ID: 1119126384

View in Genome Browser
Species Human (GRCh38)
Location 14:72130987-72131009
Sequence TCCCCAAGGCAGAGCCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119126384 Original CRISPR TCCCCAAGGCAGAGCCTAGC AGG (reversed) Intronic
900374378 1:2346833-2346855 TCCCCAGGGCAGACCCCAGCAGG - Intronic
900610027 1:3540774-3540796 TCCCCACGGCAGAGCCTTCCTGG + Intronic
901387805 1:8922558-8922580 TCCCCCAGGAAGAGCCTTCCTGG + Intergenic
905665486 1:39760915-39760937 TCCCCAAGGGGGAGCCTGGAAGG + Intronic
906344042 1:45004219-45004241 TCCCCAAGGCAGGGCAGGGCAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
912628539 1:111226960-111226982 TCCCCCAAGCAGAGACGAGCTGG - Intronic
912697380 1:111851709-111851731 TCCCCAACGCAGCACCTAGCAGG + Intronic
913046074 1:115074436-115074458 TCCACAAGGGAGAGTCCAGCTGG - Intronic
915579230 1:156803562-156803584 TCCTCCAGGCAGAGCCTCTCTGG - Intergenic
922575434 1:226658283-226658305 TCCCCCTGGCAGGGCCCAGCTGG + Intronic
923041007 1:230319623-230319645 TCCCCAGGACAGAGCCTGGAAGG - Intergenic
923306637 1:232694504-232694526 GCCCCAAGGCAGCGTCTAGAGGG - Intergenic
923389563 1:233500638-233500660 GCCCCATGGCAAACCCTAGCTGG + Intergenic
1062966622 10:1612116-1612138 TCCCCAGGGCTGAGCCGAGGGGG + Intronic
1067074963 10:43172887-43172909 TCCCCCAATCACAGCCTAGCTGG - Intronic
1068395176 10:56451292-56451314 TCCCAATAGCAGAACCTAGCAGG + Intergenic
1069824234 10:71245542-71245564 TCCCCACATCAGAGACTAGCTGG - Intronic
1070887223 10:79913458-79913480 TCCCAATAGCAGAACCTAGCAGG - Intergenic
1071978938 10:90984079-90984101 TCACCAAGGCAGAGCTTTGCAGG - Intergenic
1072477996 10:95781937-95781959 TCACCAAGGCAGGGCAGAGCTGG + Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1075095614 10:119468899-119468921 TACCCAAGGCAGAGCCTGGAAGG + Intergenic
1075668608 10:124247952-124247974 TCCCCAGGGCAGGGCCCAGAGGG + Intergenic
1076051097 10:127333713-127333735 TCCTGCAGGCAGAGCCTCGCCGG + Intronic
1077066806 11:644716-644738 TCCCCAAGGCAGACCCCAGAGGG + Intronic
1077550735 11:3199123-3199145 TTCCCAAGGCAGACCCACGCTGG - Intergenic
1078433178 11:11303129-11303151 TCCCCCAGGCAGAGGGCAGCAGG - Intronic
1080626704 11:34037120-34037142 TCCCCAAGGCAAAGCCTTAATGG + Intergenic
1082092873 11:48104156-48104178 TCCAAAAGGCAGAGACAAGCAGG - Intronic
1082693478 11:56332206-56332228 TGCCCAAGGCACAGCCCCGCGGG - Intergenic
1084401815 11:68948472-68948494 TACCCACTGCAGAGCCTAGTCGG + Intergenic
1084694277 11:70744469-70744491 TCCCGTAGGCAGATCCTAGCAGG - Intronic
1089309255 11:117547165-117547187 TGCACATGGCAGAGCCCAGCCGG + Intronic
1091364745 11:135008347-135008369 TCTGCTAGCCAGAGCCTAGCAGG + Intergenic
1094501168 12:31022231-31022253 TCCCCTAGGCAAAGCTCAGCAGG - Intergenic
1094749573 12:33390289-33390311 TCCTCAAGGCTGAGCGTATCAGG + Intronic
1099459984 12:82910399-82910421 ACCCCACGGCAGTGCCTAGGGGG + Intronic
1102571892 12:113831810-113831832 TCCCCACGCCTGAGCCTCGCTGG - Intronic
1103181727 12:118918049-118918071 TCCCCAAGTCAGAGATTATCAGG - Intergenic
1103937564 12:124484630-124484652 TGCTCCAGGCAGAGCCCAGCAGG - Intronic
1104710441 12:130982082-130982104 TCCTCCAGGCAGAGCCTCCCGGG - Intronic
1104969910 12:132526591-132526613 TTCCCAAGACAGACCCTTGCCGG - Intronic
1105210847 13:18255961-18255983 TCCCCAAGGCAGTGGCGAGGAGG + Intergenic
1108361046 13:49668233-49668255 TCCCCCACACAGATCCTAGCTGG + Intronic
1112765870 13:102742695-102742717 TCCCCAAGGTAGACCTTTGCAGG - Exonic
1116988022 14:51241783-51241805 TCCCCAAGGGAGAACCCAGAAGG + Intronic
1119126384 14:72130987-72131009 TCCCCAAGGCAGAGCCTAGCAGG - Intronic
1122978226 14:105179746-105179768 TCCCCAAGGCGAAGCTAAGCTGG - Intronic
1128325114 15:66719267-66719289 TCCCCAAGCCAGACCCTGGCAGG + Intronic
1128775184 15:70314987-70315009 TCCCCAAGAGAGAGCTTTGCGGG + Intergenic
1128800232 15:70492605-70492627 ACCCCAAGTCAGAACCAAGCTGG + Intergenic
1131334645 15:91536369-91536391 TCCCTAAGGCAGAGACCAGCAGG - Intergenic
1132397072 15:101481944-101481966 TCCCCGAGACAGAGCCATGCTGG + Intronic
1139481658 16:67234113-67234135 GCCCCAAGGCTGAGCCCATCTGG - Exonic
1139851149 16:69952140-69952162 CCCCCCTGGCAGAGCCCAGCTGG - Intronic
1139880127 16:70175052-70175074 CCCCCCTGGCAGAGCCCAGCTGG - Intronic
1139949212 16:70661019-70661041 GCCCCCAGGCAGCCCCTAGCAGG + Intergenic
1140032789 16:71351726-71351748 GCCCCCAGGCAGAGCCAAGCCGG + Intergenic
1140372382 16:74420465-74420487 CCCCCCTGGCAGAGCCCAGCTGG + Intronic
1141113269 16:81287739-81287761 TGCACAAGACAGAGCCCAGCAGG + Intronic
1142847608 17:2689866-2689888 GCCCCAAGGCTGCGCCCAGCTGG + Exonic
1142956879 17:3528619-3528641 TCCCAAGGGCAGACCCTTGCTGG - Intronic
1143565807 17:7719883-7719905 TCCCCAAGGAGGAGCCTGGTGGG + Exonic
1145790209 17:27621860-27621882 GCCCCAATGCAGAGCCTGTCGGG - Intronic
1146064189 17:29622329-29622351 TCCTCTAGGGAGACCCTAGCTGG - Intronic
1147951006 17:44108048-44108070 TCCCCAAGCCAGAACTAAGCTGG + Intronic
1148189932 17:45671449-45671471 TCCCCATGGCCGAGTCTAGTTGG - Intergenic
1148203351 17:45764385-45764407 CCCTCAAGGCAGAGCAGAGCTGG - Intergenic
1148367476 17:47067295-47067317 TCCCCTAGGCAGCGCTCAGCGGG - Intergenic
1148536633 17:48444615-48444637 TTGCCAAGGCAGAGCCAAGCTGG + Intergenic
1148582803 17:48755094-48755116 TCCCCGACGCTGAGCCTTGCAGG - Intergenic
1148788074 17:50155669-50155691 TGCGCCAGGCAGAGCCTGGCGGG - Intergenic
1149659874 17:58328704-58328726 TCCCCAGAGCAGAGGCCAGCAGG - Intronic
1151508850 17:74546113-74546135 TGCAGAAGGCAGAGCCAAGCTGG + Exonic
1151894147 17:76968958-76968980 TCCCCAAAGCCCAGCCCAGCTGG - Intergenic
1151903972 17:77035767-77035789 TCCCCAAAGCAAAGCCTGGCTGG - Intergenic
1152877135 17:82793311-82793333 TCCTCAAGGCGGGGCCTAGGGGG - Intronic
1161023272 19:2021772-2021794 TCCACAAGGAAGAGCCTCACTGG - Intronic
1163782197 19:19256509-19256531 TCCACAAGGAAAAGCCTAGGGGG + Exonic
1165068853 19:33243718-33243740 TCCCCAAGGCAGGGCATGGCTGG + Intergenic
1165220608 19:34313227-34313249 TCATCAAGGAAGAGCGTAGCTGG + Intronic
1165346829 19:35253866-35253888 TCCCCGAGACAGAGCCTGGGGGG - Intronic
1167622141 19:50566424-50566446 TCCCCTGGGGAGAGCCCAGCTGG - Intronic
928236219 2:29543560-29543582 TTCCCAAAGCAGAGGGTAGCAGG - Intronic
930213249 2:48665470-48665492 TACCCAAAGCAGTGCCTAGAGGG - Intronic
930531822 2:52597970-52597992 TTCCTAAGGCAGAGCTCAGCAGG + Intergenic
932024076 2:68116155-68116177 TTCCCAGGGCAGAGTCCAGCTGG - Intergenic
933331111 2:80894387-80894409 TTCCCAAGGCAGATCCTAAATGG - Intergenic
934577286 2:95410986-95411008 TCACCAAGGCAGGGCCCAGAGGG - Exonic
934639583 2:96019660-96019682 TCACCAAGGCAGGGCCCAGAGGG - Intergenic
934794067 2:97085717-97085739 TCACCAAGGCAGGGCCCAGAGGG + Exonic
936595292 2:113841483-113841505 TTCCCATTGCAGAGCCTACCAGG + Intergenic
937111547 2:119370618-119370640 ACCCCATGACAGAGCCTAGAAGG + Intronic
938289881 2:130143509-130143531 TTCCCTAGGCAGAGCCCACCTGG + Intronic
938466647 2:131529430-131529452 TTCCCTAGGCAGAGCCCACCGGG - Intronic
946189570 2:218001276-218001298 TCCCCAGGGCAGTGCCTGGCAGG - Intronic
946414357 2:219532139-219532161 TGCCCAATCCAGGGCCTAGCAGG - Intronic
947524371 2:230869414-230869436 TGTTCAAGACAGAGCCTAGCTGG - Intronic
947530608 2:230906685-230906707 GGCCCAGGCCAGAGCCTAGCAGG + Intergenic
948279757 2:236738010-236738032 GCCCCAAGGCATAGCTTTGCTGG - Intergenic
948930260 2:241127369-241127391 TCCCCAAGGCAGTGATTTGCTGG + Exonic
948981911 2:241498819-241498841 TCCCTTAGGCAGAGCTTGGCTGG - Intronic
949047983 2:241880900-241880922 TCCCCGAGGCAGAGCCTCCCAGG - Intergenic
1168796247 20:611798-611820 TCCCCAAAGCCCAGCCTGGCTGG - Intergenic
1171291987 20:23987650-23987672 TCCCCAAGGCAGTGGCGAGGAGG + Intronic
1173497563 20:43530412-43530434 TCCCAAAGGTAAGGCCTAGCTGG + Exonic
1177553886 21:22664551-22664573 ACCCCAAGGAAGAGCTCAGCTGG - Intergenic
1180765405 22:18343461-18343483 TCCCCAAGGCAGTGGCGAGGAGG - Intergenic
1180813625 22:18776238-18776260 TCCCCAAGGCAGTGGCGAGGAGG + Intergenic
1181027948 22:20136307-20136329 TCCCACAGGCAGGGCCTAGCAGG - Intronic
1181199810 22:21210568-21210590 TCCCCAAGGCAGTGGCGAGGAGG + Intronic
1181399957 22:22645285-22645307 TCCCCAAGGCAGTGGCGAGGAGG - Intronic
1181649408 22:24250504-24250526 TCCCCAAGGCAGTGGCGAGGAGG + Intergenic
1181809206 22:25393139-25393161 CACGCAAGGCAGAGCCCAGCTGG + Intronic
1181910464 22:26234305-26234327 CCCCCAAGGTCCAGCCTAGCTGG - Intronic
1182713882 22:32339903-32339925 TCCCCAGGGCAGAACCTCGGGGG - Intergenic
1183257323 22:36770894-36770916 TCCCATTGGCAGAGCCTAACAGG - Intronic
1185082697 22:48718602-48718624 TCCCCAGAGCACAGCCAAGCCGG + Intronic
1185164851 22:49255300-49255322 CCCCCGAGGCTGAGCCTGGCTGG - Intergenic
1203227026 22_KI270731v1_random:84351-84373 TCCCCAAGGCAGTGGCGAGGAGG - Intergenic
1203263725 22_KI270734v1_random:1920-1942 TCCCCAAGGCAGCGGCGAGGAGG + Intergenic
949663042 3:6303864-6303886 GCACCAAGGCAGAATCTAGCAGG - Intergenic
949923531 3:9022894-9022916 TGCCTCAGGCAGAGCCCAGCTGG - Intronic
952272676 3:31848020-31848042 TCCCTCAGGCTGAGCCTACCTGG + Intronic
952841875 3:37653292-37653314 TCCCCAAGGCAGAGCAAATAGGG + Intronic
953979943 3:47408587-47408609 TGCCCAAGCCAGGGCCTAGAGGG - Intronic
955381495 3:58442007-58442029 TCCCCAAGGCAAGGCTTTGCAGG + Intergenic
955400142 3:58585637-58585659 TGCCCAAGGCAGAGGGTAGCTGG + Intronic
961432176 3:126891099-126891121 TCCCCAGGACATACCCTAGCAGG + Intronic
963633812 3:147768083-147768105 TCCCCAATGCAGGGCCTGGTGGG + Intergenic
964681537 3:159345472-159345494 TCCCCAAGGCAGAGCCAGGAAGG + Intronic
968877519 4:3280805-3280827 TCCCCAGGGCAGACACTACCTGG + Intergenic
969057320 4:4409962-4409984 TTCCCACGGCAGACCCTGGCTGG - Intronic
969261623 4:6037596-6037618 TCACCGAGGCAGAGGCTAACCGG + Intronic
969261639 4:6037663-6037685 TCACCGAGGCAGAGGCTAACCGG + Intronic
969261653 4:6037730-6037752 TCACCGAGGCAGAGGCTAACTGG + Intronic
969261666 4:6037797-6037819 TCACCGAGGCAGAGGCTAACCGG + Intronic
969261802 4:6038435-6038457 TCACCGAGGCAGAGGCTAACCGG + Intronic
969339336 4:6530438-6530460 TCCCCAAAGCAGCGCCTCCCGGG - Intronic
969531887 4:7734856-7734878 TCCCCACGGGAGCGCCTGGCAGG - Intronic
969721376 4:8894467-8894489 ACCCCATGGCAGCGCCTGGCAGG - Intergenic
970993553 4:22239449-22239471 TCCCCAAGGAAAACCATAGCAGG - Intergenic
971207400 4:24584041-24584063 TCCCCCAGGCCGAACCGAGCGGG - Intronic
971252063 4:24981234-24981256 CCCCCAAGGAAGAGCTTGGCAGG + Intergenic
972256402 4:37360549-37360571 TGACCAAGGCAGCCCCTAGCAGG + Intronic
978802378 4:112767628-112767650 CCCCATAGGCAAAGCCTAGCGGG - Intergenic
979808907 4:125011376-125011398 TTCCAAAGGGAGAGCCTAGATGG + Intergenic
983287659 4:165760350-165760372 TCCTCTAGGCAGAGCCTAACAGG + Intergenic
983746172 4:171203088-171203110 TTCCCAAGGCAGTGCCTCTCTGG - Intergenic
984707382 4:182857581-182857603 GGCCCAAGGCAGAGCAGAGCAGG - Intergenic
999296041 5:150459967-150459989 TTGACAAGGCAGGGCCTAGCAGG - Intergenic
999467715 5:151823021-151823043 CCCCCAAGGGAGTGCCTTGCAGG - Intronic
1001941326 5:175741809-175741831 TCCCCAAGGCTAAGCCCAGCGGG + Intergenic
1003991610 6:11492324-11492346 TCCCCAAGTCAGTGTCAAGCTGG - Intergenic
1006105763 6:31715391-31715413 TACCCAAGGCAGCCCCTAGCAGG - Exonic
1006390500 6:33755385-33755407 TCCCCAAGGCAGTGCCGGGAAGG + Intergenic
1006448495 6:34092749-34092771 TCTCCAAGGCAGAGCCGACCCGG + Intronic
1007829034 6:44624407-44624429 CCCCCCAGGCACAGCCTAGCTGG + Intergenic
1013003346 6:106046697-106046719 TCCCCAGCGCAGAGCCCTGCCGG - Intergenic
1018382289 6:163269331-163269353 GTCCCCAGGCAGAGCCCAGCTGG - Intronic
1018538186 6:164846366-164846388 TCCCCAAGGCAGAGCCAACATGG - Intergenic
1019129071 6:169860280-169860302 TCCCTGAGCCAGAGCCTAGAGGG + Intergenic
1019686201 7:2383620-2383642 TCACCTAGGCAGAGCAGAGCGGG + Intergenic
1020098112 7:5379735-5379757 GCCCCACGGCAGAGGCTACCAGG + Intronic
1024926219 7:54618403-54618425 TCCCCAAGGTGGAGCCTGGTGGG - Intergenic
1027822127 7:83060290-83060312 GCACCAAGGCAGAGCCAAGCAGG - Intronic
1029435962 7:100564210-100564232 CCCCGAAGGAAGAGCCTAGGGGG - Exonic
1029649285 7:101879792-101879814 GCCCCAAGGCAGCGTCCAGCTGG + Intronic
1030550462 7:110952687-110952709 TCTTCAACACAGAGCCTAGCAGG - Intronic
1032844347 7:135739875-135739897 TACCCGTGGCAGAGCCTGGCAGG + Intronic
1034204676 7:149305030-149305052 TCCCCAAGGCTTAGACCAGCGGG + Intergenic
1034386641 7:150746019-150746041 TCCCCAAGGCAGGCCCCAGCCGG + Intronic
1034448835 7:151126740-151126762 TCACCAAGGCCCAGCCTACCTGG + Intronic
1034555736 7:151849302-151849324 TCCAGAAAACAGAGCCTAGCTGG - Intronic
1035056002 7:156037145-156037167 TGCCCAAGGAAGAGCCTGGTGGG - Intergenic
1036084508 8:5599115-5599137 TCCTAACGGCAGATCCTAGCCGG - Intergenic
1036084615 8:5599936-5599958 TCCCAAGGGCAGATCCTAGCTGG - Intergenic
1036424077 8:8627181-8627203 TTACCATGGCAAAGCCTAGCTGG - Intergenic
1036934671 8:12989667-12989689 TGCCCAGGTCAGAGCCTGGCAGG + Intronic
1037931131 8:22880956-22880978 TCCCCCAGGCAGAGCAGAGCAGG - Intronic
1041012736 8:53559882-53559904 TTCCCCAGGCAGAGGGTAGCTGG - Intergenic
1041464071 8:58141796-58141818 TCCCCATGGCAGCCCGTAGCGGG + Intronic
1045332463 8:101167261-101167283 TGCACAGGGCAGAGCCAAGCCGG + Intergenic
1047682024 8:127264119-127264141 TCACCAAGGCAGAGACTAAGAGG + Intergenic
1049360054 8:142208178-142208200 TCCCCCAGGCAGAACCTATGGGG + Intergenic
1051107520 9:13596804-13596826 TCCCCAGGGGAGGGCCCAGCAGG + Intergenic
1059335989 9:113568802-113568824 TCCCTGAGGCTGAGCCTGGCTGG - Intronic
1061534508 9:131239253-131239275 TCCCCACGGCAGAGCCTTCCTGG + Intergenic
1062473041 9:136714544-136714566 TGCCCAAGGCAGGGCCATGCAGG - Intronic
1187270433 X:17775622-17775644 ACCCCAAGGCAGAGGAAAGCTGG + Intergenic
1187320077 X:18230103-18230125 ACCCCAAGGCAGAGGAAAGCTGG - Intergenic
1190732320 X:53234237-53234259 ACCCCAAGGCCAAGCCAAGCCGG - Exonic
1195682046 X:107554501-107554523 TCCCCAAGCCAGACTCTACCTGG - Exonic
1200122361 X:153797228-153797250 TCCCCATGGCCGGGCCTAACTGG - Intronic
1200779019 Y:7197646-7197668 TCCCAGAGACAGACCCTAGCTGG + Intergenic