ID: 1119130515

View in Genome Browser
Species Human (GRCh38)
Location 14:72168329-72168351
Sequence GGCTCAGGAAAGGCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119130507_1119130515 20 Left 1119130507 14:72168286-72168308 CCACAGGCCTCGGAATGTGGCAA 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225
1119130503_1119130515 23 Left 1119130503 14:72168283-72168305 CCCCCACAGGCCTCGGAATGTGG 0: 1
1: 0
2: 0
3: 23
4: 619
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225
1119130505_1119130515 22 Left 1119130505 14:72168284-72168306 CCCCACAGGCCTCGGAATGTGGC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225
1119130506_1119130515 21 Left 1119130506 14:72168285-72168307 CCCACAGGCCTCGGAATGTGGCA 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225
1119130509_1119130515 13 Left 1119130509 14:72168293-72168315 CCTCGGAATGTGGCAAGGTCTAC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225
1119130513_1119130515 -9 Left 1119130513 14:72168315-72168337 CCATTAGGAATGTAGGCTCAGGA 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119130515 Original CRISPR GGCTCAGGAAAGGCTCCTTC AGG Intronic
901656520 1:10772829-10772851 GGCTCAGTAAGGGCTGCTCCTGG + Intronic
901910251 1:12451580-12451602 GTCTCTGCAAATGCTCCTTCTGG + Intronic
902622902 1:17660688-17660710 GTCTCAGCAAAGGCACCTTCAGG - Intronic
903295187 1:22339195-22339217 GGCTCCAGGAAGGCTCCTTGGGG + Intergenic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
903862693 1:26374456-26374478 GGCTGAGGACAGACTCCCTCAGG + Intronic
905024986 1:34843810-34843832 GACTCAGGAAAGGCTCTCCCAGG + Intronic
906407812 1:45556011-45556033 GGCAAAGGAAAGGTCCCTTCAGG - Intronic
907357258 1:53886532-53886554 GGGTCATGAAAGGCTTCTCCGGG - Intronic
908902006 1:68966396-68966418 GACACAGGAAAAGCTCCTTAGGG + Intergenic
909472365 1:76042909-76042931 GGATCAGGCAAGTTTCCTTCAGG + Intergenic
909698338 1:78491763-78491785 GGCGCAGGAAAGGCTGGCTCCGG + Intronic
910916942 1:92299226-92299248 CGCTCCTGAAAGGCTGCTTCAGG + Intronic
912265202 1:108150419-108150441 GGCTCAGTTAAGTCTCCTTTAGG - Intronic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
915534213 1:156525065-156525087 GGCTCAGGAAAAGAACCTGCAGG + Intergenic
916203631 1:162294997-162295019 GGCTCAGGCAGGGCTCCCGCTGG - Intronic
916484074 1:165242366-165242388 GGCTAAGGCAAGGCTCTTTTAGG - Intronic
916839875 1:168588629-168588651 GACTTAGGAAAGGGTCCTTGAGG + Intergenic
917515923 1:175708292-175708314 GGTTCAGGGAAGGCTTCTCCTGG - Intronic
918344859 1:183598166-183598188 GGCTCAGGAAAGGCTGGAACCGG - Intronic
921130845 1:212218305-212218327 GAGTCAGGAAAGGCTCCCTAAGG - Intergenic
921765784 1:218971525-218971547 GGTTCTGGAAAGACTCCCTCAGG + Intergenic
922746210 1:228045617-228045639 GGTTCAGCAAAGGCCCCTCCAGG + Intronic
1063672362 10:8109547-8109569 GGTTCCTGAAAGGCACCTTCTGG - Intergenic
1066452594 10:35544812-35544834 TGCTCAGAACAGGCTGCTTCTGG - Intronic
1067978696 10:51056254-51056276 GTTTCAGGGAAGGCACCTTCAGG + Intronic
1068754536 10:60636616-60636638 AGCTCAAGAAAGACTGCTTCAGG + Intronic
1070541065 10:77415713-77415735 TCCTCAGCAAAGGCTCCTGCAGG + Intronic
1070744976 10:78928204-78928226 GGTTCATGAAATGCTTCTTCTGG + Intergenic
1070973716 10:80588358-80588380 TCCTCAGGAAAGGATCCCTCAGG - Intronic
1072218769 10:93310000-93310022 GGCCAAGGAAGGGCTCCTACCGG + Exonic
1072715319 10:97748275-97748297 GGCTCAGGAAGGCCTCCAGCTGG - Exonic
1072886121 10:99275802-99275824 AGCTCAGAGCAGGCTCCTTCAGG + Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1075912728 10:126139773-126139795 GGCTTAGGAAAGGATGCATCAGG + Intronic
1076731036 10:132439009-132439031 GGCTCTGGAAAGGCACCGTCAGG - Intergenic
1076769067 10:132653240-132653262 GCCTCAGCAAAACCTCCTTCAGG + Intronic
1077411694 11:2406719-2406741 TGCTCAGGAAGTTCTCCTTCTGG + Exonic
1079951001 11:26804298-26804320 GGCTGAGGAGAGCCTCTTTCAGG - Intergenic
1080781316 11:35432477-35432499 GGCTCAGGAGATGCTCGTCCCGG + Exonic
1081079660 11:38726113-38726135 GGCACATGCAAGGCTCCTACTGG - Intergenic
1081616541 11:44594785-44594807 GGCTCTGGAAAGGCTCAGGCTGG - Intronic
1083682749 11:64358922-64358944 GGCTCAGGGATGGCTCCCACGGG + Intergenic
1085244630 11:75090098-75090120 TGCTTTGGAAAGGCTTCTTCTGG + Intergenic
1085769193 11:79309948-79309970 GGGTCAGGACAGGCTCCCACAGG - Intronic
1086989480 11:93287501-93287523 GCCTAAGGAAAGGCTCCTGGAGG + Intergenic
1089116728 11:116101221-116101243 GGCTCAGCAAAGGCTCAGGCAGG + Intergenic
1089376526 11:117999023-117999045 GGCTCAGGCTGGGCTCCTGCAGG - Exonic
1091649836 12:2301741-2301763 GGCAGATGGAAGGCTCCTTCAGG - Intronic
1092224069 12:6735111-6735133 GGCTCTGAAAAGGCTACTGCAGG + Intergenic
1092896332 12:13014293-13014315 GGCTCAGGAAAATTTTCTTCAGG - Intergenic
1093270948 12:17060620-17060642 AGCTCAGGAAGGTCTCTTTCAGG + Intergenic
1095484998 12:42675673-42675695 GCCTGAGGATAGACTCCTTCAGG - Intergenic
1096121678 12:49092778-49092800 GGCTCAGGAGGGGCTCCGGCAGG - Intronic
1100436245 12:94573886-94573908 GGATCAGGAAAGGCTTCCCCAGG - Intronic
1101981064 12:109407188-109407210 GGATCAGAGAAGGCTCCTTGAGG - Intronic
1102602138 12:114039440-114039462 AGCTGAGGGAAGGCTCCTCCTGG + Intergenic
1103009918 12:117450180-117450202 GGCTCTGGAGAGTCTCATTCTGG + Intronic
1103054779 12:117810051-117810073 GCCTCAGCAAAGGCTCATTCGGG - Intronic
1106485775 13:30171394-30171416 GTCTCAGGCAAGGCTGCTGCTGG - Intergenic
1106506429 13:30374651-30374673 AGCTCAGGAAATCCTCCCTCTGG - Intergenic
1106832795 13:33603044-33603066 TCCTCAGGAAAGGATCCCTCGGG + Intergenic
1110166814 13:72452372-72452394 GGCTCAGGTGGGGCCCCTTCAGG + Intergenic
1114152856 14:20064277-20064299 GGCCAAGAAAAGGCCCCTTCAGG - Intergenic
1114206643 14:20578440-20578462 AGCTCTGGAAAGTCTCCTGCTGG - Intergenic
1115988152 14:39123988-39124010 GGCTCAGGCAATCCTCCTGCTGG + Intronic
1118838080 14:69490707-69490729 TGCTCAGGAAATGCTCATCCTGG - Intronic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1122034166 14:98935475-98935497 GGGTTAGGGAAGGCTTCTTCAGG + Intergenic
1122152039 14:99730668-99730690 GGCTCAGAAAAGGCTGCCACTGG - Intergenic
1122267931 14:100555300-100555322 GGCACAGGAGAGGCTCCGCCAGG - Intronic
1122602468 14:102928537-102928559 GGCTCTGGAAAGGCATGTTCAGG + Intronic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1122790908 14:104183802-104183824 GGCGCAGGAAAGGATCTTGCTGG + Intergenic
1123033260 14:105461043-105461065 GGTGCAGGACAGGCTCCCTCAGG - Intronic
1124147017 15:27137159-27137181 GGCTCAGAAAAGGCTTCCTGGGG - Intronic
1124808730 15:32912595-32912617 GGCTCAAGGAAGGCTTCTTTGGG + Intronic
1124887086 15:33697194-33697216 GGTGCAGGAAAGGGACCTTCAGG + Intronic
1125059317 15:35400060-35400082 GGCTCTGGAAAAGATTCTTCAGG + Intronic
1125349988 15:38756331-38756353 GACTCAGGAGAGGCTGCTACAGG + Intergenic
1125952875 15:43768501-43768523 GGCTCTGGAGAGGTTCCTGCAGG + Exonic
1126790239 15:52214443-52214465 GGCTAACGAAAGGATCCTTTGGG - Intronic
1127922103 15:63502532-63502554 GGGTCGGGAAAGACTCCCTCAGG + Intergenic
1128242372 15:66109747-66109769 GGGTCAAGAAAGACCCCTTCAGG - Intronic
1129868084 15:78924124-78924146 GGGTCAGGGAAGGCTCCCTGTGG + Intronic
1130770508 15:86918915-86918937 GGTTCAGGAAATGATTCTTCTGG + Intronic
1131170422 15:90174433-90174455 GGCTCAGAAAAGGGTACCTCTGG - Intronic
1132045617 15:98560703-98560725 GGATGAGGAAAGGCTTCTACTGG + Intergenic
1132607260 16:798775-798797 GGTTCAGGAAGGGGTCCTTGGGG + Exonic
1132863595 16:2083175-2083197 GGCACAGGAAATGCTGCTTTGGG + Intronic
1132877003 16:2144410-2144432 GGATCAGGACAGTCTCTTTCTGG - Intronic
1134538000 16:15041899-15041921 GGCTCAGCCCAGGCTCCTTCGGG - Intronic
1135590130 16:23699137-23699159 GGCTCAGGAAATCCTGCTGCAGG + Intronic
1138348255 16:56332912-56332934 GGCTTGGGAGAGGCTCCTTCTGG + Intronic
1139579097 16:67861619-67861641 GGCTGAGGCCAGGCTCCTTGAGG - Intronic
1139721514 16:68859746-68859768 GGCTCTGGAAAGCCTCCCCCAGG - Intronic
1140038020 16:71385687-71385709 GGCACAGGAGAGGCTTCTGCAGG + Intronic
1141030208 16:80581134-80581156 GGATCAGGGAAGGCTCCTGGCGG + Intergenic
1142271614 16:89092693-89092715 AGCTCAGGAAAGGGCACTTCAGG - Intronic
1142330571 16:89449953-89449975 TGCTTAGGAAGGGCTCCCTCAGG - Intronic
1142365290 16:89646866-89646888 GGGGCAGGAAAGGCTCCTGGTGG - Intronic
1143611291 17:8019358-8019380 GGCTTAGGCAGGGCTCCTCCCGG + Intronic
1144342794 17:14324075-14324097 GGGTCCAGAAAGGCTCATTCTGG - Intronic
1144773236 17:17771017-17771039 GGCTCAGGAAAGGGGGCTTCAGG + Intronic
1146910820 17:36647335-36647357 GTCACAGGAAAGGCGACTTCAGG - Intergenic
1151675905 17:75597210-75597232 GGCTCATGAAGGGCTTCTGCAGG + Intergenic
1152035124 17:77867622-77867644 ACCACAGGAAAGGCTCCTGCCGG + Intergenic
1152856528 17:82667841-82667863 AGCTCAGGAAAGCCTCGTACTGG - Intronic
1154151353 18:11908779-11908801 GGCCCAGGAAAGGCCCGTTGCGG + Exonic
1160166877 18:76521518-76521540 GGCTCTTGAAAGCCTCCTTGAGG - Intergenic
1162153133 19:8659518-8659540 GGGTCAGGATACGCTCCATCTGG + Intergenic
1162419047 19:10555390-10555412 GGCTCAGGGAAGGCCCCGCCTGG - Intronic
1163128636 19:15258210-15258232 GGCTCAGGAAACACTCCTTGAGG + Intronic
1164551088 19:29212965-29212987 GGCTGAGGAAGGGCCGCTTCAGG + Exonic
1164645512 19:29856327-29856349 GGCTCATCAAAGGCGCCGTCAGG - Intergenic
1164667614 19:30051918-30051940 GCCTCAGAGAAGGCTCCTGCAGG + Intergenic
1166076283 19:40415403-40415425 AACTCAGGAAAGGATCCTGCAGG + Intergenic
926040216 2:9666772-9666794 GGGTGAGGACAGGTTCCTTCGGG + Intergenic
926897920 2:17714952-17714974 TGCTGATGAAAGGGTCCTTCAGG - Exonic
927640585 2:24843025-24843047 GGCTCGACCAAGGCTCCTTCAGG - Intronic
931919633 2:66999618-66999640 GGGTTAGGACAGGCTCCTTAGGG - Intergenic
932362435 2:71120093-71120115 GTCCCAGAAAAGGGTCCTTCTGG + Intronic
934474814 2:94586960-94586982 GGCTCAGGGAGGGCTTCCTCAGG + Intergenic
935223028 2:101031288-101031310 GGCTCAGGAAAGGGTACACCTGG + Intronic
937524568 2:122752245-122752267 AGTTCAGGGAAGGCTTCTTCAGG + Intergenic
939461573 2:142503270-142503292 GGCTCAGGAAATGCTGGGTCTGG - Intergenic
939624849 2:144463981-144464003 GGCTCAGGGAAGGCTTCATGGGG + Intronic
944850304 2:203712451-203712473 GTCTCAGAGAAGGCTTCTTCAGG - Intronic
946403387 2:219480526-219480548 GGCACAGGAGTGGCTTCTTCAGG - Intronic
947372876 2:229466363-229466385 GGCAGAGGAAAGACTCTTTCAGG - Intronic
948781615 2:240325006-240325028 CTCTAGGGAAAGGCTCCTTCTGG + Intergenic
1169068616 20:2708193-2708215 GGCTGAGGAGAGGGTCCTTGAGG + Intronic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1169357438 20:4919465-4919487 GGGAGAGGTAAGGCTCCTTCTGG - Intronic
1173975849 20:47186051-47186073 GGGTCAGGAAAGGCCTCTCCAGG - Intronic
1174037249 20:47675791-47675813 GCCTCAGAAAAGCCTCCTTCAGG + Intronic
1175480702 20:59308745-59308767 GGCCCAGGAAGGGCTTCTGCAGG - Intronic
1175859408 20:62142606-62142628 GGCCCCGGGAAGGCTCCTCCCGG + Intronic
1178175790 21:30096834-30096856 GGCTAAGGAAGGGTTCCTTGGGG + Intergenic
1178806919 21:35846901-35846923 GGATCAGAAAAGGCTCATTTTGG - Intronic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1180046926 21:45310842-45310864 GGCTCTGAGAAGGCTCCTCCAGG + Intergenic
1180711484 22:17842362-17842384 TTCTCAGGCAAGGCTGCTTCAGG - Intronic
1180906242 22:19413951-19413973 AGCTAAGGAAAGGGACCTTCTGG + Intronic
1181280161 22:21714072-21714094 GGCACAGGACAGGCTGCTGCCGG - Intronic
1181534551 22:23534699-23534721 GGCTCAGGAAGGCCTCTTTGAGG + Intergenic
1182127123 22:27824193-27824215 GGCTCAGGGGAGGCTCATGCGGG + Intergenic
1182252108 22:29009097-29009119 GAATCAGGACAGGATCCTTCAGG + Intronic
1183765984 22:39875422-39875444 GGCTGAGGAAGGGCCGCTTCAGG - Intronic
950272987 3:11634096-11634118 AGCTCAGGAGAGGCTGCTGCTGG - Intronic
952627021 3:35418067-35418089 GGTTCAAGAAAGGCTGCCTCAGG + Intergenic
954291258 3:49651167-49651189 GGCTCAGGACAGGTGCCTTGGGG + Intronic
954444121 3:50537464-50537486 GGCACAGGGAAGGCACCTCCTGG + Intergenic
954939015 3:54353848-54353870 GCCTCAGGAAAGGCCCCTCAGGG + Intronic
957071482 3:75571025-75571047 GGCCCAGGAAAAGCTGCTTGGGG - Intergenic
959082488 3:101816821-101816843 GGCTCAGGAACTTTTCCTTCTGG + Exonic
960534644 3:118802711-118802733 GGCACAGGTAAGGGACCTTCAGG - Intergenic
963798320 3:149653574-149653596 TGCTCAGGAAAGGTGCCTTCAGG + Intronic
964317955 3:155464164-155464186 TGATCAGGAAAGGCTCCCTAGGG + Intronic
965477571 3:169176275-169176297 GGATCAGGGAAGTCTCCCTCAGG + Intronic
965701240 3:171460640-171460662 GGTTCAGGAACAGCCCCTTCGGG - Intergenic
967801868 3:193670816-193670838 GTCTCAGGAGAGGCTCTTCCAGG + Intronic
968947323 4:3671879-3671901 GGCAGAGGAAAGGCCCCTCCTGG - Intergenic
969220817 4:5757287-5757309 GGCTCAGCAATGCCTCCTACAGG - Intronic
971220267 4:24699219-24699241 GGGACAGGAAAGGAGCCTTCAGG + Intergenic
971451153 4:26803322-26803344 GGCTCAGGAAATAATCCTCCCGG - Intergenic
971562206 4:28093941-28093963 GGCTCAGGAAACCCACCTTTTGG - Intergenic
973271364 4:48266398-48266420 GGCTCAGGAACAGCTTCTTGAGG + Intronic
974556262 4:63452629-63452651 AGCTCAGGAAAAGCACTTTCAGG - Intergenic
975714787 4:77195245-77195267 GGGGCAGGGAAGGCTCCTGCAGG + Intronic
977067593 4:92337815-92337837 GGCTCAGGAAAGACTTCTTCTGG - Intronic
977283443 4:95070589-95070611 GGCTCAGGAAAGGATACTGTAGG + Intronic
981577769 4:146222958-146222980 GGCCCAGGAAAAGCTTCTTGAGG + Intergenic
983556008 4:169059774-169059796 GTTCCATGAAAGGCTCCTTCGGG + Intergenic
984295644 4:177851624-177851646 GGTTCAGGAAAGGCTTTTCCTGG - Intronic
988485516 5:31665365-31665387 GGTCCAGGAAAGGCTTCTTGGGG - Intronic
990905386 5:60797519-60797541 GGCACAGAAAAGCATCCTTCAGG + Intronic
993599849 5:89908358-89908380 GATTCAGGAAAGGCTCTTCCCGG - Intergenic
994328396 5:98476517-98476539 GGTTCAGGAAATACTTCTTCTGG + Intergenic
997626083 5:135331380-135331402 GGCTCAGGGAGGGCTTCTTGGGG - Intronic
998585044 5:143418666-143418688 GGGTCAGGGAAGGCTCCTGGAGG + Intronic
1000305772 5:159993308-159993330 GGCTCAGGAAAAGCTGCCTGGGG + Intergenic
1003338307 6:5195742-5195764 GTCTCAGAAATGGCTCCTTCAGG + Intronic
1006590272 6:35150036-35150058 CGGTCAGGAAAGGCTGCTTTCGG - Intergenic
1006777800 6:36609736-36609758 GGCTTAAGAAAGGCTCCTTTGGG + Intergenic
1011090489 6:83592978-83593000 GGCACAGGAGAGGCCCCTTGTGG + Exonic
1012423960 6:99094300-99094322 AGCTCTGGAATGCCTCCTTCAGG - Intergenic
1012503198 6:99913663-99913685 GGTTCAAGGAAGGCTCCTTGAGG + Intergenic
1012864088 6:104596656-104596678 GGGTCAGGAAAGGCTTCTTTGGG - Intergenic
1016290344 6:142522158-142522180 GGCACAGGACAGTCTCCCTCGGG + Intergenic
1018033273 6:159861201-159861223 GCCTCAAGAGAGGCTCATTCTGG + Intergenic
1018629933 6:165813348-165813370 TTCTCAGTAAATGCTCCTTCCGG - Intronic
1018773979 6:166998058-166998080 GCCACAGGAAAGGCTCCTTCGGG - Intergenic
1019334552 7:476837-476859 GTTGCAGGACAGGCTCCTTCTGG - Intergenic
1019556363 7:1633494-1633516 GGCCCAGGTAAGGCTCCCACAGG - Intergenic
1019646959 7:2135991-2136013 GGCAGAGGGAAAGCTCCTTCAGG + Intronic
1020115371 7:5473243-5473265 GACTCAGCAATGCCTCCTTCTGG - Intronic
1020168328 7:5824982-5825004 GTCATAGGAAAAGCTCCTTCAGG - Intergenic
1020722807 7:11769529-11769551 GTCTCAAGAAAGGGTCCTTAGGG + Intronic
1020910790 7:14127905-14127927 TGCTCATGAAAGGCTCCATTAGG + Intergenic
1021459446 7:20869537-20869559 GGCTAAGGAGAAGCTCCTGCAGG + Intergenic
1022127370 7:27371623-27371645 GGCTCTGGAAGGGCTCATCCAGG - Intergenic
1023131797 7:37011011-37011033 GGCTCAGGACAGGCAGCTCCAGG - Intronic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1024639638 7:51318040-51318062 AGGCCAGGAAAGGCTCCTTGGGG - Intergenic
1027666741 7:81049456-81049478 TCCTCAGGAAAGGATCCCTCTGG + Intergenic
1028155313 7:87422716-87422738 TGCTCAGGAAAGGCCCCTCTGGG - Intronic
1030236976 7:107274523-107274545 GGCCCAGGATAGGCTGCTGCAGG + Intronic
1031126272 7:117776658-117776680 GGCTCAGGCATGGCCCATTCTGG - Intronic
1032457343 7:132083428-132083450 GCCTGAGGAAAGGCACGTTCTGG + Intergenic
1032844692 7:135742439-135742461 GTCTCAGGAAAGGCTTCCTGGGG - Intronic
1035470488 7:159106105-159106127 GGCTCAGGATAGGGGCCTGCAGG - Intronic
1037744253 8:21630434-21630456 GGCTCAGGAATGGCTGGTTGGGG + Intergenic
1039957766 8:42220407-42220429 GGATCAGGAAAAGCTCCATCAGG - Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1041501333 8:58542098-58542120 GGCTCTGGAAAGGGAGCTTCTGG + Intergenic
1045799157 8:106081600-106081622 GACTCAGGAATCGCTGCTTCTGG - Intergenic
1046795398 8:118365863-118365885 GGATCAGGAAAATCTCCTTCAGG - Intronic
1047730875 8:127727065-127727087 GGATCATGAAAAGCTCCTACAGG + Intergenic
1048439803 8:134451446-134451468 GGCTCATGGAAGCCTCCTTCTGG - Intergenic
1048785841 8:138049362-138049384 GGGTCAGGAAAGGCTTCCTCAGG + Intergenic
1049214367 8:141401009-141401031 GGGTGAGGACAGGCTCCTCCTGG + Intronic
1050199714 9:3131417-3131439 AGGTCAGGGAAGGCTGCTTCCGG - Intergenic
1052855236 9:33402799-33402821 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1053683248 9:40499141-40499163 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1053933229 9:43127457-43127479 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1054280466 9:63125787-63125809 GGCTCAGGGAGGGCTTCCTCAGG + Intergenic
1054296353 9:63334639-63334661 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1054394370 9:64639144-64639166 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1054429019 9:65144343-65144365 GGCTCAGGGAGGGCTTCCTCAGG - Intergenic
1054501365 9:65877192-65877214 GGCTCAGGGAGGGCTTCCTCAGG + Intergenic
1057294337 9:93826699-93826721 GGCAGAGGAAAGGCTCAATCAGG + Intergenic
1057793944 9:98142678-98142700 GACTCAGGGAAGGCGCCTTAGGG + Intronic
1060243130 9:121921903-121921925 GGCTCAGAGAAGGGTTCTTCAGG - Intronic
1060802469 9:126553457-126553479 GGATCAGGGAAGGCTCCTGGGGG + Intergenic
1060999234 9:127893515-127893537 GGCTCAGGGAAGGCTGCCTTGGG - Intronic
1061587123 9:131576413-131576435 GGCTCTAGAATTGCTCCTTCGGG - Intergenic
1061723006 9:132565273-132565295 GGCTCAGGAAGGGCTCTCTGGGG - Intronic
1062730079 9:138103751-138103773 GACTCAGGAAAGTCTTCCTCAGG - Intronic
1189226566 X:39418362-39418384 GACTCAGGAAAGTTTCCTTGAGG + Intergenic
1190462837 X:50695809-50695831 TTCTCATCAAAGGCTCCTTCCGG - Exonic
1192791761 X:74388859-74388881 GACTCTGGTAAGGCTCCTTGAGG - Intergenic
1196098378 X:111823734-111823756 GGCTCCTTAAAGGATCCTTCTGG + Intronic
1199544478 X:148993293-148993315 GGCTCAGAAAAGATTCTTTCAGG - Exonic