ID: 1119129107

View in Genome Browser
Species Human (GRCh38)
Location 14:72155337-72155359
Sequence CTCAGGGTACTCAGGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119129107_1119129116 29 Left 1119129107 14:72155337-72155359 CCACCATTCCTGAGTACCCTGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1119129116 14:72155389-72155411 AGAACTCAAGATGACCTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 159
1119129107_1119129112 -9 Left 1119129107 14:72155337-72155359 CCACCATTCCTGAGTACCCTGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1119129112 14:72155351-72155373 TACCCTGAGGGCTTGTTACCTGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119129107 Original CRISPR CTCAGGGTACTCAGGAATGG TGG (reversed) Intronic
901612354 1:10508861-10508883 CCCAGGGTACTGGGGAAGGGTGG + Intronic
902754980 1:18542980-18543002 CTCAGGGTGCACAGGCCTGGGGG + Intergenic
904431476 1:30467297-30467319 CTCAGGGTGATCTGGATTGGCGG + Intergenic
904447979 1:30589953-30589975 CTGAGGGGACTCACAAATGGAGG - Intergenic
904714750 1:32459033-32459055 CTCAGGGTACTCAGGAGATTAGG - Intergenic
905825612 1:41023972-41023994 CTCAGGGTACTTAGGTAAAGAGG + Intergenic
907340382 1:53731238-53731260 CTCAGGATCCTCAGGAATCTGGG - Intronic
908505980 1:64800762-64800784 CCCAGAGTACACAGGATTGGAGG - Intronic
909228077 1:73051219-73051241 CTCTGGGGACTCAGGAGGGGAGG + Intergenic
911368975 1:96973846-96973868 ATCGGGGAACTCAGGAATGCTGG - Intergenic
919878108 1:201885353-201885375 CTCAGGGTCCTATGGAGTGGGGG + Intergenic
921705163 1:218314140-218314162 CTCAGGGTCACCAGGCATGGTGG - Intronic
922616540 1:226964427-226964449 CTCAGGGTACAGGGAAATGGAGG - Intronic
922762654 1:228142269-228142291 CTCAGGGGACCCAGGAAGAGCGG + Intronic
1062963488 10:1590900-1590922 CTCAGGTTACTCAGTAAAAGGGG + Intronic
1065826270 10:29574679-29574701 CTCAGGCTGATCAGGAATGTGGG - Intronic
1065951102 10:30651939-30651961 CTCAGGCTGATCAGGAATGTGGG + Intergenic
1067482227 10:46609677-46609699 CTCAGATTCCTCAGGACTGGAGG + Intergenic
1067612522 10:47731991-47732013 CTCAGATTCCTCAGGACTGGAGG - Intergenic
1069844031 10:71358368-71358390 CTCAGGGTTCTGAGGATAGGAGG + Intronic
1070638094 10:78145382-78145404 CTCAGGGTCCTGAGGGGTGGTGG + Intergenic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1071627943 10:87192238-87192260 CTCAGATTCCTCAGGATTGGAGG - Intergenic
1072724800 10:97806062-97806084 CTTAGGTTATTCAGGAATGGGGG - Intergenic
1075802704 10:125162281-125162303 CGCGGGGCACTCAGGGATGGAGG - Intergenic
1076688981 10:132211254-132211276 CTCAGACTACTCAGGAATGAGGG + Intronic
1078899502 11:15628487-15628509 CTCCGTGCACCCAGGAATGGTGG - Intergenic
1080577029 11:33609378-33609400 CTCAGGGCACTGAGAACTGGCGG + Intronic
1082833087 11:57633918-57633940 CTCAGGAGAGTCAGAAATGGAGG - Intergenic
1083049737 11:59766512-59766534 CTCAGGGTACTCAGGGAGTGGGG - Intronic
1083259097 11:61513578-61513600 CTCATGGGACTCAGGAAAGTGGG + Intergenic
1084068422 11:66718724-66718746 GTCAGGGGATTCAAGAATGGTGG + Intronic
1085391239 11:76183382-76183404 ATCTTGGTACTCAGGAATTGTGG - Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1089625637 11:119749094-119749116 CTCAGAGGCCTCAGGAAGGGTGG - Intergenic
1091388960 12:113616-113638 CTCAGATTCCTCAGGAATCGAGG + Intronic
1097092743 12:56520227-56520249 CTCAGGGGACACAGGAAGGGTGG - Intergenic
1098299536 12:69039787-69039809 CCCATGGTACTTAGGAAAGGGGG - Intergenic
1100024511 12:90111546-90111568 CTCAGGTTACTCACTAATGTAGG - Intergenic
1101088977 12:101265425-101265447 CTCAGGGTAGTCAGACATGGTGG - Intergenic
1105467927 13:20664483-20664505 CTCACAGTGTTCAGGAATGGAGG - Intronic
1106487568 13:30185746-30185768 CTCAGTGTCCTCAGAACTGGAGG - Intergenic
1106754527 13:32809531-32809553 CTCAAGGTAGCCAGGCATGGTGG + Intergenic
1112382794 13:98908744-98908766 TTCAGTGTTCTCAGGAATGTGGG + Intronic
1112621363 13:101057242-101057264 TTAAGAGCACTCAGGAATGGAGG - Intronic
1117202290 14:53403648-53403670 CTCCTGGTACCCTGGAATGGGGG - Intergenic
1118711295 14:68521741-68521763 CTCTGGGGATTCAGAAATGGAGG - Intronic
1119129107 14:72155337-72155359 CTCAGGGTACTCAGGAATGGTGG - Intronic
1121123093 14:91388513-91388535 CTCAGGTCACTCAGGAAAAGAGG - Intronic
1124175737 15:27422363-27422385 CTCAGAATACTCAGTATTGGTGG - Intronic
1124175757 15:27422507-27422529 CTTAGAGTACTCAGTATTGGTGG - Intronic
1124933442 15:34146434-34146456 CACAGTGTAATAAGGAATGGAGG - Intronic
1125085091 15:35720705-35720727 CTCAGAGTACTCATGGAAGGAGG - Intergenic
1126385360 15:48088408-48088430 CTGAGGGGAATGAGGAATGGAGG - Intergenic
1126696652 15:51331467-51331489 CTCATGGAAATAAGGAATGGGGG + Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1129149906 15:73682077-73682099 CCCTGGGAACTCAGGAATGGAGG - Intergenic
1129582645 15:76829290-76829312 TTCTGGGGACTCAGGAAAGGTGG + Intronic
1130192530 15:81750409-81750431 TGCCGGGAACTCAGGAATGGAGG + Intergenic
1131010809 15:89016935-89016957 CTCAGTGTAGGCAGAAATGGCGG + Intergenic
1132825598 16:1903839-1903861 CTCAGAGGACTCCGGCATGGCGG - Intergenic
1134879505 16:17733055-17733077 CAAAGGGTACTTAGTAATGGTGG + Intergenic
1138333556 16:56234349-56234371 CTGAGGGTACTCATGGTTGGTGG + Intronic
1140908004 16:79426633-79426655 CTCAGGGGACTCACCAATGTTGG - Intergenic
1141768561 16:86074764-86074786 CTCAGGGGACTTGGGAAGGGTGG + Intergenic
1144280232 17:13719278-13719300 CACAGGATCATCAGGAATGGGGG + Intergenic
1144587253 17:16494677-16494699 CTCAAGGTACTCAGGGATAACGG - Intergenic
1144655408 17:17032215-17032237 CTCAGAGTCCACAGGAATGGGGG - Intergenic
1144730276 17:17522068-17522090 CCCAGTGACCTCAGGAATGGGGG - Intronic
1146003692 17:29147612-29147634 GTCAAGGTAGTCAGGCATGGTGG + Intronic
1147156819 17:38548180-38548202 CTCAGAATACTCAAGTATGGGGG + Intronic
1147600754 17:41743852-41743874 CTCAGGGAGCTGAGGATTGGAGG - Intergenic
1148382781 17:47211723-47211745 ATCTGGGTCCTCATGAATGGAGG + Intronic
1148456975 17:47816387-47816409 CTCAGAGTTGTCAAGAATGGGGG - Exonic
1148856240 17:50580630-50580652 CTCAGGCTCCTGAGGAAGGGCGG + Intronic
1149197915 17:54145105-54145127 CTCAGGGCAGCCAGGAATGGGGG - Intergenic
1150709467 17:67518218-67518240 CTTAGGGAACCCAGGAGTGGTGG - Intronic
1151337660 17:73449564-73449586 ATTAGGGTACCCAGGAATTGGGG - Intronic
1153001192 18:456895-456917 CTCAGGGTCCTCAGGTATATAGG - Intronic
1153013838 18:565552-565574 TGCTGGGTACTCAGGTATGGTGG - Intergenic
1153032175 18:724966-724988 CTTGGGTTACTGAGGAATGGTGG + Intronic
1156364729 18:36415061-36415083 GTGAGGGGACTCAGAAATGGAGG - Intronic
1157558686 18:48631121-48631143 CCCAGGGTACTGAGCATTGGAGG - Intronic
1159806305 18:72962140-72962162 CTTAGGGTACTCTGGCCTGGGGG - Intergenic
1160533898 18:79581048-79581070 GGCAGGGCACTCAGAAATGGGGG - Intergenic
1161099411 19:2413920-2413942 CACAGGGCTCTCAGGACTGGTGG - Exonic
1161345908 19:3768608-3768630 CTTAGGGGACTCTGGAGTGGAGG + Intergenic
1164589448 19:29498311-29498333 CTCAGGGGGCTGAGGACTGGTGG + Intergenic
927275348 2:21257786-21257808 CTCAGGGAAGTCGGGAAGGGAGG - Intergenic
927508681 2:23630773-23630795 CTCAGGGCAGCCAGGCATGGTGG - Intronic
927786847 2:25980649-25980671 CTCAGGGTACCCAGGCGGGGCGG + Exonic
928441297 2:31294481-31294503 CTCAGAATACTCAAGAATTGGGG - Intergenic
931426668 2:62177999-62178021 CTCAGGAAAGGCAGGAATGGTGG + Intergenic
931714236 2:65016405-65016427 CACAGGGTACTCATCAGTGGGGG - Intronic
933009687 2:77044202-77044224 TTCAGGGTACTCAGGTATGAAGG - Intronic
934163334 2:89272617-89272639 CTCAGGGCACGCAGGGAGGGTGG + Intergenic
934561204 2:95314465-95314487 CTCAGATCCCTCAGGAATGGGGG - Intronic
934650918 2:96091046-96091068 CTCAGGGTGGTCAGGAAGAGGGG + Intergenic
934732689 2:96669446-96669468 ATGAGGTTATTCAGGAATGGCGG + Intergenic
934850831 2:97700044-97700066 ATCAGGGAAATCAGGCATGGAGG - Intergenic
935234664 2:101128404-101128426 CTTAGGGTACTCAGGAAGCCAGG + Intronic
937305782 2:120869774-120869796 CTCAGGGTACTAAGGAAGGAAGG + Intronic
942947296 2:181684183-181684205 CTCAGGGGCCGCAGGAACGGAGG + Intergenic
944588312 2:201192838-201192860 CTCAAGTTGCTCAGGAATGTAGG - Intronic
947143807 2:227045049-227045071 CTCAGGGTAGTCCAAAATGGGGG - Intronic
948505514 2:238424904-238424926 CTCAGGGTCCTGAGAAATGGGGG + Intergenic
1169142182 20:3232946-3232968 CTCAGGGATCTCAGACATGGCGG - Intronic
1171326297 20:24296513-24296535 TCCAGGGTGCTCAGGCATGGAGG - Intergenic
1171975791 20:31593879-31593901 CTCAGGGCACTCCTGACTGGTGG + Intergenic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172202466 20:33136149-33136171 CTCAGGTTGCTGAGGGATGGAGG - Intergenic
1172425359 20:34852118-34852140 CTCAGGGTCCCCAGGAAAGCAGG + Intronic
1174477160 20:50803846-50803868 ATCAGAATACTCAGGGATGGGGG - Intronic
1174571453 20:51504698-51504720 CTAAGGTTACACAGGAATTGGGG - Intronic
1176025307 20:62982518-62982540 CTCCGGGTTCTCAGGCCTGGGGG + Intergenic
1178701263 21:34835374-34835396 CCCAGGGGGCTCAGGACTGGTGG + Intronic
1179422689 21:41249094-41249116 CTCAGGGGACTCAGGACTAGTGG + Intronic
1181558646 22:23686781-23686803 CTCAGGGTTCACAGGCATGCAGG - Intergenic
1184529158 22:45043420-45043442 CTGGGGGGACTCAGGACTGGGGG + Intergenic
950515080 3:13459925-13459947 TCCAGGGCTCTCAGGAATGGAGG + Intergenic
951801482 3:26601437-26601459 CACAGGGTAAGCAGGATTGGAGG + Intergenic
952203517 3:31155877-31155899 CTTAAGGTAATCAGGAATTGTGG + Intergenic
954285616 3:49616904-49616926 CACAGGGTACTAAGGATTGGTGG + Intronic
956742861 3:72288682-72288704 CTCATGGTAGTCAGCAGTGGAGG - Intergenic
958707462 3:97673751-97673773 CTGAGGGCATTGAGGAATGGAGG + Intronic
959141606 3:102492569-102492591 CTCTGGGGGCTCAGGCATGGTGG + Intergenic
959329506 3:104985498-104985520 CACAGGGTACCCAGGAAGTGGGG - Intergenic
962996040 3:140629600-140629622 CTCATCCCACTCAGGAATGGAGG + Intergenic
965623280 3:170661933-170661955 CTTTGGGGACTCAGGAAGGGAGG + Intronic
967849209 3:194070098-194070120 CTCAGGAAACTCCGGAAGGGAGG + Intergenic
968341255 3:197957816-197957838 CTCGGGGTATTCAGGGATAGAGG + Intronic
969475522 4:7420549-7420571 CTCATGGGACTCAGGAAGGCAGG + Intronic
972142526 4:35978120-35978142 CTCAGGGCATTCTGGAGTGGGGG - Intronic
972299744 4:37773464-37773486 CTCAAGGTTCCCAGGAAAGGGGG - Intergenic
979674804 4:123398776-123398798 CTCCGGGTAATCGGGGATGGAGG - Intronic
985434413 4:189915268-189915290 CTCAGGGTAGGCAGGTAAGGTGG - Intergenic
985629794 5:1008562-1008584 CTCAGGCTCCTCTGGAATTGGGG + Intergenic
986276486 5:6279617-6279639 CACAGGGCACACAGGAGTGGGGG - Intergenic
993669144 5:90739781-90739803 CTCAGGGTAGGCAGGACTGCAGG + Intronic
994550326 5:101226414-101226436 CTTTGGGGACTCAGGGATGGAGG - Intergenic
997823530 5:137086625-137086647 CTCAGTGGATGCAGGAATGGTGG - Intronic
998259938 5:140622441-140622463 GTCAGGATACACAGGAGTGGAGG + Intergenic
1000351274 5:160354840-160354862 CCCAGGGCCCTCAGGAATGATGG - Exonic
1001380971 5:171306521-171306543 CTTAGGCAGCTCAGGAATGGGGG - Exonic
1001567350 5:172708073-172708095 CTCGGAGTACACAGGAGTGGAGG - Intergenic
1003411716 6:5869877-5869899 CTCAGGGTTCACAGCTATGGTGG + Intergenic
1007915077 6:45553655-45553677 CTCAGGGTCCACAGCAATGGTGG - Intronic
1011124038 6:83987133-83987155 ACCAGGGTAATCAGGGATGGGGG + Intergenic
1013961946 6:115911518-115911540 CTCATGGTACTGAGCAGTGGGGG - Intergenic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1016781775 6:147967012-147967034 CTCTGGTTAGTCAGGAGTGGGGG + Intergenic
1017961618 6:159227302-159227324 CTAAGGGTAGGAAGGAATGGAGG + Intronic
1018756093 6:166850946-166850968 CACAGTGTACTCAACAATGGGGG - Intronic
1019127250 6:169849027-169849049 CTCCGGCTTCTCAGCAATGGTGG + Intergenic
1020001552 7:4759140-4759162 CTCAGGGTCGTGTGGAATGGGGG - Exonic
1020329422 7:7002592-7002614 CTCAGGGAACACAGGTTTGGGGG + Intergenic
1024932264 7:54676025-54676047 CTCAGGGAACACAGGGTTGGGGG + Intergenic
1026204129 7:68240800-68240822 CTCAGTGTACTTTGTAATGGGGG - Intergenic
1028899167 7:96076327-96076349 TTCAGGGTAGTCAAGAATGGGGG - Intronic
1031206346 7:118762984-118763006 CACAGGGTACCGAGGGATGGTGG + Intergenic
1034201813 7:149287468-149287490 GTCAGGATTCTCCGGAATGGGGG - Intronic
1035055333 7:156031479-156031501 CTCAGTGGACTCAGGAAAGTAGG - Intergenic
1039791746 8:40881880-40881902 CTCAGGCTTCTGAGGAGTGGCGG - Intronic
1040869091 8:52081481-52081503 TTCAGGGAACACAGGAATTGCGG + Intergenic
1041355429 8:56994166-56994188 CTCAGATTATTGAGGAATGGAGG + Intergenic
1048802669 8:138208137-138208159 CCCAGGGTGCTCAGGAATTGAGG + Intronic
1050237460 9:3596874-3596896 CTCAGGGCAGCCAGGCATGGTGG - Intergenic
1051164111 9:14243446-14243468 CTCAAGGGACTTAGGAATCGGGG - Intronic
1051662081 9:19435092-19435114 CTAAGGGTAGGCAGGAATGATGG - Intronic
1057569045 9:96189816-96189838 CTCAGTGTACTCACAAATTGAGG + Intergenic
1057694221 9:97311964-97311986 CTCAGGGCTCTCTGGAATTGGGG + Intronic
1057864303 9:98667074-98667096 CTCAGGGTCCTCAGGAATGAGGG + Intronic
1057871826 9:98723717-98723739 CTCAGGGCACACAGGCCTGGGGG + Intergenic
1057946421 9:99333525-99333547 CTGGGGGTACTCAGGGATGCTGG + Intergenic
1058349921 9:104009441-104009463 GTCAGGGAACCCAGGATTGGAGG - Intergenic
1203746327 Un_GL000218v1:42403-42425 CTCAGTGCACCCAGGAATGTTGG + Intergenic
1186238796 X:7544202-7544224 CTCACTGTAGTCAGGAAGGGAGG - Intergenic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1190873676 X:54445126-54445148 CTGAGGGAACCCAGGACTGGAGG - Exonic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1191101166 X:56730152-56730174 TTCAAGGTATTCAGGAAGGGTGG + Intergenic
1191219722 X:57975470-57975492 CTGATGGTACTAAGGAATGCAGG - Intergenic
1194267357 X:91771420-91771442 CTCAGGGTCCTGAGGAGGGGAGG - Intergenic
1196016468 X:110944933-110944955 TTCAGGGAGCTCAGGGATGGGGG + Intronic
1198324231 X:135551611-135551633 CTCATGGTACAAAGGAATGAAGG + Intronic
1199340540 X:146671883-146671905 CTCAGAGCACTCAGGAATGAAGG + Intergenic