ID: 1119128433

View in Genome Browser
Species Human (GRCh38)
Location 14:72150034-72150056
Sequence CAGGTAGACGTGAATTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 15, 3: 58, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119128433_1119128439 3 Left 1119128433 14:72150034-72150056 CCTCCCAAATTCACGTCTACCTG 0: 1
1: 1
2: 15
3: 58
4: 223
Right 1119128439 14:72150060-72150082 CCTCAGAATGTTACTTTATATGG 0: 1
1: 3
2: 111
3: 1114
4: 2593
1119128433_1119128440 10 Left 1119128433 14:72150034-72150056 CCTCCCAAATTCACGTCTACCTG 0: 1
1: 1
2: 15
3: 58
4: 223
Right 1119128440 14:72150067-72150089 ATGTTACTTTATATGGAAATAGG 0: 1
1: 4
2: 181
3: 1045
4: 3218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119128433 Original CRISPR CAGGTAGACGTGAATTTGGG AGG (reversed) Intronic
900281986 1:1875843-1875865 CAGGTAGACATGAATTTTGGGGG - Intronic
900357977 1:2273852-2273874 CAGGCAGACGTGCTCTTGGGTGG + Intronic
900712032 1:4120437-4120459 CAGGTAGATGTGAATCTTTGGGG + Intergenic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
902174359 1:14638212-14638234 CCTGTAGACATGAATTTGGGGGG + Intronic
902643500 1:17781671-17781693 GGGGTAGACATGAATTTTGGGGG + Intronic
905510817 1:38518280-38518302 GAGGTGGACATGAATTTTGGAGG + Intergenic
905795293 1:40812650-40812672 CAGGGAGAAGTGAAGTTTGGGGG + Intronic
906106889 1:43300028-43300050 CAGGGAGAGGTGAGTCTGGGAGG + Intergenic
906373045 1:45270569-45270591 CATGAAGACGTGAAATTTGGAGG + Intronic
906955733 1:50372157-50372179 CAGGGAGACATAAATTTCGGAGG + Intergenic
907585605 1:55615270-55615292 CAGGTGGACATGAATTTTGTGGG - Intergenic
909873324 1:80772578-80772600 CAGACAGACCTGAGTTTGGGCGG + Intergenic
911202600 1:95060841-95060863 CAGGTGGACATGAATTTTAGGGG - Intronic
913210733 1:116580252-116580274 CAGGTGGACATGCATTTTGGAGG - Intronic
913375942 1:118152668-118152690 CAGGTAGGTGTGACTTTGTGTGG + Intronic
913461702 1:119093385-119093407 TAGGTAGACATGAATTTTGGAGG - Intronic
918007304 1:180553999-180554021 CAAGTGGAAGTGAATTTGGGGGG - Intergenic
920961961 1:210671449-210671471 CAGGTACACATGAATTTGCAGGG - Intronic
921366531 1:214379752-214379774 CAGGAAGACTTGAAGTAGGGAGG - Intronic
921410653 1:214832866-214832888 CAGGTAGATGTGAAATTTTGGGG + Intergenic
922343032 1:224672732-224672754 CAGGTAGATATGAATTTTGGAGG + Intronic
922907125 1:229182543-229182565 CAGGTAGTCGTGAAATTGTTTGG - Intergenic
924467163 1:244308925-244308947 CAGGAGGATGTGAATTTGGGGGG + Intergenic
924744892 1:246822586-246822608 TAGATGGACGTGAATTTTGGGGG + Intergenic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1067396655 10:45926058-45926080 CAGGTGAACATTAATTTGGGGGG + Intergenic
1067864970 10:49895161-49895183 CAGGTGAACATTAATTTGGGGGG + Intronic
1068892294 10:62160543-62160565 CAGGTAGACGTATCTTTTGGGGG - Intergenic
1069404273 10:68081577-68081599 CAGATGGACATGAATTTTGGGGG + Intergenic
1069555436 10:69394719-69394741 CAGGTAGACATGAATGCTGGTGG + Intronic
1069730645 10:70609782-70609804 CAGAAGGACATGAATTTGGGGGG + Intergenic
1069840444 10:71336312-71336334 TGGGTAGACATGAATTTTGGGGG + Intronic
1070370768 10:75779832-75779854 CAGGTAGACATAAATTTGTAGGG - Intronic
1072058135 10:91781375-91781397 CAGGTGGATATGAATTTGGGAGG + Intergenic
1072242953 10:93514271-93514293 CAAGTGGACATGAATTTTGGGGG + Intronic
1072836657 10:98722125-98722147 CTGGTAGACATAAATTTTGGGGG - Intronic
1074713504 10:116197659-116197681 CAGGTGGACATGAATTTTGTGGG + Intronic
1075256929 10:120932705-120932727 CAGATGGAGGTGAATTTGGAAGG - Intergenic
1075484458 10:122810793-122810815 CAGGAAGATGGGAATTTGAGAGG + Intergenic
1075621957 10:123934594-123934616 CAAGTGGACATGAATTTGGTGGG + Intronic
1076380527 10:130022070-130022092 CAAGTGGATGTGGATTTGGGGGG - Intergenic
1076484243 10:130805600-130805622 TAGATAGACATGAATTTTGGGGG - Intergenic
1076716102 10:132364644-132364666 CAGGTAGATGTAAGTGTGGGTGG - Intronic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1080208857 11:29761868-29761890 CAGGTGGATATGAATTTTGGAGG - Intergenic
1081109051 11:39109123-39109145 CAGATAGACACGAATTTGGAGGG + Intergenic
1081307361 11:41529874-41529896 CAGATAGAGTTTAATTTGGGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084447668 11:69213093-69213115 CAGGGGGACATGAATTTTGGCGG - Intergenic
1085669975 11:78454266-78454288 CATTTCAACGTGAATTTGGGAGG - Intronic
1087740232 11:101879198-101879220 CAGGAAGACTTGAAGTGGGGAGG - Intergenic
1087779029 11:102283828-102283850 CAGGTAGACGTGACTTTCTGTGG + Intergenic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1088395002 11:109357412-109357434 CCAGTAGCCCTGAATTTGGGGGG - Intergenic
1089172009 11:116518641-116518663 CAAGCAAACATGAATTTGGGTGG + Intergenic
1091123448 11:133075875-133075897 CAGGCTGACTGGAATTTGGGTGG - Intronic
1093503544 12:19838427-19838449 TGGGTAGACGTTAATTTTGGAGG + Intergenic
1093580178 12:20777714-20777736 CAGTTAGGCGTGAACTTGGCGGG - Intergenic
1095290368 12:40472711-40472733 AAGGAAGACATGAATTTGGGTGG + Intronic
1097350026 12:58538625-58538647 CAGGTAGGCATGAATTTTGGGGG - Intergenic
1099467999 12:83010466-83010488 CAGGTAAACAGGAATGTGGGAGG - Intronic
1100795735 12:98179908-98179930 CAGGTGGACATGAATTTTAGTGG + Intergenic
1100825760 12:98472870-98472892 CAGGTAGACATGAATTATTGGGG - Intergenic
1101405630 12:104426233-104426255 CAGGTTGATGTGAATTTGGGGGG - Intergenic
1101448086 12:104752409-104752431 TGGGTGGACATGAATTTGGGAGG + Intronic
1102217040 12:111169013-111169035 TAGGTGGACATGAATTTTGGCGG - Intronic
1102502193 12:113360133-113360155 CAAGTAGACGTGAGATTTGGGGG + Intronic
1102568020 12:113809765-113809787 CAGGTGGACGTATATTTTGGGGG - Intergenic
1103477585 12:121229984-121230006 CAGGTAGATGTGAATTTTTGGGG + Intronic
1103613249 12:122136695-122136717 CAGGAAGACGCGAATGAGGGAGG + Intronic
1104844503 12:131840124-131840146 CGGATGGACGTGAATTTGGCGGG + Intronic
1108066726 13:46585461-46585483 CAGCTACTCGTGAATCTGGGAGG + Intronic
1108570586 13:51745898-51745920 CAGGTAGAAGTGAATTTTGTGGG - Intronic
1111456655 13:88493177-88493199 CAGGTAAACAGGAATTAGGGAGG - Intergenic
1111775347 13:92654783-92654805 CAGGTAGAAATGAAATTTGGGGG - Intronic
1112838805 13:103549985-103550007 CAGGTGGATATGAATTTTGGGGG + Intergenic
1114504553 14:23199282-23199304 CAGGAAGACTTGAAGTGGGGAGG + Intronic
1117965906 14:61206523-61206545 CAGGTAGATATGAATTTTAGGGG + Intronic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1120144292 14:80962594-80962616 CAGGTAGATATGAATTTTGGGGG + Intronic
1120876977 14:89384002-89384024 CAGGTGGACATGAATTTGGTGGG + Intronic
1120885719 14:89450366-89450388 CAAGCAGACATGAATTTTGGGGG + Intronic
1121022784 14:90591706-90591728 CAGGTAAACCTGAACTTGTGGGG - Intronic
1122077093 14:99243030-99243052 CATGTAGACTTGGATTAGGGAGG - Intronic
1122134462 14:99624898-99624920 CAGGGAGATGTGAATTTGATGGG - Intergenic
1122595016 14:102884391-102884413 CAGATAGACATGAATTTTGGAGG + Intronic
1122595757 14:102889906-102889928 CAGGTAGACTTGACATTTGGTGG + Intronic
1124010193 15:25831912-25831934 CAGATGGACATGAATTTTGGGGG - Intronic
1124969108 15:34467488-34467510 CAAGTAGAAATGAATTTTGGGGG - Intergenic
1126188116 15:45850450-45850472 CAGGTAAACAGGAATTAGGGAGG - Intergenic
1126487674 15:49200375-49200397 CAAGTAGATATGAATTTGGGGGG - Intronic
1126874354 15:53023664-53023686 CAGGTAGATGTAAATGTGAGAGG + Intergenic
1127462546 15:59212476-59212498 CAGGTGGATGTGAAATTTGGGGG - Intronic
1129063359 15:72880105-72880127 CAGATAAACATGAATTTCGGAGG - Intergenic
1129245667 15:74277363-74277385 CAGGCAGAGGTGGATGTGGGTGG + Intronic
1129690127 15:77708474-77708496 CAGATGGACATGAATTTGGGGGG - Intronic
1130964689 15:88688267-88688289 TCAGTAGACGTGAATTTTGGGGG + Intergenic
1131537684 15:93251480-93251502 CGAGTAGACATGAATTGGGGTGG - Intergenic
1131552499 15:93369626-93369648 TGGGTAGACATGAATTTTGGGGG + Intergenic
1133177376 16:4025491-4025513 CAGGGAGAGGTGCGTTTGGGCGG + Intronic
1133395647 16:5445091-5445113 CAGGTAGGTGGGAATGTGGGAGG + Intergenic
1133623017 16:7544355-7544377 CAAGTGGACATAAATTTGGGGGG - Intronic
1133689846 16:8202748-8202770 CAGGTGGACATGAATTTTGAGGG + Intergenic
1133758314 16:8778909-8778931 CAGGTAAACATGAATTTAGGGGG + Intronic
1135738401 16:24952625-24952647 CAGGTAGAAAGGAATTTGGTGGG + Intronic
1136404469 16:30036117-30036139 AAGGTAGAGGTGACTTAGGGTGG - Intronic
1138752255 16:59438137-59438159 CAGGTAGGCATGAATTTGGGGGG - Intergenic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1140662823 16:77204298-77204320 CTGGTGGACATGAATTTTGGAGG - Intronic
1140821918 16:78670602-78670624 CAGATAGACACGAATTTGGGGGG - Intronic
1141437965 16:84011581-84011603 CAGGTAGACATGAATTTTGGGGG - Intronic
1141598972 16:85113939-85113961 CAGGGAGACATACATTTGGGGGG - Intergenic
1141666591 16:85468852-85468874 CTGGTAGACGTGAATTTTGGGGG - Intergenic
1141685768 16:85569059-85569081 CAAGAAGGCTTGAATTTGGGAGG - Intergenic
1142065425 16:88059667-88059689 CAGGAAGATGTGAGTTTGGTGGG + Intronic
1147269192 17:39255463-39255485 CAGGTAGATGTGACTTGAGGGGG + Intergenic
1147347801 17:39814474-39814496 CAGGAGGACATGAATTTAGGAGG - Intronic
1147645404 17:42030652-42030674 CAGATAGATGTGAATTTTGGGGG - Intronic
1147993400 17:44348825-44348847 CAGGAAGACGTGATTTTTGTGGG - Intronic
1151222784 17:72625597-72625619 CAGGTGGACATGGATTTTGGTGG + Intergenic
1151363296 17:73601383-73601405 TGGGTGGACATGAATTTGGGGGG - Intronic
1151498700 17:74474868-74474890 CAGGTAGGGGGGAAGTTGGGGGG + Intronic
1151701313 17:75743989-75744011 CAGGTGGACGTGTCCTTGGGAGG - Intronic
1152098017 17:78283565-78283587 CTTATAGACGTGAATTTGGAGGG - Intergenic
1152108702 17:78345131-78345153 CATGCAGACATGAATTTGGTGGG - Intergenic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1153076615 18:1168879-1168901 TAGGAAGACGTGAACTTTGGAGG - Intergenic
1154124950 18:11683735-11683757 CAGGTGGAAGTGAATTATGGAGG - Intergenic
1155072212 18:22326584-22326606 TAGGTGGACATGAATTTTGGAGG - Intergenic
1155544481 18:26901416-26901438 CAGGTAGTCATGAATTTGCCAGG - Intergenic
1157085552 18:44577022-44577044 CAGGTAAACATGAATTTTGGAGG + Intergenic
1158599225 18:58842792-58842814 CAAGAAGATATGAATTTGGGAGG + Intergenic
1160411608 18:78678786-78678808 CAGGTGGACCTGAATTTGGAGGG + Intergenic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161341567 19:3745941-3745963 CAGGTAGGCATGAATTTGAGGGG + Intronic
1161692016 19:5741241-5741263 CAGGTTGACATAAATTTTGGGGG - Intronic
1161894970 19:7073535-7073557 CATGTATATGTGAATTTTGGGGG + Intronic
1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG + Intronic
1163374818 19:16923518-16923540 CAAGTGGATGTGAATTTGGGAGG - Intronic
1163550436 19:17963648-17963670 CAGGGAGACTTGAGTTAGGGTGG - Intronic
1166772605 19:45293174-45293196 CAGGTTCACTTGAATCTGGGAGG + Intronic
925665984 2:6256874-6256896 CTGGTGGACATGAATTTTGGGGG - Intergenic
928697306 2:33862181-33862203 CAGGTGGACATAAATTTTGGAGG + Intergenic
930248903 2:49013573-49013595 CAGGTAGAAGTGCCTTTGGAGGG + Intronic
935632986 2:105227268-105227290 CTGGTAGATGTGAATTTTGGTGG - Intergenic
938764943 2:134454622-134454644 CAGGTGGAAGTGATTTTTGGGGG + Intergenic
942034680 2:171999614-171999636 CATGGAAACGTGAAGTTGGGCGG - Exonic
943302410 2:186220590-186220612 CAGTGAGACGTAAAGTTGGGAGG + Intergenic
943325609 2:186493944-186493966 CAGGTGGACTTGAATTTTGGGGG + Intronic
944304984 2:198169102-198169124 CAGGTGGCCATGAATTTGGGTGG + Intronic
944472826 2:200073143-200073165 CAGGTGGACATGAATTTTTGAGG + Intergenic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
945609818 2:211985985-211986007 CAGGTAGTACTGAATTAGGGTGG + Intronic
946887991 2:224243732-224243754 CAGGTAGATGTGAAGTTTGGGGG - Intergenic
948320830 2:237067687-237067709 CAGGTGAGCATGAATTTGGGGGG + Intergenic
1169343959 20:4815605-4815627 CAGGTAGAAGTGGAGTTGTGTGG - Intronic
1172976427 20:38909429-38909451 CAGGTAGACATGAATTTTTGAGG + Intronic
1175119623 20:56708062-56708084 CTGGTGGACATGAATTTTGGAGG + Intergenic
1175761399 20:61564232-61564254 CTGGTGGACGTGAATTTGGGAGG + Intronic
1176069452 20:63218504-63218526 CAGGTGGACATGAGTTTTGGGGG + Intergenic
1177484067 21:21732254-21732276 CAGGTAGATGTGACTTTCAGGGG + Intergenic
1178839168 21:36124966-36124988 CAGGTGGACATGAATTTTGAGGG - Intergenic
1178911805 21:36680728-36680750 AGGGAAGACGTGAATTTTGGGGG - Intergenic
1179472783 21:41622651-41622673 CAGGTGGACACGAATTTTGGGGG + Intergenic
1183013902 22:34970329-34970351 TGGGTAGACATGAATTTTGGGGG - Intergenic
1183397011 22:37577312-37577334 CAGGTGGACATGAATTTTCGGGG - Intronic
1184748886 22:46472995-46473017 CAGGTGGATGTGAATTTTGGGGG + Intronic
1184775595 22:46621300-46621322 GAGGTGGACATGAATTTTGGGGG - Intronic
1185118414 22:48951236-48951258 CAGGTGTGCGTGAATTTGGGGGG - Intergenic
952180838 3:30914830-30914852 CAGGAAGACATGGATATGGGAGG - Intergenic
953716788 3:45322570-45322592 CAATTAGACCTGAATTTTGGGGG + Intergenic
954846430 3:53562657-53562679 CAGGTTCAAGAGAATTTGGGGGG - Intronic
956318295 3:67965049-67965071 CTGGTGGACGTGAATTTTGGGGG + Intergenic
956437673 3:69249754-69249776 CTGGGATACTTGAATTTGGGAGG - Intronic
958579407 3:95998290-95998312 CAGGTAGTTGAGAATTTGGGAGG - Intergenic
959938082 3:112050751-112050773 CAGGTACACTTGCATTTTGGAGG - Exonic
961113230 3:124303493-124303515 CAGATGGAAGTGAAGTTGGGTGG + Intronic
966709406 3:182955671-182955693 CAGGTTCACTTGAACTTGGGAGG - Intronic
967001617 3:185341111-185341133 CTGGTGGACGTGAATTTTGGGGG - Intronic
968970082 4:3789148-3789170 CAGATGGACGTGAATTGGGAGGG - Intergenic
969051605 4:4377200-4377222 CAGATGGACATGAATTTTGGGGG + Intronic
970211332 4:13713199-13713221 CAGGTAGACATGAATTTTAGGGG - Intergenic
970464941 4:16312943-16312965 AAGGTAGACATGAATTCTGGGGG + Intergenic
970535741 4:17028197-17028219 CAGGTGGACATGGATTTGGTGGG - Intergenic
973580100 4:52334836-52334858 GAGGATGACGTGAACTTGGGAGG + Intergenic
975488971 4:74967707-74967729 CAGGTAGGCATGTATTTGGTTGG - Intronic
976055458 4:81060635-81060657 CGGGTTGACCTGAAATTGGGTGG - Intergenic
976528272 4:86118887-86118909 AAGGCAGAAGTGAATTTGGCAGG - Intronic
976663120 4:87561213-87561235 GAGGTGGACATGAATTTTGGGGG - Intergenic
976764416 4:88584289-88584311 CAGGTAGACATGAATTTGAAGGG + Intronic
976956612 4:90909320-90909342 CAAGTAGACATGAATTTTGGAGG + Intronic
977531029 4:98200634-98200656 CAGGTAGACATGAATTTTGGGGG - Intergenic
977648855 4:99446120-99446142 CTGGCATACGTGAATTTTGGAGG - Intergenic
978937532 4:114396216-114396238 TAGATGGACATGAATTTGGGGGG + Intergenic
979715186 4:123829364-123829386 CAGGTAGACATAAATTTGCAGGG - Intergenic
981027796 4:140094162-140094184 CAGGTAAGGGGGAATTTGGGAGG + Intronic
981888375 4:149706368-149706390 GAGGCAGACATGGATTTGGGGGG + Intergenic
981901638 4:149871903-149871925 CGGCTAGATGTGATTTTGGGAGG + Intergenic
984702448 4:182826895-182826917 CAGGGAGACACGAATCTGGGGGG + Intergenic
984806016 4:183752545-183752567 CAGGTGGACATGAATTTGGTGGG + Intergenic
985768004 5:1791089-1791111 CAGGTAGACAGGAATTTTGCGGG - Intergenic
986766456 5:10932462-10932484 CAGTTAAACCTGCATTTGGGAGG + Intergenic
986897943 5:12393674-12393696 CATGTGGACATGAATTTCGGAGG - Intergenic
987108443 5:14663456-14663478 TAGGTGGACGTGAATTTTGGGGG + Intergenic
987247002 5:16059299-16059321 CAAGAAGACATGAATTTTGGAGG + Intergenic
988389683 5:30611767-30611789 CAGGTGGACATTAATTTGGGTGG - Intergenic
989169105 5:38457661-38457683 TGGGTAGACATGAATTTGGCGGG + Intronic
989262259 5:39431198-39431220 TAGGTAGACATGAATTTTGGAGG - Intronic
990569312 5:57061721-57061743 CAGGGGGATGTGAATTTTGGAGG + Intergenic
991290508 5:65030041-65030063 AAGGTAGACTTGGATTTGGCAGG - Intergenic
991574635 5:68090205-68090227 CAGGTGGACTTGAATTTCAGGGG + Intergenic
992160191 5:73993422-73993444 CAGGTAGAAGTGGAGCTGGGAGG + Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
994280171 5:97892615-97892637 CAGGTAGACATGAATTTTGCAGG - Intergenic
995168203 5:109073123-109073145 CAGGTAGACATAAATTTTGGGGG + Intronic
996229947 5:121050310-121050332 GAGGTAGAAGTGGAGTTGGGTGG - Intergenic
996303481 5:122017565-122017587 CAGGTGGATGTGAATTTTGAGGG + Intronic
997659986 5:135582107-135582129 GAGGTAGACGTGAAGTGTGGGGG + Intergenic
1000784921 5:165531080-165531102 CTGGAAGACATGAATTTGGGAGG + Intergenic
1005091225 6:22058897-22058919 GAGGTAGAAGTAAATTTGGAAGG - Intergenic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1005810129 6:29509068-29509090 TATGTAGACATGAATTTGAGGGG + Intergenic
1007539454 6:42627585-42627607 GAGGTTGGCTTGAATTTGGGTGG - Intronic
1013274506 6:108571400-108571422 CAGGAAGACATGAATTTTAGAGG - Intronic
1013343648 6:109238743-109238765 CAGGTAGACATGAATTTTGGGGG + Intergenic
1013356177 6:109347746-109347768 CAGGTAGACATGAAATTTGGGGG + Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1018034218 6:159867568-159867590 TGGGTAAACGTGAATTTTGGAGG - Intergenic
1018040864 6:159921031-159921053 CAGGTGGACAGGAATTTTGGGGG - Intergenic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1019065975 6:169298134-169298156 TAGGTGGACATGAATTTTGGGGG - Intergenic
1019806692 7:3131646-3131668 CAGGCTGAAGTGAATTTTGGGGG - Intergenic
1021503653 7:21357093-21357115 CAAGCAGACTTGAATTTTGGGGG - Intergenic
1022621158 7:31986008-31986030 CAGGTAGATGTGAATTTTGGTGG - Intronic
1024246213 7:47472252-47472274 CAGGTGGACATGAATTTCGGGGG + Intronic
1024638186 7:51308008-51308030 CAGGTAGAATTGGTTTTGGGTGG - Intronic
1024756031 7:52532482-52532504 CAGGTAAAGAGGAATTTGGGAGG - Intergenic
1025831494 7:65055091-65055113 CAGGTTGATGTGTAGTTGGGGGG - Intergenic
1025918632 7:65888978-65889000 CAGGTTGATGTGTAGTTGGGGGG - Intronic
1026656823 7:72263878-72263900 CAGGAGGACATTAATTTGGGGGG - Intronic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1029715644 7:102324022-102324044 CAGGTTAAAGTGAATTCGGGGGG + Intergenic
1030872562 7:114775046-114775068 CAGGTTGACGTGAAGGTGGTGGG + Intergenic
1030996872 7:116370384-116370406 TAGGTGGATGTGAATTTTGGGGG - Intronic
1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG + Intronic
1034070207 7:148177162-148177184 TAGGTGGACATGAATTTTGGGGG - Intronic
1034408584 7:150923685-150923707 CAGGTGGACATGGATTTTGGGGG - Intergenic
1037278274 8:17204752-17204774 CAGGTAAACGTGAGTTGTGGGGG - Intronic
1037464691 8:19148737-19148759 CAGGTAGACATGAATTTTGGAGG - Intergenic
1037627347 8:20619633-20619655 CAGGTGAACATGAATTTTGGTGG - Intergenic
1037660996 8:20926759-20926781 CAGGTGGACATGAATTTTGAGGG + Intergenic
1038482571 8:27911760-27911782 CTGGTAGACGTGAATTTAAGGGG - Intronic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1039726588 8:40223998-40224020 CAGGTAAACATGAATTATGGGGG + Intergenic
1040011193 8:42662434-42662456 TGGGTAGATATGAATTTGGGAGG + Intergenic
1040896510 8:52374118-52374140 TTGGTAGACGTGGATTTTGGTGG - Intronic
1041067181 8:54093242-54093264 CAGGTGGATGTGAATTTGGGGGG - Intronic
1041821065 8:62033380-62033402 CAGGTGGACATGAGTTTGAGGGG + Intergenic
1042998116 8:74723446-74723468 CAGACAGACCTGAATTTGGCTGG + Intronic
1043036798 8:75208959-75208981 CAATTAGACATGAGTTTGGGTGG + Intergenic
1044688985 8:94857845-94857867 CAGATACACATGAATTTTGGGGG + Intronic
1044773302 8:95660644-95660666 CATGTAGACATGAATTTTGGGGG - Intergenic
1044804399 8:95990440-95990462 CAGGTACAGGTGAAGCTGGGAGG - Intergenic
1045176886 8:99735272-99735294 CAGGTAGAAATGAATTTGGGAGG - Intronic
1045468421 8:102489834-102489856 TGGGTGGACGTGAATTTTGGGGG - Intergenic
1045486110 8:102633023-102633045 CTGGTGGACATGAATTTTGGAGG - Intergenic
1048743121 8:137584457-137584479 CGGATAGACATGAATTTTGGAGG - Intergenic
1049320952 8:141996049-141996071 TAGGTGGACATGAATTTTGGGGG + Intergenic
1049483618 8:142839866-142839888 AAGGAAGACTTGATTTTGGGAGG + Intronic
1050291744 9:4162344-4162366 CAGGTGGGCATTAATTTGGGGGG + Intronic
1050425594 9:5509581-5509603 TCAGTAGACATGAATTTGGGGGG - Intergenic
1050692444 9:8243043-8243065 CAGGTGGAGATGAATTTGGATGG + Intergenic
1051518479 9:17957620-17957642 TAAGTGGACATGAATTTGGGGGG - Intergenic
1051888131 9:21916179-21916201 CAGGTATACATGAATTTTGGAGG - Intronic
1055830112 9:80368258-80368280 CAGGTGAATATGAATTTGGGGGG - Intergenic
1056009151 9:82307965-82307987 CAGGCAGATGGGAATTTAGGGGG + Intergenic
1056255460 9:84795011-84795033 AAGGTAGACATTAATTTGGGGGG - Intronic
1057073280 9:92118885-92118907 GAGGCAGATGTGAATTTGGAAGG - Intergenic
1057792665 9:98134396-98134418 CAGGTGGACATGAGTTTTGGGGG - Intronic
1057860118 9:98634319-98634341 CAGGTGGACGTGAATTTCACGGG - Intronic
1058165235 9:101611483-101611505 TAGGTAGACATTAATTTTGGGGG + Intronic
1058782907 9:108356487-108356509 CTGGTAGACATGAATTTTGAGGG + Intergenic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061625491 9:131838619-131838641 CAGGAAGACGCTAATATGGGAGG - Intergenic
1062083898 9:134638696-134638718 CAGCCAGACGTGACTCTGGGAGG + Intergenic
1062250237 9:135590171-135590193 CAGATAGACGTGAGCTTGAGTGG - Intergenic
1062635898 9:137491586-137491608 TGGGTAGACATGAATTTGGGGGG - Intronic
1185923900 X:4125221-4125243 TAGGTGGATGTGAATTTTGGGGG - Intergenic
1186399460 X:9243225-9243247 CAGGTGGACATCAATTTTGGGGG + Intergenic
1187549644 X:20289069-20289091 TGGGTAGACATGAATTTTGGGGG + Intergenic
1193173461 X:78363832-78363854 CAGGTAGAAGAGAATTTGGGAGG + Intergenic
1194120142 X:89951718-89951740 CAGGAAGACTTGAAATGGGGAGG - Intergenic
1194647171 X:96471980-96472002 CAGGTGGATATGAATTTTGGGGG - Intergenic
1196168696 X:112564038-112564060 GAGGTAGAAGAGAATTTTGGTGG - Intergenic
1196283360 X:113850416-113850438 CAGGGAGACCTGACTTTGGATGG - Intergenic
1198677662 X:139147966-139147988 TGGGTAGACATGAATTTTGGTGG + Intronic
1200473003 Y:3609239-3609261 CAGGAAGACTTGAAATGGGGAGG - Intergenic