ID: 1119126233

View in Genome Browser
Species Human (GRCh38)
Location 14:72129852-72129874
Sequence GTGGTGCCTCATCATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119126233_1119126237 -2 Left 1119126233 14:72129852-72129874 CCCACCTCATGATGAGGCACCAC 0: 1
1: 0
2: 2
3: 7
4: 97
Right 1119126237 14:72129873-72129895 ACTGTTTTCCCATCGATAACTGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119126233 Original CRISPR GTGGTGCCTCATCATGAGGT GGG (reversed) Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
902722926 1:18316105-18316127 GTGATGCCTCTGCTTGAGGTTGG - Intronic
902734919 1:18394180-18394202 TTGGTGCCTTATCCTGAGGCTGG - Intergenic
907328395 1:53655822-53655844 GTGGTGCCTCAACCTGAGGTTGG - Intronic
908392833 1:63698997-63699019 GAGTTGCCTTATCATGAGATGGG - Intergenic
915163698 1:153936537-153936559 GTGGTGCTCCCTGATGAGGTAGG - Exonic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
921060928 1:211583867-211583889 GTGGAGCGACATCATGAGGCTGG - Intergenic
921385914 1:214569539-214569561 GTGATGACTCAGGATGAGGTTGG - Intergenic
1069827960 10:71265803-71265825 GTGGTGCCTCACCAAGAGCCTGG - Intronic
1076336696 10:129711436-129711458 GGGCTGCCTCATTGTGAGGTTGG + Intronic
1076391604 10:130107595-130107617 ATGGTCCCTCATCATTGGGTCGG + Intergenic
1077512002 11:2971318-2971340 GTGCTGCTGCATCATTAGGTTGG - Intronic
1085726697 11:78960951-78960973 ATGGGTGCTCATCATGAGGTGGG + Intronic
1086358142 11:86027599-86027621 GTGGTGCTTCATACTGAGATGGG - Intronic
1091300521 11:134504268-134504290 GAGGTGCGTCATCCTGAGGAAGG + Intergenic
1091409454 12:229618-229640 GTACTGCCCCTTCATGAGGTCGG + Intronic
1105044693 12:132992675-132992697 ATGGAGCCTCATCATAAGTTGGG + Intronic
1112108916 13:96273207-96273229 CTGATGCTTCATGATGAGGTAGG + Intronic
1116980473 14:51164929-51164951 GTGGTGTCTCATCATCAGGTAGG - Intergenic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1119905427 14:78297837-78297859 TTGTTCACTCATCATGAGGTGGG - Intronic
1120285919 14:82501493-82501515 GTGGAGCCTCATCTTAATGTAGG - Intergenic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1129110953 15:73336765-73336787 GGGGAGCCTCATCAAGAGGTTGG - Intronic
1129678513 15:77645059-77645081 GTGGTGGCTCATCAGGAGTGGGG + Intronic
1130065530 15:80600542-80600564 ATGGGGCCTCACCATGATGTTGG - Intergenic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1143010680 17:3864768-3864790 GGAGAGCCTCATAATGAGGTGGG - Intronic
1147438442 17:40432047-40432069 GTGATGCCTCCTCATGTGGTGGG + Intergenic
1147898743 17:43769735-43769757 CTTCTGCCGCATCATGAGGTAGG + Exonic
1148072168 17:44914891-44914913 ATAGTGCCCCATCAAGAGGTAGG + Intronic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1157314498 18:46576427-46576449 GGGGTGGCTCATCCAGAGGTTGG - Intronic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1161453104 19:4357568-4357590 GTGATGCCTCCTCCCGAGGTAGG + Exonic
1163396083 19:17062358-17062380 GTGAGGACTCATCCTGAGGTCGG - Intronic
1164194173 19:22939985-22940007 GAGGTGGCAGATCATGAGGTGGG + Intergenic
1165095134 19:33406054-33406076 GGGGTGCCTCGTCCAGAGGTGGG + Intronic
1165793369 19:38505358-38505380 GTAGGGCCTCAGCATGGGGTGGG - Exonic
925996610 2:9298633-9298655 GTGGGGTCTCATCACCAGGTCGG + Intronic
927098697 2:19769673-19769695 GTAGTACCTCATCATGATTTTGG - Intergenic
927460981 2:23297959-23297981 GGGCGGCCTCATCATCAGGTGGG - Intergenic
931670562 2:64643430-64643452 CCGGTGACTCATCATGAGGCAGG - Intronic
932494718 2:72140652-72140674 GAGGTGCCTCAGCAGGAGGACGG - Intronic
933813909 2:86050667-86050689 TTTGTTCCTCATCATGAGCTGGG + Intronic
937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG + Intronic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
939982258 2:148795868-148795890 GTGGTGCCATATCCTGAGATGGG - Intergenic
944684895 2:202109623-202109645 GTGGGGCCACATCGTGAGGTGGG - Exonic
1169284412 20:4295900-4295922 GAGTTGCTGCATCATGAGGTAGG - Intergenic
1169772077 20:9212019-9212041 GCAGTGCCCCATCAAGAGGTGGG + Intronic
1174103633 20:48146667-48146689 GTGGTCCCTCTCCAGGAGGTGGG - Intergenic
1175171730 20:57085689-57085711 GTGGGGTCTCATCTTGAGGTTGG - Intergenic
1175354202 20:58349741-58349763 CTGGTGACTCATCCTGAGATTGG - Intronic
1175892845 20:62323018-62323040 GTGGTGTCTAACCATGAGGGGGG + Intronic
1177707267 21:24723003-24723025 GTGGAGCCTGTTCATGATGTGGG + Intergenic
1182887328 22:33786523-33786545 GAGGTGCCTCAGAAGGAGGTTGG + Intronic
1185357338 22:50381486-50381508 GGGATGCCTCATGCTGAGGTGGG - Intronic
951161028 3:19422705-19422727 TAGGTGCCTCATCCTGAGCTAGG + Intronic
955886099 3:63600398-63600420 GGGGAGCCTCAGCAGGAGGTGGG + Intronic
957040913 3:75334903-75334925 GTGGTGCCACATCCTGAGGATGG - Intergenic
961045713 3:123706488-123706510 GTCGTGCCACATCCTGAGGATGG - Intronic
966930200 3:184671194-184671216 GAGGTGCCCCATGATGAAGTGGG + Intronic
966930218 3:184671268-184671290 GAGGTGCCCCATGATGAAGTGGG + Intronic
966930235 3:184671342-184671364 GAGGTGCCCCATGATGAAGTTGG + Intronic
966930274 3:184671495-184671517 GAGGTGCCCCATGATGAAGTGGG + Intronic
966930316 3:184671683-184671705 GAGGTGCCCCATGATGAAGTGGG + Intronic
966930367 3:184671905-184671927 GAGGTGCCCCATGATGAAGTTGG + Intronic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
971209837 4:24605251-24605273 CTGGTGCCTCAGTATGAGGCTGG - Intergenic
986961126 5:13214273-13214295 GTGGTGTCTTATCTTGAGGCTGG + Intergenic
988469657 5:31526603-31526625 GGGGTGCCTCATCTGGTGGTTGG + Exonic
997200371 5:132006404-132006426 GTGGTTCCTCATCATTTGCTCGG - Intronic
998489027 5:142529758-142529780 GAGGTGTCTCATCATTAGGGAGG + Intergenic
999360197 5:150978195-150978217 CTGGTGCCTCTGCATGTGGTTGG - Intergenic
1001509021 5:172304775-172304797 GTGGTGGCTCATACTGAGGAAGG - Intergenic
1002375310 5:178784648-178784670 TTGGTTCCTCAGCCTGAGGTGGG - Intergenic
1004000495 6:11592813-11592835 GTGGTGGCTTATCATGAAGAGGG + Intergenic
1007397186 6:41584710-41584732 GTGGTGCCTCCTCCTGGGTTGGG + Intronic
1007633886 6:43286756-43286778 GTTGAGGCTCATGATGAGGTGGG - Exonic
1021542034 7:21770541-21770563 CTGGTCCCTCCTCATGAGGCTGG - Intronic
1024919513 7:54543008-54543030 CTGGTGCCTGACAATGAGGTGGG + Intronic
1026764588 7:73152493-73152515 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027041058 7:74962261-74962283 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027082579 7:75240112-75240134 GTGGTGCCTTCTCCTGAGGCAGG + Intergenic
1029237281 7:99131605-99131627 ATGGTGGCTCATGCTGAGGTGGG + Intronic
1029860904 7:103570875-103570897 TATGTCCCTCATCATGAGGTAGG - Intronic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1036513942 8:9426253-9426275 GGGAGGCCACATCATGAGGTTGG + Intergenic
1037500179 8:19477987-19478009 CTTGTGCCTCTTCAGGAGGTGGG - Intronic
1039063734 8:33592133-33592155 GTGGTGGTACAGCATGAGGTAGG + Exonic
1040001598 8:42581597-42581619 CTGGTGCCCAATCATGGGGTGGG + Intergenic
1042447665 8:68905842-68905864 GTGATGCCTGTGCATGAGGTGGG - Intergenic
1049209945 8:141381341-141381363 GTGCTTCCTCATCAAGGGGTGGG - Intergenic
1049600895 8:143507057-143507079 GTGGTGCCCCATCTCCAGGTTGG - Intronic
1186568486 X:10689744-10689766 ATAGTGCCTCTTCATGTGGTAGG + Intronic
1188230439 X:27656560-27656582 GTGCTGCCTAATCTGGAGGTAGG + Intronic
1189290082 X:39878601-39878623 TTGGTTCTTCTTCATGAGGTTGG + Intergenic
1192509333 X:71712663-71712685 TTGGTGCCTCATCTAGAAGTGGG - Intergenic
1192517364 X:71768890-71768912 TTGGTGCCTCATCTAGAAGTGGG + Intergenic
1200094298 X:153650058-153650080 GTGGAGCTTCTGCATGAGGTAGG - Exonic
1200215160 X:154365049-154365071 GTGGCCCCTCATCATCAGGTGGG + Intronic
1201694227 Y:16807075-16807097 GTGGTCTCTCATCCTGCGGTAGG - Intergenic
1202068255 Y:20962704-20962726 GTGGTACTTCTTCCTGAGGTGGG + Intergenic