTCCAAAAAATAGAGG - Intergenic
1072855718 10:98943957-98943979 CAGACTACTCCAAAACTGAGTGG - Intronic
1072993724 10:100224416-100224438 TAAATTACCCCAACATTTAGTGG - Intronic
1073967410 10:109007395-109007417 CAAACCACCCTAAAACTTAGTGG + Intergenic
1074915072 10:117947603-117947625 CAAATTACTCCAAAACCTAGTGG + Intergenic
1074976001 10:118582083-118582105 CAAACCACCCCAAAACATAGTGG - Intergenic
1075154546 10:119963821-119963843 CAAATTATCCCAAGACTTAGTGG + Intergenic
1075379915 10:122010813-122010835 CAAACCACCCCAACACTTAGTGG + Intronic
1075518408 10:123128317-123128339 CAAATTACTCCAAAACTTAGTGG + Intergenic
1075594510 10:123718651-123718673 CAAGCTACCCCAAAACTCAGTGG + Intronic
1077872655 11:6275586-6275608 CAAACTATTCCAAAAAATAGAGG + Intergenic
1077960478 11:7072089-7072111 CAAACTATCCCAAAACTTGGTGG + Intergenic
1078001032 11:7495995-7496017 CAAACCACGCCTAAACTTAGTGG + Intronic
1078123172 11:8531348-8531370 CAAACTACCCTAAAACTTAGTGG + Intronic
1078148019 11:8735462-8735484 CAAATCACCCCAAAACTTAGTGG - Intronic
1078381328 11:10843781-10843803 CAAATTGCTCCAAAACATAGTGG - Intronic
1078522531 11:12074869-12074891 CAAACCACCCCAAAACTTTGTGG + Intergenic
1078592801 11:12659841-12659863 CCAACCACCCCAAAACTTAGTGG - Intergenic
1078651272 11:13195769-13195791 CAAAATACCCCAAAACTAAGTGG - Intergenic
1078764923 11:14287088-14287110 AAAACAGCACCAACACTTAGGGG - Intronic
1078787271 11:14507100-14507122 TAAGCTACCCCAAAACTTAGGGG - Intronic
1078841758 11:15083065-15083087 CAAACTACCCCAAAGCTTAGTGG - Intergenic
1078928873 11:15898078-15898100 CAGATTACCCCAAAACTTAGTGG - Intergenic
1079573164 11:21969842-21969864 CAAACTAATCCAAGAGTTAATGG + Intergenic
1079728993 11:23916814-23916836 CAAACTACTTCAAAAAATAGAGG - Intergenic
1079982013 11:27161079-27161101 CAAATTACTCCAGAACTTACTGG - Intergenic
1080044774 11:27797477-27797499 CAGATTACCCCAAGACTTAGTGG + Intergenic
1080098856 11:28436346-28436368 TAAACCACTCCAAAACTTAGTGG + Intergenic
1080264926 11:30390647-30390669 CAAAGTACCCCAAAACCTAGTGG + Intronic
1080930065 11:36800556-36800578 CAAATTTCTCCAAAACTTAGTGG - Intergenic
1081408873 11:42731559-42731581 CTAATTACTCCCAAACTTAGTGG - Intergenic
1081770058 11:45644673-45644695 CAAGTCACTCCAAAACTTAGTGG + Intergenic
1082653388 11:55822520-55822542 CAAACCACTCCAAAACCTATTGG - Intergenic
1083039783 11:59674341-59674363 TAAACTACTCTAAAACTTTGTGG - Intergenic
1083061028 11:59872439-59872461 ATAACTACCCCAAGACTTAGTGG - Intergenic
1083157491 11:60833527-60833549 CAAACTACCCCAAAACTTTCTGG + Intergenic
1083563713 11:63695427-63695449 TTAACTCCTCCACCACTTAGGGG + Intronic
1083587074 11:63868026-63868048 CAAAGTACTCCAACAGTTTCTGG - Intronic
1084223004 11:67696418-67696440 CAAATTACCCCAAAACTGAGAGG + Intergenic
1084474571 11:69381447-69381469 CAAACAACTTCAGGACTTAGTGG + Intergenic
1085158917 11:74323031-74323053 CAAATTACCCCAACACTTAGTGG - Intergenic
1085168616 11:74427886-74427908 CAAACAACCCCATAACTTAGTGG - Intergenic
1085617288 11:78010617-78010639 CAAACCACTCCAAAACATAGAGG + Intergenic
1085719469 11:78900186-78900208 CAAATGACTCCAAAATTTAGTGG - Intronic
1086018176 11:82192680-82192702 CAAACTACAGCAAAACTCAGAGG + Intergenic
1086065451 11:82738893-82738915 CAAATTACTCCAAAACTTAGTGG + Intergenic
1086792501 11:91060227-91060249 CAAACAACTCCATCACAAAGTGG + Intergenic
1087181645 11:95148167-95148189 CAAACCACTCCATAACTTAATGG + Intergenic
1087292010 11:96330522-96330544 CAAACCACCCCAAAAGTTAGTGG + Intronic
1087350389 11:97024160-97024182 CAAACTATTCCAAAAAATAGAGG + Intergenic
1087460676 11:98442039-98442061 CAAACTATTCCAACAAACAGAGG - Intergenic
1087720496 11:101659783-101659805 CAAACTATTCCAAAAAATAGAGG - Intronic
1087874974 11:103344010-103344032 AAAACTACTCCATCACTTTTAGG + Intronic
1087884683 11:103465503-103465525 CAAACTAGCTCAAAACTTAGTGG + Intronic
1088308195 11:108432893-108432915 CAAACCACCCTAAAACTTAGTGG + Intronic
1088358867 11:108970530-108970552 CAAACTATGCCAAAGCTTAGTGG - Intergenic
1088616250 11:111631975-111631997 GAAACTACTTCAACTCTTTGTGG - Intronic
1088680466 11:112237247-112237269 CAAATTACTCCCAAACATAGTGG + Intronic
1088945428 11:114507339-114507361 GAAACTACTCCAACAAATTGAGG + Intergenic
1089082545 11:115788916-115788938 CAAAGTACTCCAAAACTTAGTGG - Intergenic
1089231472 11:116981099-116981121 CAAACCACTCCAAAATTTAGTGG + Intronic
1089271470 11:117304414-117304436 CAGACTACTCCAAAATTTAGTGG - Intronic
1089651117 11:119913758-119913780 AAAACCACTCCAAGACTTGGTGG - Intergenic
1089668759 11:120037485-120037507 CAAAATGCCCCAAAACTTAGTGG - Intergenic
1090008110 11:123020553-123020575 CAATTTACTCTAAAACTTAGTGG + Intergenic
1090174962 11:124640507-124640529 CAAGCTACCCCAAAACTTAGGGG - Intronic
1090316898 11:125799037-125799059 CAAACTATTCCAAAAAATAGTGG - Intergenic
1090452935 11:126822575-126822597 CAAACTACCCCAAAACTTAGTGG + Intronic
1090879589 11:130821892-130821914 CAGACCACTCCAAGATTTAGTGG - Intergenic
1090960738 11:131554359-131554381 CAAGCTCCTCCAATATTTAGTGG + Intronic
1091329223 11:134717599-134717621 CAAACTACCCCAAAATGTAGTGG + Intergenic
1091501248 12:1020137-1020159 CAAATTACTTCAAAACTTACTGG + Intronic
1091667039 12:2426582-2426604 CAAACTACCCGGATACTTAGTGG + Intronic
1091882829 12:3993303-3993325 CAAAGCACTCCAAAATTTAGTGG - Intergenic
1091941132 12:4483387-4483409 CAAACCACTCCAAAACTTAGTGG - Intergenic
1092297973 12:7217292-7217314 AAAACCACTCCAAAATTTAGTGG + Intronic
1092307415 12:7315701-7315723 CAAACCATCCCAGCACTTAGTGG + Intronic
1092320479 12:7468671-7468693 CAAACTATTCCAAAAAATAGAGG + Intronic
1092447641 12:8572417-8572439 CAAATTATACCAACACTTAGTGG + Intergenic
1092558947 12:9589125-9589147 CAAATTACTCCAAAGTTTAGTGG - Intergenic
1092959073 12:13578662-13578684 CAAACTAGCCCAACACTTAGTGG - Intronic
1093280975 12:17195843-17195865 CAAGCTAGCCAAACACTTAGTGG - Intergenic
1093292485 12:17344903-17344925 CACACTATTTCAACACTTTGAGG + Intergenic
1093517374 12:20004411-20004433 CAAATTACCCCAGAACTTAGTGG - Intergenic
1093602267 12:21042389-21042411 CAAACTATTCCAAAAAATAGAGG - Intronic
1094393888 12:29983360-29983382 CAAACGACTCCCAGAATTAGTGG - Intergenic
1095130723 12:38539135-38539157 CAAACCACCCCAAAATTTAGTGG - Intergenic
1095900131 12:47319388-47319410 CAAATTACCCCAAAACTTAGTGG - Intergenic
1096639938 12:52986026-52986048 AAAACCACTCCAAGACTTAGAGG + Intergenic
1097663239 12:62453417-62453439 CCAACTACTCTCACATTTAGAGG + Intergenic
1097684741 12:62680782-62680804 AAACCTCCTCCAAAACTTAGAGG - Intronic
1097959513 12:65518815-65518837 CAAACTACTCCAAAACTTAGTGG - Intergenic
1098181466 12:67851162-67851184 CAAACCACTGCAAAATTTAGTGG - Intergenic
1098233849 12:68399309-68399331 CAAATTACTCCAAAACTTAGTGG - Intergenic
1098457112 12:70686901-70686923 CAAATTACCCCAAAATTTAGTGG - Intronic
1098486700 12:71029684-71029706 CAAACTATCCCAAAACTTACTGG - Intergenic
1098577483 12:72059715-72059737 CAAACCACTCCAACCCTCAAAGG + Intronic
1098597366 12:72290466-72290488 CAAACTACTCTAGAACTTAGTGG + Intronic
1098635047 12:72772755-72772777 CAAACCACTGCAAAATTTAGTGG - Intergenic
1098985450 12:77007152-77007174 CAAACTACCCCAAAATGTAGTGG + Intergenic
1099549002 12:84019611-84019633 CAAACTAATCCAAAAGCTAGTGG + Intergenic
1099602848 12:84763490-84763512 CAAACTACCCCCACATTTAGTGG - Intergenic
1099808549 12:87550906-87550928 CAAACTATTCCAAAAAATAGAGG + Intergenic
1100060707 12:90571876-90571898 CAAACTACTCCAAAAAATAGAGG - Intergenic
1100682477 12:96942690-96942712 CAAATCTCTCCAACACTTTGAGG + Intronic
1100691205 12:97040202-97040224 CAAACTACTCCAAAACTTAGTGG + Intergenic
1100755431 12:97746128-97746150 CAAATTACTCCAAAACTTAGTGG - Intergenic
1101262531 12:103047608-103047630 CAAACCACCTCAATACTTAGAGG + Intergenic
1101448323 12:104754293-104754315 CAAATCACCCCAAAACTTAGTGG + Intronic
1101527572 12:105545589-105545611 CAAATTATCCCAAAACTTAGTGG - Intergenic
1101623125 12:106410114-106410136 CAAACAATTCTAAAACTTAGTGG + Intronic
1101637920 12:106561518-106561540 CAAACCACCCCAAAACTTAGTGG - Intronic
1102740845 12:115206189-115206211 CAAACTACCCCCAAACTTAGTGG - Intergenic
1102797974 12:115705803-115705825 CAAACCACTCCAAAACTTGATGG - Intergenic
1103169862 12:118808019-118808041 CAAACTATTCCAAAAAATAGAGG - Intergenic
1103395383 12:120602937-120602959 CAAATTACCCCAAAACTTAATGG + Intergenic
1103447931 12:121006610-121006632 AAAACTTCTTCAACACTTACTGG - Intronic
1104594195 12:130109179-130109201 CAAACTACTCTGAAACTTAGTGG - Intergenic
1105335564 13:19464270-19464292 CAAACCACCCCAAAACTTACTGG - Intronic
1105945141 13:25182923-25182945 CATACTACTCCAAAACTTAATGG + Intergenic
1106034595 13:26032291-26032313 CAAACCACCTCAGCACTTAGTGG + Intergenic
1106948433 13:34854981-34855003 TAAACCACTCCAAAACTTAGTGG + Intergenic
1107209786 13:37838334-37838356 CCCACTAATCCAACACTTTGGGG + Intronic
1107265638 13:38550470-38550492 CAAATTATTCCAACAAATAGAGG - Intergenic
1107391164 13:39965708-39965730 AAAATTACTCCAAAACTCAGTGG - Intergenic
1107705286 13:43097041-43097063 CAAACCACCCCAAAACTTAGTGG - Intronic
1107807520 13:44168158-44168180 CAAACTATTCCAAAAAATAGAGG - Intergenic
1107914689 13:45137461-45137483 CAAACCATCCCAAAACTTAGTGG + Intronic
1107996030 13:45861958-45861980 CAAATTACTCCAAAACTTGGTGG - Intergenic
1108586178 13:51871733-51871755 CAAATTACCCTAAAACTTAGTGG - Intergenic
1108723498 13:53156646-53156668 TAAACCACCCCAAAACTTAGTGG + Intergenic
1110126122 13:71944053-71944075 CAAACCACTACAAGACGTAGTGG - Intergenic
1110140595 13:72123935-72123957 CAAACCATACCAAAACTTAGGGG - Intergenic
1110155396 13:72310611-72310633 CAAACTAATTCAAAACTTAAAGG - Intergenic
1110448400 13:75614355-75614377 CAATCTATTCCAACAATAAGGGG - Intergenic
1110753538 13:79144794-79144816 CAAACCACTCCAAAACTTAGTGG + Intergenic
1110868208 13:80421106-80421128 CAAACTATCCTAAAACTTAGAGG - Intergenic
1111538319 13:89633637-89633659 CAAACTCTCCCAAAACTTAGGGG - Intergenic
1111878480 13:93925625-93925647 CAAACTATCCCAAAACTTTGTGG + Intronic
1111953147 13:94726726-94726748 CAAACTATGCCAAAACTTAATGG - Intergenic
1111956467 13:94763973-94763995 CAAAATACCCCAAACCTTAGTGG - Intergenic
1111971712 13:94923738-94923760 CAAACGACTCCAAAACTTAGTGG - Intergenic
1112217369 13:97446941-97446963 AAAACTATCCCAAAACTTAGGGG - Intronic
1112741926 13:102484682-102484704 CAAATTACTACAAAACTTAGTGG - Intergenic
1112784926 13:102941039-102941061 CAAACTACTCCAAAACTCTGTGG - Intergenic
1113002976 13:105664245-105664267 CAAATTATCCCAAGACTTAGTGG - Intergenic
1113568546 13:111337214-111337236 CAAATTACCCCAAAACTTAGTGG + Intronic
1114784487 14:25580902-25580924 CAAACAACCCCAACAATAAGTGG - Intergenic
1114785235 14:25589113-25589135 CAAACCACCCCAAAACCTAGTGG - Intergenic
1115044078 14:28968394-28968416 CAAATTACTTCAAAACTTCGTGG - Intergenic
1115123282 14:29962621-29962643 CAAGCTACTCCAAGACTTGGTGG - Intronic
1115146166 14:30228645-30228667 CAAACTACCCCAAAACTCAGTGG + Intergenic
1115591511 14:34870105-34870127 CAACCTACCCCAAAACTTGGTGG - Intronic
1115619571 14:35128382-35128404 CAAACTATTCCAAAAAATAGAGG - Intronic
1115692408 14:35858520-35858542 TTAATTACTCCAAAACTTAGTGG + Intronic
1116082286 14:40190034-40190056 CAAAGTACCCCAAGACTAAGTGG + Intergenic
1116387510 14:44349273-44349295 TAAACTTCCCCAAAACTTAGTGG + Intergenic
1116668547 14:47811155-47811177 CAAACTATTCCAAAACATAGAGG - Intergenic
1116724707 14:48548069-48548091 GAAACTATTCCAAAAATTAGAGG + Intergenic
1116804689 14:49481377-49481399 CAAACCACCCCAAAACTTAGTGG - Intergenic
1117020220 14:51562815-51562837 GAAACCACCCCAAAACTTAGTGG + Intronic
1117132827 14:52703267-52703289 CAAATTACCCCAAAACTAAGTGG + Intergenic
1117194626 14:53327349-53327371 AAACCTACCCCAAAACTTAGTGG - Intergenic
1117482738 14:56164580-56164602 CAAACTATTCCAAAAAATAGAGG - Intronic
1117648249 14:57875396-57875418 CAAACAACTCCAAACCTTAGTGG + Intronic
1117806223 14:59493494-59493516 CAAACTACCTCAATACTTAGTGG - Intronic
1117905375 14:60579725-60579747 ATAACTACTTCAAGACTTAGTGG + Intergenic
1118033853 14:61844921-61844943 CAAACTATTCCAAAAAATAGAGG - Intergenic
1118182957 14:63511532-63511554 CAAACCACTCCAAAACTTGGTGG - Intronic
1118477569 14:66132665-66132687 CAAATCACTCCAAAGCTTAGTGG + Intergenic
1118896658 14:69950865-69950887 CAAACTACCACAAAACTTAACGG + Intronic
1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG + Intronic
1119586090 14:75836982-75837004 CAAATTACTGTAACATTTAGTGG + Intronic
1119904443 14:78288792-78288814 CAAGCTATTCCATCTCTTAGTGG - Intronic
1120208120 14:81608045-81608067 GAAAATATTCTAACACTTAGGGG - Intergenic
1120313757 14:82865527-82865549 CAATGTACTCCAAAACTTACTGG + Intergenic
1120330152 14:83082198-83082220 CAAATTACCCTAACACTTTGTGG + Intergenic
1120537220 14:85711979-85712001 CAAATCCCTCCAAAACTTAGTGG + Intergenic
1120599537 14:86485081-86485103 CAAATTATCCCAAAACTTAGCGG - Intergenic
1120764225 14:88313788-88313810 CAAATAACCCCAACATTTAGTGG - Intronic
1120909947 14:89657193-89657215 CAAACTATGCCAAAACTCAGTGG - Intergenic
1121064982 14:90954292-90954314 CAAACTCTTCCAAAACATAGAGG - Intronic
1121074448 14:91056132-91056154 CAAATTATTCCAAACCTTAGTGG - Intronic
1121660214 14:95629490-95629512 CAAATTACTCCAAACCTTAGCGG - Intergenic
1121743719 14:96271601-96271623 AAAACCACTCCCACACTTAGTGG + Intergenic
1121801338 14:96776855-96776877 CAAACCACCCCAAAAGTTAGTGG + Intergenic
1121989160 14:98538385-98538407 CAAAATACTTCAACTCATAGTGG + Intergenic
1122586863 14:102814008-102814030 AAAACTACTACAAAACATAGGGG - Intronic
1122821630 14:104349318-104349340 CAAATGACTCCAAAACTTAGTGG + Intergenic
1123111724 14:105872767-105872789 CAAACTATTCCAAAAAATAGAGG - Intergenic
1123627337 15:22236848-22236870 CAAATTACCCCAAAACTTAGTGG + Intergenic
1124354835 15:28987250-28987272 CATATTATGCCAACACTTAGTGG + Intronic
1124413434 15:29455384-29455406 CAAACTATTCCAGAACATAGTGG - Intronic
1124476370 15:30038545-30038567 CAAATCACACCAAAACTTAGTGG - Intergenic
1124594042 15:31079222-31079244 CAAATTGCCCCAAAACTTAGTGG + Intronic
1124845335 15:33284469-33284491 CAAACCACTCCCACACTCAGTGG + Intergenic
1124903430 15:33845852-33845874 CAAACCACTCTAAAACTCAGTGG + Intronic
1125233710 15:37486280-37486302 CAATCTACTGCAACATGTAGAGG - Intergenic
1125272805 15:37958403-37958425 CAAACAACTCCACCAAATAGTGG + Intronic
1125329867 15:38572539-38572561 CAAACTACTCCAAGATAAAGGGG - Intergenic
1125848049 15:42876176-42876198 CAAACTACATCAAAATTTAGAGG - Intronic
1126317869 15:47390061-47390083 CAAACTACCCCAAAACTCAGTGG + Intronic
1126571816 15:50159933-50159955 CAAACTATTCCAAAAAATAGAGG - Intronic
1126741529 15:51781414-51781436 CAAATTACTCCAAAACTTAGAGG + Intronic
1126840400 15:52712051-52712073 CAAACCACTCCAAAACTTAAGGG + Intergenic
1126974114 15:54155107-54155129 CAAACCACTCCAAAACTCAGTGG + Intronic
1127013054 15:54651063-54651085 CAAACTATTCCAAAATATAGAGG + Intergenic
1127163353 15:56215740-56215762 TAAACTACTCAAAAACTTAATGG + Intronic
1127177676 15:56378260-56378282 CAAACTATTCCAAAAATTGGAGG - Intronic
1127213300 15:56798163-56798185 CAAACCATCCCAACACTTAATGG + Intronic
1127214381 15:56809374-56809396 TAAATTACCCCAAAACTTAGTGG + Intronic
1127528116 15:59814270-59814292 CAAAATACCCCAGAACTTAGTGG + Intergenic
1127553324 15:60062714-60062736 CAAATTACACCAAAACTTAGTGG + Intergenic
1127780591 15:62310745-62310767 CAAACTATTCCAAAAAATAGAGG + Intergenic
1127848575 15:62893209-62893231 AAAACTACTCTAACACTTGTGGG - Intergenic
1127909110 15:63401350-63401372 CAAACCACCCCAAAGCTTAGTGG - Intergenic
1127938848 15:63672187-63672209 AAAAATACTCAAAAACTTAGGGG + Intronic
1128114853 15:65098841-65098863 CAAACTACCCCGAAACTTAGTGG - Intronic
1128664197 15:69526392-69526414 CAAACGACCCCAAAACTCAGTGG - Intergenic
1128724339 15:69976697-69976719 CAAACCACCCCAAAACATAGTGG + Intergenic
1128763878 15:70238946-70238968 CAAAGCACTACAACACTTAGTGG + Intergenic
1129139049 15:73579976-73579998 TAAATTACCCCAAAACTTAGTGG - Intronic
1129224019 15:74155483-74155505 CAAACCACTCTAAAACTTAATGG - Intergenic
1129287224 15:74535370-74535392 CAAACTACCTCAAAACTTACTGG + Intergenic
1129496010 15:75981440-75981462 CATACTACCCCAAAACTCAGTGG - Intronic
1129546113 15:76397364-76397386 CAAACTATTCCAAAAAATAGAGG - Intronic
1130401335 15:83557484-83557506 CAAACCACTCCAAAATTCAGTGG + Intronic
1130603145 15:85291715-85291737 CAAACTACCCCAAAACTCAGTGG + Intergenic
1131010149 15:89010755-89010777 CAACCTACTCCAACATTTAGCGG + Intergenic
1131105879 15:89734188-89734210 CAAACCACCCCAAAACTTAATGG + Intronic
1131231138 15:90660467-90660489 CAAATTGCCCCAAAACTTAGTGG - Intergenic
1131476406 15:92743924-92743946 CAAACTACCCTATAACTTAGTGG + Intronic
1131639288 15:94272797-94272819 TAAAGAACTCCAACACTTAGTGG - Intronic
1132064731 15:98721460-98721482 CAAACCACTCAGACACTAAGTGG - Intronic
1132311325 15:100860066-100860088 CAAATGACTCCAAAACCTAGCGG - Intergenic
1132343187 15:101090880-101090902 CAAAGCACCCCAAAACTTAGCGG - Intergenic
1133224371 16:4333579-4333601 CAAAGTACCCCAACACTGAGTGG + Intronic
1133428867 16:5718409-5718431 CAAACCACACCAAAACTCAGTGG - Intergenic
1133817197 16:9207021-9207043 CCAACTATTCCAAAACTTAATGG - Intergenic
1135145726 16:19961253-19961275 AAAACTACCCCAAAACTTAGTGG + Intergenic
1135193551 16:20375637-20375659 GAAAATACACCAACCCTTAGAGG - Intronic
1135231816 16:20715793-20715815 CAAACCATCCCAGCACTTAGTGG + Intronic
1135266466 16:21030599-21030621 CAAACTACCCTAATACTTAACGG - Intronic
1135356979 16:21777060-21777082 CAAATTATTCCAAAACTCAGTGG - Intergenic
1135455482 16:22593174-22593196 CAAATTATTCCAAAACTCAGTGG - Intergenic
1135486895 16:22873683-22873705 CAAACCACCCCAAAACTTAGTGG + Intronic
1135529941 16:23244634-23244656 CAAAGTATCCCAACACTTAGTGG - Intergenic
1135626713 16:24001985-24002007 CAAACCATTCCAAAATTTAGTGG + Intronic
1135781223 16:25302871-25302893 CAAACTACCCCAAAACTGAGTGG + Intergenic
1135816337 16:25637512-25637534 CAAATTATCCCAAAACTTAGTGG - Intergenic
1135852001 16:25972284-25972306 CAAATTACCCCAAAACTTGGTGG + Intronic
1137909001 16:52356594-52356616 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1138136238 16:54525472-54525494 CAAACCACCCCAAAACTTAGGGG + Intergenic
1138221188 16:55251697-55251719 CACATTATTCCCACACTTAGTGG - Intergenic
1138524619 16:57595641-57595663 CAAATCACTCCAACACTCAGTGG + Intergenic
1138677058 16:58659085-58659107 TAAACCACCCCAAAACTTAGAGG - Intergenic
1138981584 16:62275174-62275196 CAAACCACCCCAAAACTTAATGG - Intergenic
1139133370 16:64172816-64172838 CAAACTACACCAAAACTTGGTGG - Intergenic
1139140099 16:64251731-64251753 CAAGCCACTCCACAACTTAGTGG + Intergenic
1139415689 16:66807218-66807240 CAAACCACTTCAAAACTTAGTGG - Intronic
1140066274 16:71614191-71614213 CAAATCACTCCCAAACTTAGAGG + Intergenic
1140294082 16:73690933-73690955 CAAACTACTCCAAACCATAGAGG - Intergenic
1140791089 16:78391838-78391860 CAAATTACTCCAAAATTTAGTGG + Intronic
1140916267 16:79496143-79496165 ACAAATACTCCTACACTTAGTGG - Intergenic
1141276792 16:82595661-82595683 CAAACCACTCCCAAATTTAGTGG + Intergenic
1141713229 16:85712341-85712363 CAAACTATGCCAAAACTTTGTGG - Intronic
1141745771 16:85925303-85925325 CTAACTATTCCTAAACTTAGTGG + Intergenic
1141822052 16:86453173-86453195 CAAACCACCCCTAAACTTAGAGG - Intergenic
1141844282 16:86596559-86596581 CAAACTACTCCACCTCTCTGTGG - Intergenic
1141848462 16:86627380-86627402 CAAACAGCTCCAAAACTTATTGG + Intergenic
1141976618 16:87520530-87520552 CAAATTACCCCAAAACTTAGTGG - Intergenic
1143603700 17:7967839-7967861 CAAACCACCCCAAAACTTCGTGG + Intergenic
1143707751 17:8711183-8711205 CAATCTACCCCAAAACTGAGTGG - Intergenic
1143967764 17:10769073-10769095 CAAACTATGCCAAAACTCAGTGG - Intergenic
1143968654 17:10775930-10775952 CAAAGTATTCCAAAACTGAGTGG - Intergenic
1144000460 17:11049459-11049481 CAAATGACTCCAAAACTTAATGG + Intergenic
1144004010 17:11083613-11083635 CAAATTACCCCACAACTTAGAGG + Intergenic
1144406097 17:14954080-14954102 CAAACTACCCAAAGACTTAGTGG - Intergenic
1144580921 17:16458913-16458935 CAAACTACCCCAAAACTTAGTGG - Intronic
1144595908 17:16569932-16569954 CAAACCACCCCAAAACTTAGTGG + Intergenic
1144717466 17:17444448-17444470 CAAATGACCCCAAAACTTAGTGG - Intergenic
1144925048 17:18799207-18799229 CAAATCACTCCAAAACATAGTGG + Intronic
1144966640 17:19080630-19080652 CAAACCACCCCAAAACTCAGTGG - Intergenic
1144981278 17:19171427-19171449 CAAACCACCCCAAAACTCAGTGG + Intergenic
1144986946 17:19206812-19206834 CAAACCACCCCAAAACTCAGTGG - Intergenic
1145066344 17:19763878-19763900 CAAGCCACTCCAAAACTTAATGG - Intergenic
1145967240 17:28928322-28928344 CAAACTACGCCAAAACTCATTGG - Intronic
1146101086 17:29983012-29983034 CAAAATACTCCAAAACTTCATGG + Intronic
1146638598 17:34523901-34523923 CAAATTACCCCAACACAGAGTGG - Intergenic
1146734130 17:35222716-35222738 CAAACCACCCCAAAACTTAGTGG - Intergenic
1149231505 17:54539919-54539941 CAAACTAGTCCAAAAAATAGAGG + Intergenic
1149242400 17:54665307-54665329 CAAACTTATCCACCATTTAGAGG - Intergenic
1149245810 17:54706338-54706360 CAAACAACAACAACACTTTGTGG + Intergenic
1149450237 17:56744486-56744508 CAAACTACTCTGAAACTTAGTGG + Intergenic
1149460136 17:56822158-56822180 CAAACCACTCCTAGTCTTAGTGG - Intronic
1149561683 17:57611929-57611951 CAAACTGCCCCCAAACTTAGTGG - Intronic
1149578683 17:57732099-57732121 CAAGCTACTTCAAAACTTAATGG + Intergenic
1149629380 17:58109496-58109518 GAAATTACTCCAAAACTTAGTGG - Intergenic
1149711567 17:58747036-58747058 CAAACTATCCCAAAACTTAGTGG - Intergenic
1149731182 17:58947725-58947747 CAAATTACCACAAAACTTAGTGG + Intronic
1149790975 17:59476750-59476772 AAAACTACCCCAAAACGTAGTGG - Intergenic
1149821217 17:59779667-59779689 CAAATCACCCCAACATTTAGTGG + Intronic
1151266134 17:72956858-72956880 CAAAACACCCCAAAACTTAGTGG + Intronic
1151339419 17:73460468-73460490 CAAACTACCCCAAAACATAATGG - Intronic
1151423608 17:74015260-74015282 CAAACTACCCTAAAACTTAGTGG + Intergenic
1151487237 17:74408632-74408654 CACACTACCCCAAAACTTAGTGG - Intergenic
1152016633 17:77755342-77755364 CAAATTACCCCAAAACTTAGTGG - Intergenic
1152201719 17:78951139-78951161 CAAGTTACCCCAAAACTTAGAGG - Intergenic
1152203950 17:78963681-78963703 CAAACTGCTCCAAAACTCGGTGG - Intergenic
1152650871 17:81492042-81492064 CAAATTACTCCAAAACACAGGGG - Intergenic
1153111234 18:1590256-1590278 CAAACCACTTCAAAACTAAGTGG - Intergenic
1153201635 18:2653724-2653746 CGAACTTCCCCAAAACTTAGTGG - Intergenic
1153871048 18:9320386-9320408 CAAATTACCCCAAAACTCAGTGG - Intergenic
1155443734 18:25888734-25888756 CAAACTATTCCAAAAAATAGAGG + Intergenic
1156058942 18:33049188-33049210 CAAAAAACCCCAACATTTAGTGG + Intronic
1156780359 18:40843468-40843490 CAAACCACCCCAAAACTTAGTGG - Intergenic
1157089364 18:44618109-44618131 CAAACCATTCCAACAAATAGAGG + Intergenic
1157101114 18:44730848-44730870 CAAACTACCCCAAAACTCAGTGG + Intronic
1157450285 18:47781205-47781227 CAAACCATCCCAAAACTTAGTGG - Intergenic
1157547787 18:48559490-48559512 AAAACCACCCCAAAACTTAGTGG + Intronic
1157643272 18:49239846-49239868 CAAACTACCCCAAAACTTAGTGG - Intronic
1157788152 18:50505431-50505453 CAAATTACCTCAACACTTGGTGG - Intergenic
1158288598 18:55913313-55913335 CAAAACACTCCAAAACTCAGTGG - Intergenic
1158926553 18:62269960-62269982 CAAACTACCCCAAAACATAATGG + Intronic
1158938717 18:62387798-62387820 CAAACCACCCAAAGACTTAGTGG + Exonic
1159081913 18:63744427-63744449 CAAACTACCCCAAACCTTAGTGG + Intergenic
1159379340 18:67636702-67636724 CACACTGCTCAAACATTTAGAGG + Intergenic
1159482839 18:69012801-69012823 CAAACAACTCCAAATCTCAGTGG - Intronic
1159558302 18:69967776-69967798 CAAACTACCCCAAAGTTTAGTGG + Intergenic
1159604269 18:70458588-70458610 AAAAGTACTTCAACATTTAGAGG - Intergenic
1161330510 19:3684667-3684689 CAAACCACTGCCACACTGAGAGG - Intronic
1161638360 19:5403628-5403650 AAAACTACCCCAAAACTTAGTGG - Intergenic
1164490604 19:28709677-28709699 CACACTACTTCAGAACTTAGGGG - Intergenic
1164661584 19:29976211-29976233 AAAATTACTGCAAAACTTAGTGG + Intronic
1164969326 19:32517637-32517659 CAAAGTACTCCAAAACTTAGTGG + Intergenic
1165112099 19:33508437-33508459 TAAACGACTCCAACACTTAGTGG + Intronic
1166020052 19:40018942-40018964 CAAACTACTCCAAAACTTAGTGG - Intergenic
1166537581 19:43584597-43584619 CAAACCACTCCAAAATTTAGTGG + Exonic
1167179958 19:47895501-47895523 CAAACCACCCCCAAACTTAGTGG + Intergenic
1167573158 19:50303080-50303102 CAAACTACTCTGAAACTTAGTGG + Intronic
1167949250 19:53013189-53013211 CAAACTAAACCCACACTGAGGGG - Intergenic
1168449478 19:56453319-56453341 CAAACTATTCCAAAAAATAGAGG + Intronic
1168520638 19:57047682-57047704 CAAACCACCTCAAAACTTAGTGG - Intergenic
925291626 2:2751957-2751979 CAAATTACCCCAAAACTTAATGG + Intergenic
925411947 2:3644866-3644888 CAAATTACCCCAAAACTCAGTGG + Intergenic
925773816 2:7311865-7311887 CAATTTACTCCAAGCCTTAGGGG - Intergenic
926096349 2:10083033-10083055 CAAAGAACAACAACACTTAGAGG + Intergenic
926156432 2:10456683-10456705 CAAATTACCCCAAAACTTAGTGG - Intergenic
926671992 2:15585342-15585364 ACAACTACACCAAAACTTAGAGG - Intergenic
926684128 2:15685429-15685451 CCAACGACCCCAAAACTTAGTGG + Intergenic
926709586 2:15867825-15867847 CAAACTGCCCCCAAACTTAGTGG - Intergenic
926805863 2:16710363-16710385 CAAAGTACTCCAAAAATTAATGG - Intergenic
927040283 2:19223069-19223091 CAAACCACTCCAGAACTTAGAGG - Intergenic
927140359 2:20126048-20126070 CAAACCACTCCAAAGCTCAGTGG - Intergenic
928266982 2:29820479-29820501 CAAATTCCCCCAAAACTTAGTGG - Intronic
928609611 2:32978750-32978772 CAAACTATTCCAAAAGATAGAGG - Intronic
928956295 2:36872548-36872570 CAAATTATGCCAAAACTTAGCGG - Intronic
928964332 2:36962306-36962328 CATACAACTCTAACACTTACAGG + Intronic
929281336 2:40083272-40083294 CAAACTATTCCAAAAAATAGAGG - Intergenic
929370442 2:41217396-41217418 CAAAGTATTCTAAAACTTAGCGG - Intergenic
929542867 2:42835800-42835822 CAAACTGTCCCAAAACTTAGGGG + Intergenic
929741306 2:44603478-44603500 CAAAATACCCCAAAATTTAGTGG + Intronic
929802448 2:45115931-45115953 CAAATGACTCCAAAACTCAGTGG + Intergenic
929927284 2:46224779-46224801 CAAATTACCTCAAAACTTAGTGG + Intergenic
930105818 2:47638520-47638542 CAAACCATCCCAAAACTTAGTGG + Intergenic
930151366 2:48063304-48063326 CAAATTACCCCAAAATTTAGTGG + Intergenic
931457224 2:62420697-62420719 CAAACTATTCCAAAAAGTAGAGG + Intergenic
931460389 2:62445095-62445117 CAAACTGCCCCAAAACTTAGTGG + Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932270125 2:70401974-70401996 CAAATTACTCCAAAACCGAGTGG + Intergenic
932301447 2:70670152-70670174 CAAACCACCCTAAAACTTAGTGG + Intronic
932324638 2:70849920-70849942 CAAATTACCCTAAAACTTAGTGG - Intergenic
932824684 2:74928515-74928537 CAAACTGCCCCAAAACTTAATGG + Intergenic
932880275 2:75494759-75494781 AAAACTACCCCAAAACTTAGTGG - Intronic
932909642 2:75792196-75792218 CAAACCACTCCAAAACTTAGTGG + Intergenic
933078263 2:77956095-77956117 CAAACTAGTCCAAAAAATAGGGG + Intergenic
933198033 2:79414971-79414993 CAAACTGCCCCAAAACTTGGTGG - Intronic
933407364 2:81877744-81877766 CAAACCATTCCAACATTTAGTGG - Intergenic
935334027 2:101998471-101998493 AAAACTATCCCAAAACTTAGTGG + Intronic
935577998 2:104730749-104730771 CAAACTGCACCAAACCTTAGTGG + Intergenic
935794863 2:106631353-106631375 AAAACCACCCCAAAACTTAGTGG + Intergenic
935928079 2:108092215-108092237 CAAACTATTCCAAAAAATAGAGG - Intergenic
936404859 2:112193946-112193968 TAAAATATCCCAACACTTAGTGG + Intergenic
936410885 2:112257093-112257115 TAAACTACTTAAAAACTTAGTGG - Intergenic
936823910 2:116557178-116557200 CAAACTACTCCATCAAAAAGTGG + Intergenic
937071103 2:119063983-119064005 CAAACAACTCCAAAAGTCAGTGG - Intergenic
937194344 2:120137802-120137824 CAAACTATTCCAAAAAATAGAGG + Intronic
937238435 2:120444662-120444684 CAAATTACTTCAACATGTAGTGG + Intergenic
937269881 2:120642711-120642733 CAAACCACTCTAAAACTCAGTGG + Intergenic
937348076 2:121140007-121140029 CAAACCACTTCAAAACTCAGTGG - Intergenic
937527277 2:122786905-122786927 CAAACCACTCCAAAACTCAGTGG - Intergenic
937894141 2:126964511-126964533 CAACTTACTCCAAAACATAGAGG - Intergenic
938574148 2:132588352-132588374 TAAACTATCCCAACACTTACTGG + Intronic
939081077 2:137662542-137662564 CTACCTACTCTAACATTTAGTGG + Intronic
939965885 2:148610027-148610049 CCAACTACACCAAAACTTAGTGG + Intergenic
940070648 2:149683630-149683652 CAAACAATTCCAAAATTTAGAGG - Intergenic
940104363 2:150081669-150081691 CAAACCAATCCAAAACTCAGTGG + Intergenic
940324935 2:152415223-152415245 AAAACTCCTCCATCACTGAGAGG - Intronic
940387789 2:153093719-153093741 CAAACTATTCCAAAAACTAGAGG - Intergenic
940425715 2:153529511-153529533 CAAACTGCTCCAAAAAATAGAGG + Intergenic
940488117 2:154322705-154322727 CAAATTACCCCAAAACTTAGTGG + Intronic
940720150 2:157273294-157273316 CCAACAATTCCAACAATTAGAGG - Intronic
940737347 2:157468184-157468206 CAAATGATCCCAACACTTAGTGG - Intronic
941047544 2:160693698-160693720 CAAACTATTCCAAAAAATAGAGG - Intergenic
941075812 2:161005262-161005284 CAAACCACCCCAAAACTAAGTGG - Intergenic
941204649 2:162557006-162557028 CAAACCACCTCAACACTTAGTGG + Intronic
941358598 2:164523261-164523283 CAAACTATTCCAAGCCTTTGTGG - Intronic
941765354 2:169290724-169290746 CAAAGCACCCCAAGACTTAGTGG - Intronic
941894505 2:170615573-170615595 CAAATTACACCAAAACTTAGTGG + Intronic
942001198 2:171648761-171648783 CAAACTATTCCAAAAAATAGAGG - Intergenic
942181420 2:173384482-173384504 CAAATTACCTCAAAACTTAGTGG - Intergenic
942212070 2:173681265-173681287 CAAGCCCCTCCAAAACTTAGTGG + Intergenic
942566309 2:177267558-177267580 CAAAATCCTCCATCACTTTGAGG + Intronic
943139175 2:183957643-183957665 CAAACTACTCCAAGTATTAGTGG + Intergenic
943862062 2:192879212-192879234 CAAAGCACTTCAAAACTTAGTGG - Intergenic
944128771 2:196323066-196323088 GAAAATACTCCTCCACTTAGTGG + Intronic
944189425 2:196985336-196985358 CAAATTACCCCAAAACTTAGTGG - Intronic
944434480 2:199672465-199672487 CAAATCACCCCAAAACTTAGCGG + Intergenic
944454813 2:199882394-199882416 TAAACTCCCCCAAGACTTAGTGG + Intergenic
944550820 2:200843131-200843153 CAAACTATTCCAACAAATAAAGG + Intergenic
944584263 2:201159732-201159754 CAAATCACTCCAAAATTTAGTGG + Intronic
944622797 2:201534349-201534371 CAAACCACTCCAAAACCTAGTGG - Intronic
944628991 2:201603131-201603153 CAAACCATTCCAAAACTTAGTGG - Intronic
944747914 2:202676697-202676719 AAAATTACCCCAAAACTTAGTGG - Intronic
944930535 2:204514236-204514258 CAAACTACCCTCAAACTTAGTGG - Intergenic
945190923 2:207186669-207186691 CAAATTACCCCTAAACTTAGTGG + Intergenic
945266946 2:207899990-207900012 CAAATTACCCCAAAACTTAGTGG + Intronic
945794805 2:214348845-214348867 CAAACTGCTCCAAAACTTAGAGG - Intronic
945876347 2:215281945-215281967 CAAATTACTCCAAAACTTACTGG - Intergenic
945951382 2:216042023-216042045 CAAATTACTCCAACCCAAAGAGG + Intronic
946012578 2:216578114-216578136 CAAGCCACTGCAAAACTTAGTGG + Intronic
946047887 2:216836463-216836485 AAAACTACCCCAAAATTTAGTGG + Intergenic
946139669 2:217678977-217678999 CAAACTACCCTAAAACTTGGTGG - Intronic
946573871 2:221053191-221053213 TGAACTACTCCAAAGCTTAGGGG + Intergenic
946669806 2:222090431-222090453 TAAACTACACCAACACTTAGAGG - Intergenic
946677797 2:222180983-222181005 CAAACAACTCCAAATGTTAGTGG - Intergenic
946853566 2:223930995-223931017 CAAACTACCTCAAAACTCAGTGG - Intronic
946856398 2:223954369-223954391 CAAATTACTCCAGAACTTAGTGG + Intergenic
946908313 2:224436817-224436839 CAAACCACCCCATAACTTAGTGG - Intergenic
947073014 2:226311959-226311981 CCAACTATCCCAACACTCAGTGG + Intergenic
947346314 2:229193035-229193057 TAAATTACTCCAACATTCAGTGG + Intronic
947526778 2:230881917-230881939 CAAACCATCCCAAAACTTAGTGG + Intergenic
947580312 2:231312049-231312071 AAAACTACCCCAAATCTTAGTGG + Intronic
947773942 2:232692928-232692950 CAAATTACCCCAAAACATAGTGG + Intergenic
948071438 2:235131021-235131043 CAAACCACCTCAAAACTTAGTGG + Intergenic
948073985 2:235150763-235150785 CAAACCTCCCCAAAACTTAGCGG - Intergenic
948114688 2:235485770-235485792 TGAATTACTCCAACATTTAGTGG + Intergenic
948290695 2:236822171-236822193 CCCACTACTCCAAAACTTAGTGG - Intergenic
948678703 2:239615599-239615621 CAAACCACTCCAAAACTTAGTGG - Intergenic
1168797647 20:622212-622234 CAAACTACCCCAAAACTCCGTGG - Intergenic
1168916831 20:1495823-1495845 CAAACTATTCCAAAAAATAGAGG - Intergenic
1169028266 20:2387714-2387736 CAAACTGCCCCAGCACTTAGGGG + Intronic
1169124752 20:3119494-3119516 CAAATTACCCCAAAACTTACTGG - Intronic
1169171470 20:3469201-3469223 CAAACCTCTCTAAAACTTAGAGG + Intergenic
1169288146 20:4326653-4326675 CAAACTTCCCCAGAACTTAGTGG + Intergenic
1169423272 20:5476302-5476324 CAAACAACTCCATCAATAAGTGG + Intergenic
1169461279 20:5797954-5797976 CTAACTACCCCAAAATTTAGTGG + Intronic
1169502168 20:6171167-6171189 CAAATTACTCTAAAACTTAGTGG + Intergenic
1169764956 20:9139230-9139252 CAAACCACTCCAAAACTTACTGG + Intronic
1169841258 20:9940448-9940470 CAAAATACCCCAAAGCTTAGTGG + Intergenic
1169869436 20:10235617-10235639 CAAACCACCCCAAAACTCAGTGG + Intronic
1169875931 20:10297098-10297120 CAAACAACTCCAAAACTGAGTGG + Intronic
1169940680 20:10933922-10933944 CAAAGTTCTACAACACTCAGAGG - Intergenic
1170118880 20:12891336-12891358 CAAACAATTCCAAAACTTAGTGG + Intergenic
1170194675 20:13677560-13677582 CAAACCACCACAAAACTTAGTGG - Intergenic
1170272825 20:14547683-14547705 CAAACCACTCCAAAACTTGGTGG + Intronic
1170416102 20:16144055-16144077 TAAACCACCCCAAAACTTAGTGG - Intergenic
1170455730 20:16531019-16531041 CAAATTACCCCAAAACTTAGGGG - Intronic
1170481323 20:16767848-16767870 AAAACCACTCCTAAACTTAGTGG - Intronic
1170516117 20:17132136-17132158 AAAACCACCCCAAAACTTAGTGG - Intergenic
1170579438 20:17686801-17686823 CAAACCACTCCCAAACTCAGTGG + Intergenic
1170603157 20:17857185-17857207 CAAACCACTCCAAAATGTAGTGG + Intergenic
1170632780 20:18079701-18079723 CAATCTACCCCAAAACTTATGGG - Intergenic
1170643570 20:18177089-18177111 TAAACCACTCCAAAACTTAGTGG + Intronic
1170656663 20:18293139-18293161 CAAACCACTCTAAAACTGAGTGG + Intronic
1170667746 20:18401423-18401445 CAAAACACCCCAAAACTTAGTGG + Intronic
1170708875 20:18771065-18771087 CAAACTATTCCAAAAAATAGAGG - Intergenic
1170810964 20:19674259-19674281 CAAACCATCCCAAAACTTAGTGG + Intronic
1170819646 20:19745701-19745723 CAAACTACCCCTAAACTTAGTGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1170947538 20:20904804-20904826 CAAACCACGTCAAAACTTAGTGG + Intergenic
1171215019 20:23346044-23346066 CAGACCACTACAAAACTTAGTGG + Intergenic
1171328947 20:24320435-24320457 CAAACTACCCCAAAACATAGTGG - Intergenic
1171345900 20:24466127-24466149 CAAACTACTCTGAAACTCAGTGG - Intergenic
1171491351 20:25520305-25520327 CCTTCTTCTCCAACACTTAGTGG - Intronic
1171979794 20:31619592-31619614 CAAATTACCCCAAAATTTAGTGG - Intergenic
1172179262 20:32990882-32990904 CAAACCATCCCAAAACTTAGGGG - Intronic
1172223198 20:33287602-33287624 CAAACTTCTCCACCACACAGTGG - Intronic
1172703622 20:36866996-36867018 CAAATGACCCCAAAACTTAGTGG - Intergenic
1172789354 20:37491898-37491920 CAAACTACACCAAACATTAGTGG + Intergenic
1172959785 20:38790482-38790504 CCAACTACTCCAAAACTTAGAGG - Intergenic
1173363100 20:42361858-42361880 CAAATCACTCCAAAATTTAGTGG - Intronic
1173547756 20:43912327-43912349 CAAATCACTCCAAAACTTTGTGG + Intergenic
1173562150 20:44013597-44013619 CAAACTACCCCAATACCTAGTGG + Intronic
1174433719 20:50490378-50490400 CAAACTACCTCAAAACCTAGTGG + Intergenic
1174532140 20:51222468-51222490 CAAACCACTCCAAAATTTAGGGG + Intergenic
1174625962 20:51914553-51914575 CAAACCACCTCAACACTTAATGG + Intergenic
1174715571 20:52754442-52754464 CAAATTACCCCAAAACTTAGTGG + Intergenic
1174821450 20:53729904-53729926 CAAACCACTCCAACATTTAGTGG - Intergenic
1175033812 20:55980818-55980840 CAAATTACTCTAAAACTTAGTGG - Intergenic
1175616726 20:60406056-60406078 CAAACTACCCAAACATTGAGTGG - Intergenic
1175693251 20:61081625-61081647 CAAATTACCCCAACACTGAATGG - Intergenic
1176738013 21:10570714-10570736 CAAACCACCCCAAAACTTACTGG + Intronic
1177108221 21:16988158-16988180 CAAACTATTCCAAAAAATAGAGG - Intergenic
1177256559 21:18670613-18670635 CAAACTACTCCAAAAAATGGAGG + Intergenic
1177328825 21:19629463-19629485 CATACTAGTCCAAAATTTAGTGG - Intergenic
1177339365 21:19780218-19780240 CAAACTACTCCATCAAAAAGTGG - Intergenic
1177771643 21:25523204-25523226 CAAACTATTCCAAAAAATAGAGG + Intergenic
1177850280 21:26338490-26338512 CAAACTATTCCAAAAAATAGAGG + Intergenic
1177961987 21:27679024-27679046 AAAAATACTCCAATGCTTAGTGG - Intergenic
1178003225 21:28187859-28187881 CAAACAACTCCAAGTCTTATTGG + Intergenic
1178030968 21:28525498-28525520 CAAACCATTCAAAAACTTAGTGG - Intergenic
1178032907 21:28548189-28548211 CAAATGACCCCAAAACTTAGTGG - Intergenic
1178082787 21:29082279-29082301 CAAACCACTCCAAATCTCAGTGG + Intronic
1178484325 21:33007845-33007867 TAAACTACAGCAAGACTTAGTGG - Intergenic
1179026048 21:37679305-37679327 CAATTTACCCCAAAACTTAGTGG - Intronic
1179342716 21:40527676-40527698 CAAACTACTTCAAAACTTAGTGG - Intronic
1179648017 21:42787084-42787106 CAAACCTCCCCAACACTTAGTGG + Intergenic
1180176085 21:46090583-46090605 CAAACCATTCTAACACTTAATGG - Intergenic
1181385116 22:22539099-22539121 CAAATTATCCCAAAACTTAGTGG - Intergenic
1181445154 22:22965802-22965824 CAAACTACTCTAAAATATAGAGG - Intergenic
1182039598 22:27226450-27226472 CAAACTACCCCAGAACTTAGTGG + Intergenic
1182092419 22:27604876-27604898 CAAACTACCCCATAACTTAGTGG - Intergenic
1182205318 22:28618315-28618337 AAAATCACTCCAAAACTTAGTGG - Intronic
1182733963 22:32517765-32517787 CAAACAACCCCAAAACTTAGTGG - Intronic
1182918921 22:34061522-34061544 CAATCCACTCCAAAACTTTGTGG - Intergenic
1183029292 22:35091260-35091282 CAAACTACCCCAAAACTTAGTGG + Intergenic
1183098592 22:35569621-35569643 CAAATTGCCCCAAAACTTAGTGG + Intergenic
1183101537 22:35587164-35587186 CAAGGTACTCCAAAACGTAGTGG - Intergenic
1183291819 22:37007191-37007213 CAAATCACCCCAAAACTTAGTGG - Intronic
1183496797 22:38150534-38150556 CAAACTACTCCAGAACACAGTGG - Intronic
1183682576 22:39341802-39341824 CAAATTACTTTAACACTTAGTGG + Intergenic
1184123608 22:42471121-42471143 CAAAGTATCCCAAAACTTAGTGG + Intergenic
1184862792 22:47184362-47184384 CAAACTATTCCAAGAAATAGAGG + Intergenic
1185206702 22:49543253-49543275 CAAACCATCCCAAAACTTAGTGG + Intronic
949280451 3:2340832-2340854 CAAACCACCCCAAAACTCAGTGG + Intronic
949308956 3:2674121-2674143 CAAACTACTCCAAAACTGAGCGG - Intronic
950103275 3:10371490-10371512 CAAACTACTCCAAAACTTAGTGG - Intronic
950153092 3:10703489-10703511 CACACTCCTCCAACAATTTGAGG - Intronic
950166495 3:10804392-10804414 CAAATTATCCCAAAACTTAGTGG - Intergenic
950392152 3:12705129-12705151 CAAACTATCCCAAAACTGAGTGG - Intergenic
950833636 3:15899243-15899265 CCAACTACACCAAAATTTAGTGG + Intergenic
950872440 3:16241507-16241529 CAAACTACCCCAAAACTTAGTGG + Intergenic
950932682 3:16806269-16806291 GAAGCCACTCCAAAACTTAGTGG - Intronic
951084281 3:18492647-18492669 CAAACCACCCTAAAACTTAGAGG + Intergenic
951327618 3:21324174-21324196 CAAATCACCCCAAAACTTAGTGG + Intergenic
951423442 3:22514866-22514888 CAAACTATTCCAAAAAATAGAGG + Intergenic
951464330 3:22985931-22985953 CAAACCACCTCAACACTCAGTGG - Intergenic
951593699 3:24294372-24294394 CAAATCACTCTAAAACTTAGTGG - Intronic
951605022 3:24423265-24423287 CAAACCATCCCAAAACTTAGTGG - Intronic
951940832 3:28077073-28077095 CAAACTACTTCAATATTTAGTGG - Intergenic
952212593 3:31243404-31243426 CAAACTACTGGAAAACTTAGTGG - Intergenic
952235133 3:31471437-31471459 CAAATTGCTCCAAAATTTAGTGG - Intergenic
952496733 3:33922611-33922633 CAAGCCACTTCAACACTTGGTGG + Intergenic
952620039 3:35327413-35327435 CAAATTACTCCAAAACATAGTGG + Intergenic
952813267 3:37424064-37424086 CAAACTGCCCCAGAACTTAGTGG - Intronic
952818135 3:37463271-37463293 CAAACCACCCCAAAACTTAGTGG + Intronic
952930356 3:38355418-38355440 CAAACCACTTCAAAACTTAGTGG - Intronic
953199003 3:40760612-40760634 CAAACGATTCCAACAAATAGAGG + Intergenic
953213905 3:40899953-40899975 CAAATGACTCCAAAACTTATGGG + Intergenic
953499421 3:43418652-43418674 CAAATTATCCCAAAACTTAGTGG + Intronic
953524503 3:43677519-43677541 CAAACTACTTCAAAATATAGTGG + Intronic
953640616 3:44703733-44703755 CGAACCACTCCTAAACTTAGTGG - Intergenic
953687519 3:45089691-45089713 CAAACTACCCCAAAATTTGGTGG - Intronic
953766760 3:45748882-45748904 CAAATTACTCCAAAACTTACTGG + Intergenic
953810782 3:46110970-46110992 CAAACCAGTACAAAACTTAGTGG - Intergenic
954762033 3:52881976-52881998 CAAATTACTACAAAACTTAATGG + Intronic
955509918 3:59669340-59669362 CAAACTGCCCCAAAACTCAGTGG + Intergenic
956015074 3:64873916-64873938 TAAATTATTCCAACACCTAGTGG + Intergenic
956077422 3:65520222-65520244 CAAATCACTCCAAAACTTAGTGG - Intronic
956237273 3:67087660-67087682 CAAACTATTCCAAAAAATAGAGG + Intergenic
956764372 3:72472103-72472125 CAAATTACTCCAAAACTTAGTGG + Intergenic
956816467 3:72912865-72912887 AAAATTACCCCAAAACTTAGTGG - Intronic
956852402 3:73241662-73241684 CAAACTATTCCAAAAAATAGAGG - Intergenic
956927903 3:74009254-74009276 CAAACCACTCCAAAACTCAGTGG + Intergenic
956953491 3:74310328-74310350 CAAATTACCCCAAACCTTAGTGG + Intronic
957217852 3:77344972-77344994 CAAATTACCCCAAAGCTTAGAGG + Intronic
957272550 3:78050693-78050715 CTAACCACTCCAAAACTTAATGG - Intergenic
957401755 3:79724796-79724818 CAAATTACCCCAAAACTTTGTGG - Intronic
957916123 3:86690340-86690362 CAAACTATTCCAAAAAATAGAGG + Intergenic
958602677 3:96317837-96317859 CAAACTATTCTAAAACATAGAGG - Intergenic
958976688 3:100675649-100675671 CAAACTACTCCAAAAAATAGAGG - Intronic
959056023 3:101568498-101568520 TAAGGTACTCCAACATTTAGAGG + Intergenic
959150523 3:102601787-102601809 CAAACCTCTCCAACTGTTAGTGG - Intergenic
959512063 3:107225252-107225274 CAAACTACCTCAATACTAAGTGG + Intergenic
959523613 3:107349685-107349707 CAAAGTACTCCCACCCATAGAGG + Intergenic
959570533 3:107878323-107878345 CAAACCACTCCCAAACTTGGTGG - Intergenic
959797817 3:110453270-110453292 CAAACTACTCCAGAAAATAGAGG - Intergenic
959868237 3:111296209-111296231 CAAACTATTCCAAAAAATAGAGG - Intronic
959994510 3:112665560-112665582 GAAACTACTCCAAAAATTTGAGG - Intergenic
960006917 3:112790313-112790335 CAAATTACCCTAAAACTTAGTGG - Intronic
961098957 3:124182194-124182216 CAAATTGCTCCAAAACTTAACGG + Intronic
961217621 3:125172641-125172663 CAAATTACCCCAACATTTAGTGG - Intronic
961240280 3:125404843-125404865 CAAATTACCCCAAAACTTAGTGG + Intergenic
961421403 3:126807793-126807815 CAAATTACTCCAAAACTTAGTGG + Intronic
961564179 3:127751664-127751686 CAAACCACCCCAAAACTTACCGG - Intronic
961735081 3:128996334-128996356 CAAATCACCCCAAAACTTAGTGG - Intronic
961928107 3:130504539-130504561 CAAACCACCCCAAAAGTTAGAGG - Intergenic
962065051 3:131970901-131970923 CAAACTGCCCCAAAACGTAGTGG + Intronic
962078426 3:132110650-132110672 CAAACTATTCCAAAAAATAGAGG - Intronic
962186659 3:133267542-133267564 CAAATTACCCCAAAACTTAGTGG + Intronic
962196833 3:133371211-133371233 CAAACCACTGCAAAACATAGTGG + Intronic
962255897 3:133869968-133869990 CAAACCACCCCAAAACTTAGTGG - Intronic
962320568 3:134387234-134387256 CAAACTATCCCAAAACTTAGTGG + Intergenic
962321495 3:134394343-134394365 CAAATTACCCCAAACCTTAGTGG + Intergenic
962473422 3:135733972-135733994 CAAACTAAACCAAAAGTTAGTGG - Intergenic
962483657 3:135820439-135820461 CAAACTATTCCAAAATATAGAGG + Intergenic
962550769 3:136488441-136488463 CAAATTACTCCCAAACTTGGTGG - Intronic
962786977 3:138777641-138777663 CAAACCATCCCAAAACTTAGTGG - Intronic
962904670 3:139790837-139790859 CAGATTACTCCAAAACTCAGTGG + Intergenic
963024529 3:140905757-140905779 CAGAGTACACCAACATTTAGAGG + Intergenic
963218773 3:142782453-142782475 CAAACTACTCTGAAACTTAGTGG + Intronic
963267596 3:143254527-143254549 CAAACTACCCCCAAATTTAGTGG + Intergenic
963560869 3:146863096-146863118 CAAATTACACCAAAACTTAGTGG - Intergenic
963630861 3:147728449-147728471 CAAACAACTCCATCAATAAGTGG + Intergenic
963982009 3:151548501-151548523 CAAATTCTCCCAACACTTAGTGG - Intergenic
963982472 3:151554919-151554941 CAAATCACCCCAAAACTTAGTGG - Intergenic
964028479 3:152107268-152107290 CGAACTACACCACAACTTAGTGG + Intergenic
964380820 3:156097540-156097562 CAAATCACTTCAAGACTTAGTGG + Intronic
964534411 3:157703724-157703746 CAAATTACTCCAAAACTAAGTGG - Intergenic
964690583 3:159445188-159445210 CAAACAACCCCAACAATAAGTGG + Intronic
964804391 3:160591552-160591574 CAAACTATTCCAAAAAATAGAGG + Intergenic
965075685 3:163972339-163972361 CAAATTACTCCAAAACTTAGTGG - Intergenic
965449909 3:168825057-168825079 CAAACTACCCCAATACTTTGTGG + Intergenic
965548595 3:169940191-169940213 TAAATTACTTCAAAACTTAGTGG - Intergenic
965696120 3:171410212-171410234 CAAACCACCCTAAAACTTAGTGG + Intronic
965715249 3:171595844-171595866 CAAACCACTCTAAAACTTAGTGG + Intergenic
965766269 3:172133782-172133804 CAAATTACTCCAAAATTTGGTGG + Intronic
965784537 3:172322056-172322078 CAAATTACCCCAAAACTTAGAGG + Intronic
965846666 3:172970054-172970076 CAAACCACTCTAAAACTCAGCGG - Intronic
966289563 3:178339965-178339987 CACATTACTCCAAAACTTAGTGG - Intergenic
966359353 3:179118466-179118488 CAAACTATTCCAAAAAATAGAGG + Intergenic
966817572 3:183901602-183901624 CAAATTACCCCAAAACTTAGTGG - Intergenic
966988913 3:185208452-185208474 CAAATGACCCCAAAACTTAGTGG - Intronic
967252983 3:187562231-187562253 CAAATTACTCCAACACTTGGTGG + Intergenic
967464199 3:189783808-189783830 CTAACTACTACAGCACTGAGAGG - Intronic
967551719 3:190802959-190802981 CAAACTATTTCAACAAATAGAGG + Intergenic
967571953 3:191039823-191039845 CACACTACTCCAAAAAATAGAGG - Intergenic
967726596 3:192868088-192868110 AAAACTACCCCCAAACTTAGTGG - Intronic
967732852 3:192921982-192922004 CAAACTGCTGTCACACTTAGAGG + Intergenic
967861466 3:194155123-194155145 CAAAGCATTCCAAAACTTAGTGG - Intergenic
967996261 3:195168976-195168998 CAAATCACTCCAAAACCTAGTGG + Intronic
968079955 3:195839149-195839171 CAAATGACTCCAAAACTGAGTGG + Intergenic
968109300 3:196030250-196030272 CAAACTATTCCAAAAAATAGAGG + Intronic
968438768 4:610810-610832 CAAACTGCTCCCAAATTTAGTGG - Intergenic
969386426 4:6852643-6852665 CTAAGTACCCCAAAACTTAGTGG + Intronic
969956906 4:10900022-10900044 CAAAATGCTCCAAAACTTAGTGG + Intergenic
970004914 4:11401000-11401022 CAAACCACTCCAAAACTCAGGGG - Intronic
970170461 4:13284210-13284232 CAAACCACTGCAAAACTGAGTGG + Intergenic
970178294 4:13361686-13361708 CAAATTACTCAAAGACTTAGGGG + Intronic
970342198 4:15118967-15118989 CAAACCGCTCCAAACCTTAGTGG + Intergenic
970378945 4:15486199-15486221 CAAACTATTCCAAAAATCAGAGG - Intronic
970471804 4:16386479-16386501 CAAATGACTTCAAAACTTAGAGG - Intergenic
970491272 4:16576679-16576701 GAAACTATTCCAACAAATAGAGG + Intronic
970569646 4:17367259-17367281 CAAATTACCACAAAACTTAGAGG + Intergenic
970650502 4:18172139-18172161 CAAGCTACTCCAAAATGTAGTGG - Intergenic
971098780 4:23438919-23438941 CAAACCACCTCAACATTTAGTGG + Intergenic
971104028 4:23501568-23501590 CAAACTATTTCAAATCTTAGTGG + Intergenic
971105489 4:23519692-23519714 AACACTACTCCAAAACTTAGTGG + Intergenic
971299822 4:25432860-25432882 CAAACAGCTCCAAGCCTTAGTGG + Intergenic
971355724 4:25893733-25893755 CAAACTGCTCCAAAATTCAGTGG - Intronic
971370890 4:26017963-26017985 CAAACCACCCCAAAACTTAGTGG + Intergenic
971463680 4:26930851-26930873 CAAATGACCCCAAAACTTAGTGG + Intronic
971567517 4:28164315-28164337 CAAACTACTTCAAAAAATAGAGG - Intergenic
971797994 4:31253680-31253702 CAAACTACCCCAAAATTCAGTGG + Intergenic
971925244 4:33001387-33001409 CAAGTTACTCCAAAACTTGGTGG + Intergenic
972116324 4:35638868-35638890 CAAGCCACTCCAAAACTCAGTGG - Intergenic
972246833 4:37253762-37253784 CAATCTACTTCAAAACTTAGTGG - Intronic
972270464 4:37505826-37505848 CAAACTATTCCAAAAAATAGTGG - Intronic
972293055 4:37709251-37709273 TTAACTACTCCACAACTTAGTGG + Intergenic
972704915 4:41532835-41532857 CAAATTACCCCAGAACTTAGTGG + Intronic
972728167 4:41764777-41764799 TAAACCACCCCAAAACTTAGTGG - Intergenic
972996800 4:44889772-44889794 CAAACTATTCCAAAAAATAGAGG - Intergenic
973214699 4:47655936-47655958 CAAACTACTCCAAACAATAGAGG + Intronic
973310749 4:48707069-48707091 CAAACTACCCTGAAACTTAGTGG - Intronic
973559170 4:52117198-52117220 CAATCAAGTCCAAAACTTAGGGG + Intergenic
973630292 4:52813871-52813893 CAAACCACCCCAAAACTTAGTGG - Intergenic
973671633 4:53224721-53224743 CAAATTACCCCAAAACTTAGTGG - Intronic
973868505 4:55139759-55139781 CAAATGACTCCAAAACCTAGTGG + Intergenic
974290970 4:59930098-59930120 CAAACTATTCCAAAAACTAGAGG + Intergenic
974454000 4:62102610-62102632 CAAACTATCCCTAAACTTAGTGG + Intergenic
975037788 4:69705709-69705731 CAAACTACCCCAAAATATAGTGG - Intergenic
975317587 4:72972579-72972601 AAAATTACCCCAAAACTTAGTGG + Intergenic
975415995 4:74105132-74105154 CAAATTAATCCAAAACTAAGGGG - Intergenic
975506174 4:75140742-75140764 CAAACTATTCCAATACGTAGTGG - Intergenic
975566003 4:75754841-75754863 CAAATTACTTCAAAACTTAGTGG + Intronic
975585459 4:75943479-75943501 CAAATTACCTCAAAACTTAGTGG - Intronic
975742911 4:77447780-77447802 AAAAACACTCCAAAACTTAGTGG + Intergenic
975874328 4:78818079-78818101 CAAACTAAGCCAAAACATAGAGG + Intronic
975918132 4:79348827-79348849 CAAACTATTCCAAAAAATAGAGG - Intergenic
976202938 4:82597758-82597780 CAAACTACTCCAAAACTTAATGG - Intergenic
976492313 4:85685784-85685806 CAAACTATCCCAAAACTCAGCGG + Intronic
976673832 4:87682975-87682997 CAAATTATCCCAAAACTTAGTGG + Intergenic
976725794 4:88214463-88214485 CAAACCACTCTAAAACTTAAAGG - Intronic
977082959 4:92556508-92556530 CAAATTACCCCAAAACTTAATGG + Intronic
977139818 4:93355185-93355207 CAAACCACCCCAACACTTGGTGG + Intronic
977453803 4:97232067-97232089 CAAACTACCTCAAATCTTAGTGG + Intronic
977514141 4:97998654-97998676 CAAACCACTCCAAAACTCATAGG - Intronic
977659830 4:99570997-99571019 CAAATTACCACAAAACTTAGTGG - Intronic
977664923 4:99635253-99635275 CAATCTACCTCAAAACTTAGTGG - Intergenic
977725843 4:100296138-100296160 CAAGCTACTTCAAAACTTAGTGG + Intergenic
977872587 4:102110335-102110357 CAAACTATTCCAAAAAATAGAGG + Intergenic
977873280 4:102119354-102119376 CAAACTATTCCAAAAAATAGAGG - Intergenic
977982614 4:103343031-103343053 AAAATTATTCCAACACTTAGTGG + Intergenic
978039817 4:104046081-104046103 CAGACCACTTCAACACTGAGTGG - Intergenic
978079817 4:104578545-104578567 CAAACTGCTCCAAAACTGAGTGG + Intergenic
978344275 4:107750052-107750074 TAAACTACTTCAAAACTTAGTGG - Intergenic
978641652 4:110878019-110878041 TTAACTACTCCAAAACTTTGTGG + Intergenic
978716511 4:111849937-111849959 GAAATTACTCCCAAACTTAGGGG + Intergenic
978725068 4:111959896-111959918 CAAATCACTCTAAAACTTAGTGG - Intergenic
978891404 4:113832360-113832382 CAAACCACTCCAAGACTTAGTGG + Intergenic
979158964 4:117434514-117434536 CAAATTACTCCCAAACTTACTGG + Intergenic
979241524 4:118451303-118451325 CAAATCACTTCAAAACTTAGCGG + Intergenic
979413754 4:120410797-120410819 CAAACTATTCCAAAAAATAGAGG + Intergenic
979508726 4:121527400-121527422 CAAACTACCCCAAAATTTTGTGG - Intergenic
980119313 4:128711478-128711500 CAAATTTCCCCAAAACTTAGTGG + Intergenic
980126863 4:128782819-128782841 CAAATTACTCCAAACTTTAGAGG + Intergenic
980844127 4:138303346-138303368 CAAACTACCCCAGAACTTAGTGG + Intergenic
980850582 4:138376068-138376090 CAAACTACTCCAAAAAATAGAGG + Intergenic
980956226 4:139431843-139431865 CAAACTATTCCAAAAAATAGAGG - Intergenic
981097452 4:140796470-140796492 CAAACTTTTCCAACACCTAGTGG - Intergenic
981172914 4:141645628-141645650 TAGACTACCCCAACACTTAGTGG + Intronic
981260738 4:142715724-142715746 CAAATTATCCCAACATTTAGTGG + Intronic
981447807 4:144860658-144860680 CAAACCACTTCAAAATTTAGTGG + Intergenic
981827671 4:148962199-148962221 CAAACCACTTCAAAACTTAGTGG - Intergenic
981838386 4:149081868-149081890 CAAATTACTACAAAACTTAGTGG + Intergenic
981849781 4:149216685-149216707 CAAACTACTCCAAAACTTAATGG - Intergenic
982421322 4:155201560-155201582 CAAACTACCCCAAAACTCAGTGG - Intergenic
982739809 4:159045682-159045704 CAAATTACTCTAAAATTTAGTGG + Intergenic
982854955 4:160370092-160370114 CAAACTGCCTCAACAGTTAGTGG + Intergenic
983186362 4:164705660-164705682 CAACCTACCCCGAAACTTAGGGG + Intergenic
983342863 4:166487669-166487691 GAAACAACTCCAACATTTACTGG - Intergenic
983376963 4:166942000-166942022 CAAATTACTGGAAAACTTAGTGG - Intronic
983389233 4:167107101-167107123 CAAACTATTCCAATAAATAGAGG + Intronic
983503644 4:168528755-168528777 CAAACCACTCCAAAACTTAATGG + Intronic
984041400 4:174739083-174739105 CAAACTATCCCAAAACTTTGTGG - Intronic
984632884 4:182078938-182078960 CAAAATACTCCCAGGCTTAGTGG - Intergenic
984744411 4:183200459-183200481 CAAATTGTTCCAAAACTTAGTGG + Intronic
984786827 4:183574821-183574843 CAAACTACTCCGAAACTTAGTGG - Intergenic
985097206 4:186424630-186424652 CAAACTACCCTAAAACTTAGTGG - Intergenic
985386771 4:189455322-189455344 AAAACCACCCCAAAACTTAGTGG - Intergenic
985908229 5:2858312-2858334 TAAACCACCCCAAAACTTAGTGG - Intergenic
985970746 5:3376672-3376694 CAGACTACCCCAACATTTAGTGG + Intergenic
986212100 5:5683587-5683609 TAAGCTACTCCAAAACATAGTGG - Intergenic
986288936 5:6383337-6383359 CAAACCATGCCAAAACTTAGTGG + Intergenic
986823779 5:11498141-11498163 CAAACCACCCCAAAACTCAGGGG - Intronic
986851894 5:11822964-11822986 AAAAATGCTCTAACACTTAGTGG - Intronic
987949342 5:24655557-24655579 CAAACAACTCCATCAAATAGTGG - Intergenic
987995858 5:25278838-25278860 CAAACCACTTCAACATTTAGTGG + Intergenic
988013526 5:25522614-25522636 CTAATTACTCCAAAACTTAGTGG + Intergenic
988682854 5:33501160-33501182 CAAACTACCCCAAAACTTGGTGG + Intergenic
988714721 5:33813914-33813936 CAAACCACCTCAAAACTTAGTGG - Intronic
988969660 5:36454386-36454408 CAAATTATCCCAAAACTTAGTGG - Intergenic
989094274 5:37766858-37766880 CAAATTACTCCAGAACGTAGTGG - Intergenic
989354151 5:40522629-40522651 CAAACTATTCCAAAAAATAGAGG + Intergenic
989518033 5:42366024-42366046 CAAACTATTCTAAAACCTAGTGG + Intergenic
989630927 5:43482164-43482186 TAAATTACACCAAAACTTAGAGG - Intronic
989661829 5:43808099-43808121 CAAATTACTCCAAAATTTAGTGG - Intergenic
989965698 5:50464055-50464077 TAAACTACCCCAAAACTTAGTGG - Intergenic
990131702 5:52594572-52594594 CGAATTACTCCAAAACATAGTGG - Intergenic
990371438 5:55122976-55122998 CAAATTACTCAAAAACTTAGTGG - Intronic
990388667 5:55295195-55295217 CAAACCACTCCAAAATGTAGTGG - Intronic
990430495 5:55730236-55730258 CAAACTACTCCAAAACTTGGTGG - Intronic
990577975 5:57141887-57141909 CAAACTATTCCAAAAAATAGAGG - Intergenic
991040731 5:62172857-62172879 CAAACTACTCCAAAACTCAGTGG + Intergenic
991170798 5:63623033-63623055 CAAACTACTCTAAAACTTAATGG - Intergenic
991537299 5:67684301-67684323 CAAACTATTCCAAAAAATAGAGG - Intergenic
991663987 5:68978694-68978716 CAAACTATTCCAAAAAATAGAGG + Intergenic
991926346 5:71708880-71708902 CAAATTTCTCAAAAACTTAGTGG - Intergenic
992050535 5:72936515-72936537 CAAACCACTCCAAAACCTAGTGG + Intergenic
992453940 5:76898834-76898856 CAAACTATTCCAAAAAATAGAGG - Intronic
992512676 5:77454439-77454461 CAAATTACCTCAAAACTTAGTGG - Intronic
992532013 5:77661042-77661064 CAAACTAGTCCAAAACTCAGAGG + Intergenic
992558153 5:77923661-77923683 CAAACCACTCCAAAATTTAGTGG + Intergenic
993354693 5:86891596-86891618 CAAATCACTCCAAAATTTAGAGG - Intergenic
993361431 5:86981462-86981484 CAAACTACACCAAAACTTTGTGG - Intergenic
993370240 5:87084175-87084197 CAAACTAGAACAAAACTTAGTGG - Intergenic
993734116 5:91455600-91455622 CAAATTACCCCAAAATTTAGTGG - Intergenic
993784457 5:92111562-92111584 CAAATTACCCTAACATTTAGTGG + Intergenic
993925660 5:93862834-93862856 CATAATACTCAAACACTTAAAGG - Intronic
994226543 5:97258189-97258211 CAAACTACTCCAGAAAATAGAGG + Intergenic
994424556 5:99568401-99568423 CAAACCACTCCAAAATTAAGTGG - Intergenic
994574329 5:101556866-101556888 CAAACAACTCCATCACAAAGTGG + Intergenic
994643555 5:102440742-102440764 TAAACTACCCCATAACTTAGTGG - Intronic
994656484 5:102600165-102600187 GAAACTACCCCAAAATTTAGTGG - Intergenic
994660298 5:102645692-102645714 CAAACTACTCCAAAAAATAGAGG + Intergenic
994781672 5:104096897-104096919 CACATTACTTCAAAACTTAGTGG + Intergenic
994841081 5:104925873-104925895 CAAACTATTCCAGAACTTAGTGG - Intergenic
995551900 5:113289817-113289839 CAAACTGCTCCAAAATTTAGAGG - Intronic
995555428 5:113323303-113323325 CAAATTACCCCAAACCTTAGTGG - Intronic
995777657 5:115742087-115742109 CAAACTATTCCAAGAAATAGAGG - Intergenic
995957477 5:117795374-117795396 CAAATTACCCCAAAACTTTGTGG - Intergenic
996104666 5:119485841-119485863 TAAACTACTCTAAAACTTAGTGG + Intronic
996193279 5:120571714-120571736 AAGATTACTCCAAAACTTAGTGG + Intronic
996369167 5:122735062-122735084 TAAATTACTCCAAAACTGAGTGG + Intergenic
996481391 5:123979391-123979413 CAAATTACCCTAAAACTTAGTGG - Intergenic
996525256 5:124472659-124472681 CAGACTACTCCAAAATTTAATGG + Intergenic
996529190 5:124509909-124509931 CAAACCACCCCAATACTCAGTGG + Intergenic
997003416 5:129789251-129789273 CAAACTATTCCAAAAAATAGAGG + Intergenic
997043278 5:130282362-130282384 CAAACCAGCCCAAAACTTAGTGG - Intergenic
997883028 5:137607308-137607330 CAAAGTGCTCCAAAACTTACTGG - Intergenic
998290878 5:140913127-140913149 CAAACTATTCCAAAAAGTAGAGG - Intronic
998344658 5:141451190-141451212 CAAATTATCCCAAAACTTAGTGG + Intronic
998424710 5:142016594-142016616 CAGATTACCCCAAAACTTAGTGG + Intergenic
998674062 5:144387596-144387618 TGCACAACTCCAACACTTAGAGG - Intronic
998695649 5:144635651-144635673 CAAACTAGTCCAAAAAATAGAGG + Intergenic
998834977 5:146194781-146194803 CAAATTACCCCAAAACTTAGTGG + Intergenic
998994754 5:147859038-147859060 CAAAATACTCCAAAATTCAGTGG - Intergenic
999502517 5:152161017-152161039 CAAATTAGCCCAAAACTTAGAGG + Intergenic
999924077 5:156356143-156356165 CAAACTACCCCAAAACTTAGTGG + Intronic
1000143565 5:158430476-158430498 CAAACTACCCCAAAACTGACTGG - Intergenic
1000573863 5:162951345-162951367 CACACTACTCCTATGCTTAGTGG - Intergenic
1000653669 5:163849663-163849685 CGAACTATCCCAAAACTTAGTGG + Intergenic
1000734275 5:164879596-164879618 CAAATTACCCCAAGATTTAGTGG - Intergenic
1000890929 5:166801140-166801162 CAAACCACTCCAAAACTCAGTGG + Intergenic
1001432771 5:171676232-171676254 CAAATTACCCCAAAACTGAGTGG + Intergenic
1001680037 5:173549828-173549850 CAAACTACGCCAACACTTAGCGG - Intergenic
1001693972 5:173655898-173655920 CAAACCACCCCAAAACATAGTGG + Intergenic
1001708526 5:173759715-173759737 CAAATTACCCCAAAACTTAGTGG + Intergenic
1001776653 5:174334016-174334038 TAAACCACCCCAACACTTAGTGG + Intergenic
1002121672 5:177009320-177009342 CAAATTACCCCAAAACTTAGCGG - Intronic
1002846052 6:945458-945480 CAAACAACTTCAAGACTTAAGGG + Intergenic
1003249044 6:4408835-4408857 CAAACTAATCCAAAAGCTAGCGG + Intergenic
1003371360 6:5530072-5530094 CCAACCACCCCAAAACTTAGTGG - Intronic
1004483660 6:16045232-16045254 CCAACTACCCCAAAACTCAGTGG + Intergenic
1004688845 6:17974603-17974625 TTAACTACTCTAAAACTTAGTGG - Intronic
1004842523 6:19603699-19603721 CAAACTACTCCAAAAGCTATTGG + Intergenic
1004877264 6:19968273-19968295 CAAATAACTCCAAAATTTAGTGG + Intergenic
1004918381 6:20353584-20353606 CAAACCACCCCAACACTAAGTGG - Intergenic
1005867975 6:29950560-29950582 CAAACTACCTCAAAATTTAGTGG - Intergenic
1006666120 6:35694808-35694830 CAAACTATTCCAAAATTTAGTGG + Intronic
1006870612 6:37247769-37247791 CAAGCTCCTTCAACACTTACAGG - Intronic
1006926661 6:37659273-37659295 ACAAATACTCCAAAACTTAGGGG - Intronic
1007132288 6:39486541-39486563 CAAACTATTCCAAAACTTGGTGG - Intronic
1007311480 6:40949902-40949924 CAAAACAATCCAAAACTTAGCGG + Intergenic
1007657503 6:43460310-43460332 CAAACCATTCCAAAATTTAGTGG - Intergenic
1007811784 6:44491424-44491446 CAAACTACCCCAAAACTTAGTGG - Intergenic
1007831115 6:44639223-44639245 CAAATTACCCCAAGACTCAGTGG + Intergenic
1007961583 6:45964810-45964832 CAAACCAGCCCAAAACTTAGTGG - Intronic
1008400844 6:51060620-51060642 CTAACTACCCCAAAACCTAGTGG - Intergenic
1008617478 6:53240532-53240554 CAAATTACTTCAAAATTTAGTGG + Intergenic
1008756915 6:54807325-54807347 CAAACCACCCCAAAACTCAGTGG + Intergenic
1008883982 6:56411653-56411675 CCAACTCCTTCAACACTTACTGG + Intergenic
1009380621 6:63024307-63024329 AAAATTACTCCAAAATTTAGTGG - Intergenic
1009566451 6:65317527-65317549 CAAATTACTCCAACACTTAGTGG + Intronic
1009781597 6:68278712-68278734 CAAATTACTACAAAACGTAGGGG - Intergenic
1009910662 6:69923054-69923076 GAAACCACTACAAAACTTAGTGG + Intronic
1010047590 6:71464516-71464538 CAAACTACCCCAAAACTTAATGG - Intergenic
1010182284 6:73101086-73101108 CAAACTATTCCAAAAAGTAGAGG + Intronic
1010299188 6:74239780-74239802 CAAACTATTCCAAAAAGTAGAGG - Intergenic
1010474711 6:76273136-76273158 CAAACTACTCCAAAAACTAGAGG - Intergenic
1010839169 6:80627240-80627262 CAAACTATTCCAAAAAATAGAGG + Intergenic
1011019232 6:82792344-82792366 CAAACTATTCTAAAACATAGAGG + Intergenic
1011385631 6:86795336-86795358 CAAACTATTCCAAAAAATAGAGG - Intergenic
1011548534 6:88506989-88507011 CAAATTACTCCAAAACATACAGG + Intergenic
1011549477 6:88516500-88516522 TAAACCACTCCAAAACTTAATGG + Intergenic
1011899101 6:92270238-92270260 CAAACTACCTCAAAACTAAGTGG + Intergenic
1011993496 6:93554105-93554127 AAAACCACCCCAAAACTTAGTGG - Intergenic
1012003254 6:93680919-93680941 CACACTACTTTAATACTTAGTGG + Intergenic
1012206480 6:96466908-96466930 CAAATTACTCCAAAACTTTGTGG - Intergenic
1012732841 6:102903657-102903679 CAAACTACCCCAAATCTTAGTGG - Intergenic
1012800726 6:103824024-103824046 CCAACTATTCCAAAAATTAGAGG + Intergenic
1013135357 6:107277026-107277048 CAAACTACTCCAAACCTTGGTGG - Intronic
1013594912 6:111651751-111651773 CAAACCACTCCAAAACTTAGTGG - Intergenic
1013894770 6:115073522-115073544 TAAACTAACCAAACACTTAGTGG + Intergenic
1013910929 6:115275008-115275030 CAAATTACTCCTAAACTTAGTGG - Intergenic
1013944958 6:115711655-115711677 CAAACCATTCCAAAATTTAGTGG + Intergenic
1014102950 6:117531851-117531873 CAAGCCACTCCAAAACTTAGTGG + Intronic
1014562589 6:122909002-122909024 TAAACTACCCCAAAACTCAGTGG - Intergenic
1014853714 6:126373465-126373487 CAAACTACTCTAAAACTTAATGG + Intergenic
1015120611 6:129697324-129697346 CATACCATTCCAAAACTTAGGGG - Intronic
1015257330 6:131193597-131193619 GAAACTACTCCAAAAAATAGAGG - Intronic
1015286770 6:131494474-131494496 AAAACTACTCCAAAACTTAGTGG + Intergenic
1015578336 6:134696983-134697005 CAAACTAATCCAAAAAATAGAGG - Intergenic
1016240505 6:141923694-141923716 CAAACCACCCCAAAACGTAGTGG - Intergenic
1017166587 6:151413558-151413580 CAAATTACCCCAAAACTTGGTGG - Intronic
1017274421 6:152549381-152549403 CAAACTACTCCAAAACTCTGTGG - Intronic
1017342023 6:153335248-153335270 CACCCTACTTCAACACTTAACGG - Intergenic
1017356535 6:153516263-153516285 CAAACTATTCCAAGAAATAGAGG - Intergenic
1017806344 6:157949017-157949039 CAAACTACTCCAAAAAATAGAGG + Intergenic
1018772582 6:166984936-166984958 CAAATTACTCCAAAACTTAGTGG + Intergenic
1018882889 6:167903174-167903196 CAAACCACTCCAAAACTTTGTGG + Intronic
1019089253 6:169513040-169513062 TAAACTACTCTCAAACTTAGTGG + Intronic
1019807001 7:3135068-3135090 CAAATCACTCCAACACACAGTGG - Intergenic
1019812110 7:3172450-3172472 CAAACGACCCCAAAACTCAGTGG + Intronic
1019929770 7:4215684-4215706 CAAACCACTCCAAAACCGAGTGG - Intronic
1020347211 7:7178836-7178858 CAAACTATCCCAAAACTTAGTGG + Intronic
1020586498 7:10077022-10077044 CAAACCACTCCAAGACTTTGTGG + Intergenic
1020705124 7:11534603-11534625 CAAACCACCTCAAAACTTAGTGG - Intronic
1020877605 7:13717570-13717592 CAAACCACTCCAAAAGTTACTGG - Intergenic
1021022816 7:15624770-15624792 CAAACCACTCCAAATCTTAATGG - Intronic
1021189052 7:17599341-17599363 CAAATTACCCTAAAACTTAGTGG - Intergenic
1021399430 7:20192674-20192696 CAAACTACTCCAAAACTTAGTGG - Intronic
1021624385 7:22578445-22578467 CAAACTACCCTAAAATTTAGTGG + Intronic
1021645751 7:22787948-22787970 CAAATTACCCCAAAACTCAGTGG + Intergenic
1021715931 7:23462196-23462218 CAAACCACCCCAAAACTTAGTGG - Intronic
1021831403 7:24615660-24615682 CAAACTATTCCAAAAATTGGAGG + Intronic
1021845749 7:24761059-24761081 CAAACTACCCCAAAACTTAGTGG + Intergenic
1021917308 7:25446724-25446746 CAAATTACTCCTACATTCAGTGG - Intergenic
1022020460 7:26395585-26395607 CAAACTATCCCAAAGCTTAGTGG - Intergenic
1022291927 7:29013363-29013385 TAAATCACTCCAAAACTTAGTGG - Intronic
1022393700 7:29965962-29965984 CAAATTACCCCAAAATTTAGTGG + Intronic
1022476598 7:30714998-30715020 CAAACTACCCCAAGATGTAGTGG + Intronic
1022553135 7:31261418-31261440 CCAACCACTCCAAAACTCAGGGG + Intergenic
1023114344 7:36846925-36846947 CAAACTACTCCATCAAAAAGTGG + Intergenic
1023195286 7:37630989-37631011 CAAACTATTCCAAAAAGTAGAGG - Intergenic
1023280106 7:38560472-38560494 CAAACCATCCCAAAACTTAGTGG - Intronic
1023720503 7:43088669-43088691 CAAATTACCCCAAAACTTAGTGG - Intergenic
1023853150 7:44161856-44161878 CAAACTGCCTCAAAACTTAGTGG - Intronic
1024029631 7:45447911-45447933 CAAACTAAACCCACAGTTAGGGG + Intergenic
1024132853 7:46373908-46373930 CAAACTTTTCCAAAAATTAGAGG - Intergenic
1024660882 7:51493222-51493244 CAAACTATTCCAAAAAATAGAGG - Intergenic
1024725844 7:52193102-52193124 CAAACTACCCAAAATCTTAGTGG - Intergenic
1026092747 7:67315050-67315072 CAAACCATTCCAAGTCTTAGTGG - Intergenic
1026123007 7:67553863-67553885 CAAACCATCCCAAAACTTAGGGG - Intergenic
1026127092 7:67588511-67588533 CAAACTATTCCAAAACAGAGAGG - Intergenic
1026176168 7:67999290-67999312 CAACAAACTCCAAAACTTAGTGG + Intergenic
1028029735 7:85895083-85895105 CAAACACTTCCAACATTTAGAGG - Intergenic
1028059844 7:86298512-86298534 CAAACTATGCCAAAACTTAGCGG - Intergenic
1028061174 7:86318751-86318773 CAAACTACCTCAAAACTTAGAGG + Intergenic
1028103798 7:86853741-86853763 CAAACTTCTCCATAACTTAAAGG + Intronic
1028215046 7:88121411-88121433 GAAATTACTCTAAAACTTAGTGG + Intronic
1028250653 7:88536063-88536085 CAAACTACCCCAAAACTTAGTGG - Intergenic
1028338781 7:89692387-89692409 TAAACAACTCCAAAACTTCGTGG + Intergenic
1028538101 7:91911780-91911802 CAAGGCACTCCAACATTTAGAGG + Intergenic
1028620480 7:92821440-92821462 TAAATTACTCCAACATGTAGGGG - Intronic
1028906906 7:96164452-96164474 CAAACCCCTCCAAAACTTAGTGG - Intronic
1029048067 7:97652339-97652361 CCAGCTACCCCAAAACTTAGAGG - Intergenic
1029175921 7:98664401-98664423 CAAACAACCCCAATATTTAGTGG + Intergenic
1029389370 7:100264847-100264869 CAAATTACCCCAAATCTTAGTGG + Intronic
1029605429 7:101596417-101596439 CAAATTGTCCCAACACTTAGTGG - Intergenic
1029902505 7:104056489-104056511 CAAGCCACTCTAAAACTTAGTGG + Intergenic
1030137577 7:106270885-106270907 CAAACTACCCCAAAACTTAATGG - Intronic
1030351485 7:108493119-108493141 CAAGCCACTCCAAAACTTAGTGG - Intronic
1030488372 7:110200230-110200252 CAAACTATTCCAAAAAATAGAGG - Intergenic
1030883304 7:114908225-114908247 CAAATTACTCCAAAATTTAGTGG + Intergenic
1031566321 7:123301749-123301771 CAAACTACTCCAAAAAATAGAGG + Intergenic
1031672335 7:124564747-124564769 TAAACTACTCCAAACCATAGAGG + Intergenic
1032135413 7:129272409-129272431 CAAACTACCCTAAAGCTTAGTGG - Intronic
1032512458 7:132482594-132482616 TGAACTACTCCAGAACTTAGAGG - Intronic
1032914669 7:136476613-136476635 CAAAATATTTCAAAACTTAGTGG + Intergenic
1033162420 7:139009522-139009544 CAAACCACCCCAAAACTCAGTGG + Intergenic
1033272532 7:139945688-139945710 AAAATTACCCCAAAACTTAGTGG + Intronic
1033302271 7:140197003-140197025 CAAATTACTCCAAAGTTTAGTGG - Intergenic
1033314236 7:140284310-140284332 CATACCACCCCAAAACTTAGTGG - Intergenic
1033541510 7:142360195-142360217 CAACCTACCACCACACTTAGAGG - Intergenic
1034125942 7:148671741-148671763 CAAATTACCCCAAAACTTGGTGG + Intergenic
1034299062 7:149999167-149999189 TAAATTACCCCAACACTTAGTGG - Intergenic
1034378776 7:150670708-150670730 GAAACTACTCCAAAACTCAGTGG + Intergenic
1034806955 7:154097606-154097628 TAAATTACCCCAACACTTAGTGG + Intronic
1034899968 7:154902037-154902059 CAAATCACTCCAAAACTTAATGG - Intergenic
1035347293 7:158210904-158210926 CAAACTATTCCAAAAGATAGAGG + Intronic
1035753655 8:2013646-2013668 CAAACTATTCCAAAAATTAGAGG - Intergenic
1036091965 8:5676051-5676073 CAAACCCCTCCCACACTTACTGG + Intergenic
1036154893 8:6332230-6332252 CAAATTACCCCAAAATTTAGTGG - Intergenic
1036285146 8:7437838-7437860 CAAATTATCCCAAAACTTAGTGG - Intergenic
1036336330 8:7873691-7873713 CAAATTATCCCAAAACTTAGTGG + Intergenic
1036427018 8:8654265-8654287 CAAATTAATCCAACCCATAGAGG - Intergenic
1036937723 8:13020095-13020117 CAAAATAATCCAACTGTTAGTGG - Intronic
1037034982 8:14155034-14155056 CAAACTACTCCAAAACAGAGTGG - Intronic
1037602807 8:20412328-20412350 CAAACTACTCCCAAACTTAGTGG + Intergenic
1037868663 8:22469873-22469895 CAAATTACCCCAAAACTTAGTGG - Intronic
1039031964 8:33320505-33320527 TAAACTACTCCAAAACTCAGTGG + Intergenic
1039450426 8:37669766-37669788 CCAACCACCCCAAAACTTAGTGG - Intergenic
1039576667 8:38629139-38629161 CAAATTACCCCAACACTTGATGG - Intergenic
1039758187 8:40545353-40545375 CAAATCACTCAAAAACTTAGTGG - Intronic
1039847314 8:41334812-41334834 AAAACAACTCCAAAACTTAATGG + Intergenic
1039958074 8:42222297-42222319 CAAACTGCTCCAACTTTCAGAGG - Intergenic
1040633730 8:49247487-49247509 CACAAAACTCCAACATTTAGAGG + Intergenic
1041452069 8:58016269-58016291 CAAATGACGCCAAAACTTAGTGG + Intronic
1041757120 8:61326225-61326247 CAAGCTACATCAAAACTTAGTGG + Intronic
1042364835 8:67924214-67924236 CAAGCCACCCCAAAACTTAGTGG + Intergenic
1042857268 8:73280071-73280093 CAAATTTCTCCAAAACTTAGTGG - Intergenic
1043410794 8:79992266-79992288 CAAATTACTTCATAACTTAGTGG - Intronic
1043518204 8:81016226-81016248 CAAACCACTCCATGACTTAACGG - Intronic
1043567664 8:81566266-81566288 CAAACTATTCCAAAAAATAGAGG + Intergenic
1044394832 8:91698921-91698943 CAAACTATTCCAAAAACTAGAGG - Intergenic
1044535364 8:93351529-93351551 CAAACTACATCAAAAATTAGTGG + Intergenic
1044830049 8:96238402-96238424 CAAACTACCCCCAAAGTTAGCGG + Intergenic
1044878437 8:96696965-96696987 CAAACTAGTCCAAAAAATAGAGG + Intronic
1045346284 8:101296795-101296817 CAAACTACCCCCAAATTTAGAGG + Intergenic
1045346380 8:101297562-101297584 CACACTACCCCAAAACTCAGAGG + Intergenic
1045786567 8:105928045-105928067 CAAACCACCCCAAAACTCAGGGG - Intergenic
1045935630 8:107675651-107675673 CAAACTACCTCAAAATTTAGTGG - Intergenic
1046070190 8:109242371-109242393 CAAACCACACCAAAACTCAGTGG - Exonic
1046134314 8:110006426-110006448 CAAACTATTCCAAAAAATAGAGG - Intergenic
1046224814 8:111264053-111264075 CAAATTACCCCAAGACTTAGAGG + Intergenic
1046460182 8:114523744-114523766 TAAACTACCCCAAAACTTATTGG + Intergenic
1046678287 8:117137452-117137474 CAAACTACCCCAAGATGTAGTGG + Intronic
1046758575 8:117996629-117996651 CAAATTACTCCAAAATTTACTGG - Intronic
1046943794 8:119956149-119956171 CAAGCTACTCCCAAACTTGGTGG - Intronic
1046982995 8:120357082-120357104 CAAATTACTTTAAAACTTAGTGG + Intronic
1047558877 8:125965096-125965118 AAAAAGACTCCAAAACTTAGTGG + Intergenic
1047717947 8:127613062-127613084 CAAACTACCCCAAAGCTTAGTGG - Intergenic
1048110967 8:131468273-131468295 CAAATCACTCCAAAACGTAGTGG + Intergenic
1048151197 8:131896476-131896498 CTAACCACTCCCAAACTTAGTGG + Intergenic
1048321184 8:133401429-133401451 CAAACCACTCCAAAACTCAGTGG + Intergenic
1048326765 8:133445791-133445813 CAAACTACTCCAAACCTTAGTGG + Intergenic
1048473035 8:134720293-134720315 AAAACTACTCCCACACTTAGTGG - Intergenic
1048504651 8:135009917-135009939 CAAACAACTTCTAGACTTAGTGG - Intergenic
1048574808 8:135682145-135682167 AAAACCACACCAAAACTTAGTGG - Intergenic
1048851285 8:138647398-138647420 CAGATTGCTCCAAAACTTAGTGG - Intronic
1048917694 8:139200467-139200489 CAAACTGCCCCAAAAGTTAGAGG + Intergenic
1050064199 9:1741740-1741762 CAAACTACCTCAAAACTTACAGG + Intergenic
1050114768 9:2252522-2252544 CAAACCACTCCAAAATTTAATGG + Intergenic
1050227757 9:3480092-3480114 CAAACCACCCCAAAACTTACTGG + Intronic
1050807907 9:9704970-9704992 CAAACTACCCCAAAATTTAGTGG - Intronic
1051013727 9:12450139-12450161 CAAATTACTCCAAAAGTTGGCGG + Intergenic
1051025642 9:12607626-12607648 CAAACCACCCCAACACTTAATGG + Intergenic
1051674994 9:19549848-19549870 CAAACTACCCCAAAACTTAGTGG - Intronic
1051681814 9:19614999-19615021 CAAAGCACCCCAAGACTTAGTGG - Intronic
1052067889 9:24045248-24045270 CAAACCACACCAAACCTTAGTGG + Intergenic
1052082052 9:24218483-24218505 AAAATTACACCAACACTTAGAGG - Intergenic
1053184796 9:36006491-36006513 CAAACTTCTTCAAAACTAAGTGG - Intergenic
1055072003 9:72175965-72175987 CAAATTACCCCAAAACTTAGGGG + Intronic
1055210077 9:73780972-73780994 CAAACCACCCCAAAACTTTGTGG + Intergenic
1055470224 9:76603405-76603427 CAAATTATTCCAAATCTTAGTGG + Intergenic
1055524280 9:77114852-77114874 CAAACTACCCCAAAGGTTAGTGG + Intergenic
1055630120 9:78215359-78215381 CAAACCACTCTAAAATTTAGTGG + Intergenic
1055773002 9:79737215-79737237 CAAATTACCTCAAAACTTAGTGG - Intergenic
1056027225 9:82511631-82511653 CAAACCACTCCAAAACTCAGTGG + Intergenic
1056196755 9:84236672-84236694 CAAACCACACCAAAACTTAGTGG + Intergenic
1056448253 9:86687868-86687890 CAAATGACACCAAAACTTAGTGG + Intergenic
1056496815 9:87164075-87164097 GAAACCACTCCAAAACTAAGTGG - Intergenic
1056630454 9:88289062-88289084 CAAACTACATCAAAACTTAGTGG + Intergenic
1056678746 9:88698603-88698625 AAAACCACCCCAAAACTTAGTGG - Intergenic
1056691395 9:88811451-88811473 CAAACTTGTCCAAAATTTAGTGG - Intergenic
1056739186 9:89237923-89237945 AAAAATACCCCAAAACTTAGTGG + Intergenic
1057569074 9:96190075-96190097 CAAACTACTTCAAAACTTAGTGG + Intergenic
1057627539 9:96691269-96691291 CAAACTATCCCAAAATTTAGTGG - Intergenic
1058052352 9:100419686-100419708 CAAATTACTCTAATATTTAGAGG - Intergenic
1058203304 9:102070329-102070351 CAAATTACTCTAATACCTAGTGG - Intergenic
1058232807 9:102450755-102450777 CAAACTACTCCAAAAAATAGAGG + Intergenic
1058825590 9:108773631-108773653 CAAACTACCCCAAAATTTGGTGG + Intergenic
1059078877 9:111225653-111225675 CAAACCACCCCAAAATTTAGTGG - Intergenic
1059123887 9:111665335-111665357 CAAACCACCCCAAAATTTAGTGG + Intronic
1059357071 9:113708188-113708210 CAAACCACTCCAACACTCGGTGG - Intergenic
1059373047 9:113858819-113858841 CAAACAACCCCAAAACTCAGTGG - Intergenic
1059629052 9:116099874-116099896 CAAACCACTCAAACGCTTTGTGG + Intergenic
1059956778 9:119524136-119524158 CAAACCACCCCAACACATAATGG - Intergenic
1060033685 9:120236833-120236855 CAAACCACTGCAACATTTGGTGG - Intergenic
1060143789 9:121233709-121233731 CAAACCACTCCAAAACTTTGTGG - Intronic
1060319560 9:122543907-122543929 CAAACCACTCCAAAACTTAATGG - Intergenic
1062013340 9:134278465-134278487 CAAAATACCCCAAAACTAAGTGG - Intergenic
1062054018 9:134461533-134461555 CAAACCACCCCACAACTTAGTGG + Intergenic
1062655216 9:137600860-137600882 TAAACCACCCCAAAACTTAGTGG + Intergenic
1186232403 X:7469650-7469672 CAAACTACCACAAAACATAGTGG - Intergenic
1186539863 X:10389498-10389520 AAAACCACTCCAACACTTAGTGG - Intergenic
1186709537 X:12178928-12178950 CAAACCACCCTAAAACTTAGTGG + Intronic
1186742057 X:12528986-12529008 CAAATTTCTTCAAAACTTAGTGG + Intronic
1186782003 X:12922248-12922270 CAAATTATCCCAAAACTTAGTGG + Exonic
1186815328 X:13231444-13231466 CAAATTACCCTAAAACTTAGTGG - Intergenic
1186874143 X:13800411-13800433 CAAATTCCTCCAAAACATAGTGG - Intronic
1187089074 X:16075178-16075200 TAAACCACTCTAAAACTTAGAGG + Intergenic
1187206294 X:17184971-17184993 CAGACTACCCCAAAACTTAATGG + Intergenic
1187235303 X:17461653-17461675 TAAACCACCCCAACACTTAATGG + Intronic
1187242452 X:17526172-17526194 CAAACTACCCCAAAATTTAGTGG + Intronic
1187300459 X:18044223-18044245 CAAACCACTCCAAAGCTCAGTGG + Intergenic
1187340730 X:18419351-18419373 CAAATTATCCCAAAACTTAGTGG + Intergenic
1187357411 X:18589966-18589988 CAAACTACTCCATCAAAAAGTGG - Intronic
1187404231 X:18988154-18988176 AAAACTACTCCAATATTTTGAGG + Intergenic
1187429465 X:19209050-19209072 CAAATTACCCCCAGACTTAGGGG + Intergenic
1187564553 X:20435514-20435536 CAAACTACCCTAAAACTTAGTGG + Intergenic
1187582730 X:20626303-20626325 TAAATCACTCCAAAACTTAGTGG + Intergenic
1187600623 X:20825340-20825362 CAAACTACCCCAAAATTCAGTGG + Intergenic
1187606182 X:20885456-20885478 CAAACTTCTTCATAACTTAGTGG + Intergenic
1187821834 X:23296273-23296295 CAAACTATTCTGAGACTTAGTGG - Intergenic
1188020676 X:25153629-25153651 CAAACTATGCCAAAACTTAGTGG + Intergenic
1188066953 X:25674059-25674081 CAAACCACCCCAAAACTTAGTGG + Intergenic
1188297669 X:28469779-28469801 CAAATAACTCCAAAACTTAGTGG + Intergenic
1188501192 X:30828576-30828598 AAAACTACTCCAAAATTTAAGGG + Exonic
1188514167 X:30967349-30967371 CAAACCACCCCAAAACTTAATGG + Intronic
1188752148 X:33917993-33918015 CAAACTAACCCAAAACTCAGTGG - Intergenic
1189019901 X:37324305-37324327 CAAACTATTCCAAAAAATAGAGG + Intergenic
1189102549 X:38206410-38206432 GAAACCACTCCAAAACTTAGTGG - Intronic
1189176971 X:38967330-38967352 CAAACCACCCCAAAACTTAGTGG + Intergenic
1189235520 X:39484081-39484103 CAAGCTCCTCCAAGATTTAGTGG - Intergenic
1189264749 X:39705619-39705641 TAAAATACTCCAAAACTTAGTGG - Intergenic
1189371031 X:40429479-40429501 CAAATTACTCCAACATTTAGTGG - Intergenic
1189430107 X:40938800-40938822 CAAATTATTCCAAAACTTAGTGG - Intergenic
1189465325 X:41274127-41274149 CAAGCCACCCCAAAACTTAGTGG - Intergenic
1189547008 X:42051693-42051715 CAAACCACTGCAAAACTTACTGG + Intergenic
1189568780 X:42273129-42273151 TAAACTACCCTAAAACTTAGTGG - Intergenic
1189571460 X:42302244-42302266 CAAGTTACTCCAAAATTTAGTGG - Intergenic
1189589064 X:42492724-42492746 CAAGCCACTCCAAAACCTAGTGG - Intergenic
1189611348 X:42739556-42739578 CAGATTACTCCAAAACTTAGTGG + Intergenic
1189858269 X:45246132-45246154 CAAACTATTCCAAAAAATAGAGG - Intergenic
1190030181 X:46964667-46964689 CAAACAACTGCAAAATTTAGTGG - Intronic
1190097116 X:47490601-47490623 TAAACCACACCAAAACTTAGTGG - Intergenic
1190132133 X:47758253-47758275 TAAATTACTCCAAAACTTAGTGG + Intergenic
1190229334 X:48569892-48569914 CAAATTATCCCAAAACTTAGTGG + Intergenic
1190411943 X:50145089-50145111 CAAAATATTCCAAAACTTAGTGG - Intergenic
1190893558 X:54593165-54593187 CAAACTATTCCAAAAAATAGAGG - Intergenic
1190896283 X:54621559-54621581 CAAAATACCCCAAAACTTAGTGG - Intergenic
1190943178 X:55064099-55064121 CAAACTATTCCAAAAAATAGAGG - Intergenic
1191113541 X:56828197-56828219 CAAACTACTCCATCAAATAGTGG - Intergenic
1191785698 X:64915252-64915274 CAAACCACACAAACACTTAATGG - Intergenic
1191801242 X:65082709-65082731 CAAACTATTCCAAAAATTAGAGG + Intergenic
1191982181 X:66938447-66938469 CAAACTACCCCAATACTTAGTGG + Intergenic
1191990837 X:67034439-67034461 CAAACTATTCCAAAAAATAGAGG - Intergenic
1192029809 X:67497491-67497513 AAAACTACTACAAAAATTAGGGG + Intergenic
1192073966 X:67971542-67971564 CAAACTATTCCAAAAAATAGAGG + Intergenic
1192297060 X:69861971-69861993 CAAATTACTCCAAAACTTAGTGG + Intronic
1193296405 X:79837439-79837461 CAAACTATTCCAAAAAGTAGAGG - Intergenic
1193336722 X:80298430-80298452 CACACTACTCCAGCACACAGTGG - Intergenic
1193609942 X:83619220-83619242 CAAACTATTCCAAAAAATAGAGG - Intergenic
1193726891 X:85051582-85051604 AAAACTAATCCAAAACTTAATGG + Intronic
1193756356 X:85413770-85413792 CAAACTATTCCAAAAAATAGAGG - Intergenic
1194218451 X:91162317-91162339 CAAACTATTCCAAAAAATAGAGG - Intergenic
1194924179 X:99804849-99804871 CTAACCACTCCAAAATTTAGGGG + Intergenic
1194937315 X:99966354-99966376 CAAACTATTCCAAAAAATAGAGG - Intergenic
1195386839 X:104321686-104321708 CAAATGACTCCCACATTTAGTGG - Intergenic
1195558413 X:106254371-106254393 CAAACTATTCCAAAAAGTAGAGG - Intergenic
1195692795 X:107642009-107642031 CAAATCAGTCCAACACTTAGTGG + Intronic
1195916216 X:109938639-109938661 CAAATTATCCCAAAACTTAGTGG - Intergenic
1195979921 X:110566840-110566862 CAAGTTACCCCAAAACTTAGTGG + Intergenic
1196299213 X:114035791-114035813 CAAACTACCCCAAAACATGGTGG + Intergenic
1196305007 X:114091316-114091338 CAAACTATTCCAAAAAATAGTGG + Intergenic
1196361871 X:114870464-114870486 CAAACTATTCCAAAAAATAGAGG - Intronic
1196831328 X:119777728-119777750 CAAACTATCCCAAAACCTAGTGG - Intergenic
1196989596 X:121313473-121313495 CTAATTACCCCAAAACTTAGTGG + Intergenic
1197367000 X:125575572-125575594 CAAACTATTCCAAAAATTAGAGG + Intergenic
1197422854 X:126259298-126259320 CAAACTAGCCCAAAATTTAGTGG - Intergenic
1197661219 X:129175061-129175083 CAAACTGTTCCAACAAATAGAGG - Intergenic
1197810702 X:130440375-130440397 CAAACTATTCCAAAAAATAGAGG - Intergenic
1197985969 X:132266719-132266741 CAAACTACTCCAAAATTTAATGG - Intergenic
1198696698 X:139348085-139348107 CAAATTACTCCAAAAGTTAGTGG + Intergenic
1198871702 X:141182738-141182760 CAAACTATCTCAAAACTTAGTGG - Intergenic
1199258733 X:145746479-145746501 CAAACTATTCCAAAAAATAGAGG + Intergenic
1199590055 X:149459219-149459241 CAAACTACCCCCAAACTTAGTGG - Intergenic
1199885988 X:152022406-152022428 CAAACTACCCCAAAACGTGGCGG - Intergenic
1200554963 Y:4626077-4626099 CAAACTATTCCAAAAAATAGAGG - Intergenic
1200793384 Y:7318846-7318868 CAAAGTGCTCCAGCACTTTGTGG - Intergenic
1200821667 Y:7590750-7590772 CAAATTACAGCAAAACTTAGTGG + Intergenic
1201293211 Y:12441886-12441908 CAAAAGACCCCAAAACTTAGTGG - Intergenic
1201358388 Y:13119768-13119790 CAAACAACTCCAACAAAAAGTGG - Intergenic
1202389240 Y:24353135-24353157 CAAATCACTTCAAAACTTAGCGG + Intergenic
1202481547 Y:25316989-25317011 CAAATCACTTCAAAACTTAGCGG - Intergenic
1202596265 Y:26544012-26544034 CAAACCACCCCAAAACTTACTGG + Intergenic