ID: 1119132582

View in Genome Browser
Species Human (GRCh38)
Location 14:72188122-72188144
Sequence AACACTCATATTTCTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119132582_1119132583 -5 Left 1119132582 14:72188122-72188144 CCTTGGGAAGAAATATGAGTGTT 0: 1
1: 0
2: 0
3: 28
4: 248
Right 1119132583 14:72188140-72188162 GTGTTAGATAAGCTTCGTCCAGG 0: 1
1: 4
2: 59
3: 158
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119132582 Original CRISPR AACACTCATATTTCTTCCCA AGG (reversed) Intronic
901280411 1:8029694-8029716 AACATTCATATTTCTGTTCATGG + Intergenic
904966818 1:34380601-34380623 AAGGCTCATTTTTCTTCCCCAGG + Intergenic
905112809 1:35609448-35609470 AACACCAACATCTCTTCCCATGG + Intronic
905519124 1:38584532-38584554 AAGATTCAGATTCCTTCCCAAGG + Intergenic
905983985 1:42259949-42259971 AACACTGATACAGCTTCCCAAGG - Intronic
908743143 1:67349247-67349269 AAAACTCTTATTTCTGGCCAGGG - Intronic
908808541 1:67956039-67956061 TACAATCATATTTCTTTCCCAGG + Intergenic
909195824 1:72622017-72622039 AACTCACATATTAGTTCCCATGG + Intergenic
910018513 1:82556191-82556213 AATAATCATATTTGCTCCCATGG - Intergenic
911502180 1:98701150-98701172 TGCACTCAAATTTCTTCACATGG + Intronic
911803366 1:102174076-102174098 CAAACTCACATCTCTTCCCAGGG - Intergenic
912456072 1:109798279-109798301 AGAAGTCACATTTCTTCCCATGG + Intergenic
912618049 1:111126339-111126361 AACACATATATTTCTTCTAAGGG + Intronic
915822132 1:159035390-159035412 ATCACTCATATTTCTTTGAAAGG + Intronic
917536234 1:175876622-175876644 AACCCTCATATCTGTTACCAGGG + Intergenic
918234049 1:182561395-182561417 AACACACAGATATCTTCCAAAGG - Intergenic
918691432 1:187485112-187485134 AACACTGATATTTTCTTCCAGGG - Intergenic
918978730 1:191526495-191526517 CACACTCAAATTTGATCCCAGGG + Intergenic
920080532 1:203369602-203369624 AAGCCTCTTATTTCTTCCCCAGG + Intergenic
920441443 1:205983600-205983622 AATAGTCATATGTCTTGCCAAGG + Intronic
920785632 1:209038428-209038450 GCCTCACATATTTCTTCCCACGG - Intergenic
921715143 1:218410048-218410070 AACTCTCATTTTCCTTTCCAGGG - Intronic
922594978 1:226806615-226806637 AGCAAGCAGATTTCTTCCCACGG - Intergenic
923050997 1:230391368-230391390 CAAACTCATATTTTTTCCTAGGG - Intronic
923057625 1:230439094-230439116 CACACCCCTATTACTTCCCAGGG + Intergenic
1063500941 10:6553676-6553698 AACTCTCAAATATGTTCCCAAGG - Intronic
1063844431 10:10110285-10110307 GATACTCAGATTTCTTACCATGG - Intergenic
1064594228 10:16927122-16927144 AACACACATATTAATTCCAATGG + Intronic
1064646848 10:17468513-17468535 AAGAATCATTTCTCTTCCCACGG - Intergenic
1065496596 10:26335558-26335580 GACACTCATGATGCTTCCCATGG + Intergenic
1068452263 10:57207052-57207074 AACACCCAGATTGCTTCTCAGGG - Intergenic
1070932615 10:80272014-80272036 AAGCCTCAGATTCCTTCCCATGG - Exonic
1071285744 10:84142928-84142950 ATCAATCATATTTCTTCCAGTGG + Intronic
1072021951 10:91410717-91410739 AACTCTTTTATTTCTGCCCAAGG - Intronic
1074321171 10:112404032-112404054 AACACTGATATATTATCCCATGG - Intronic
1074542441 10:114376190-114376212 AATAAACATATTTCTTCCCCTGG - Intronic
1075150593 10:119926598-119926620 AGTACTCATAATTCTTCCCTTGG + Intronic
1075489071 10:122850671-122850693 AAAACACAAATGTCTTCCCAGGG + Exonic
1077197996 11:1291113-1291135 AACAATCATCTTACTTGCCACGG - Intronic
1078494193 11:11799510-11799532 AATAATCATAATTCTTCACAGGG - Intergenic
1078874285 11:15378159-15378181 CACCCTCCCATTTCTTCCCAGGG - Intergenic
1078889659 11:15543021-15543043 AAAAACCAAATTTCTTCCCATGG + Intergenic
1078974780 11:16461029-16461051 AACAGTTTTTTTTCTTCCCACGG - Intronic
1079343702 11:19633661-19633683 AACACTCAAAATGCTTCCCCTGG - Intronic
1079578526 11:22032900-22032922 AATAAACATATTTCTTCCCTTGG + Intergenic
1079958408 11:26892511-26892533 TATACTCATCTTTTTTCCCAAGG + Intergenic
1080332221 11:31152882-31152904 AACACTCAGGAATCTTCCCATGG + Intronic
1081737765 11:45416126-45416148 CAAACTCATCTTTCTTCACAAGG - Intergenic
1082617923 11:55384319-55384341 AAGAGTTAAATTTCTTCCCAAGG + Intergenic
1082624904 11:55471889-55471911 AAAAGTTATATTTCTGCCCAAGG + Intergenic
1082639201 11:55635273-55635295 TACATTTTTATTTCTTCCCAAGG - Intergenic
1085376591 11:76068108-76068130 AACACACTTCTTTCTTCTCAAGG + Intronic
1085443157 11:76581154-76581176 AAAAATCATTTTTCATCCCAAGG + Intergenic
1085758135 11:79218463-79218485 AACACTCAAATTTCTTTCTCAGG + Intronic
1087928933 11:103953766-103953788 AACACTTTTATTTCCTACCAGGG - Intronic
1089777344 11:120847691-120847713 AACTTTCATATTACTCCCCATGG + Intronic
1091911309 12:4232633-4232655 CCCACTCATATATCTTCTCAGGG - Intergenic
1094393976 12:29984842-29984864 AACATTCATATATCTTCACTGGG - Intergenic
1095152654 12:38813561-38813583 AACAATTATATTTCTCCCCTTGG - Intronic
1098247269 12:68533435-68533457 AACCTTCATATTTCTTACTATGG + Intergenic
1098482224 12:70977012-70977034 GACAGTCAGAGTTCTTCCCAGGG + Intergenic
1098665531 12:73157952-73157974 AACAATCAAATGGCTTCCCATGG + Intergenic
1098850753 12:75593300-75593322 ACCACTCCTGTATCTTCCCATGG + Intergenic
1100125766 12:91422954-91422976 CACACTCATATTTATCCCCCAGG - Intergenic
1100168281 12:91943417-91943439 AAAACTCACTTTTCTACCCATGG - Intergenic
1100886374 12:99075055-99075077 AACTCTCATCCTTCTTCCCATGG - Intronic
1104026836 12:125033691-125033713 TACACTCCTATTTCTAACCAAGG + Intergenic
1104326336 12:127802246-127802268 AAAACTGATATTTGTTTCCATGG + Intergenic
1109450101 13:62502138-62502160 CAGACTCATATTTCCTCCTATGG + Intergenic
1110104661 13:71656749-71656771 AAAACTCATCTTCTTTCCCATGG - Intronic
1110114609 13:71796952-71796974 AATATTAATATTTCTTACCATGG - Intronic
1111035772 13:82670973-82670995 AATGCTCATATTTATTACCATGG - Intergenic
1111626222 13:90791031-90791053 AACATTTATATTTGTTTCCAGGG + Intergenic
1112006440 13:95257897-95257919 GACACTCATATTTATTTCCCAGG - Intronic
1112691274 13:101897441-101897463 AATACTCAGATTTCTTGTCAGGG + Intronic
1114789455 14:25640361-25640383 AACACTCAAGTTTCTTGCCTAGG - Intergenic
1115216370 14:31017643-31017665 TACATTCATATACCTTCCCATGG - Intronic
1115420943 14:33194973-33194995 AACACTCCTATTTGTTCCTAAGG - Intronic
1116162117 14:41281262-41281284 AAAACTAATATTTCTTCCTGTGG - Intergenic
1116259157 14:42600951-42600973 TACACTCTGATTTCTTCACACGG + Intergenic
1116695433 14:48169409-48169431 AACACACATATTTCTTACCTGGG + Intergenic
1116781013 14:49237259-49237281 AACACACAGCTTTCTTCACATGG - Intergenic
1116801654 14:49450331-49450353 AAAATTCAAATTTCTACCCAAGG - Intergenic
1119056162 14:71422118-71422140 AACACACATATCTCTTTCCCAGG - Intronic
1119132582 14:72188122-72188144 AACACTCATATTTCTTCCCAAGG - Intronic
1120596569 14:86446551-86446573 AACACTCATCTTTGTTCCCCTGG + Intergenic
1120625468 14:86820291-86820313 AAAACACATATTTCTCCCCATGG + Intergenic
1122087191 14:99316258-99316280 AAGACATATATTTCTTCCGAGGG - Intergenic
1123707919 15:22963900-22963922 AACACTGATGTTTATTCCCGGGG - Intronic
1124861481 15:33446314-33446336 AATACTAATATTTCTTTACATGG + Intronic
1124900360 15:33816973-33816995 CACACTCATATCTGCTCCCAGGG - Intronic
1125473608 15:40028406-40028428 AACAATGATTTTGCTTCCCAGGG + Intronic
1128372206 15:67048740-67048762 ATCCCTCACTTTTCTTCCCATGG + Intergenic
1129641507 15:77383382-77383404 AACTCTGATGTTTCTTCTCAAGG - Intronic
1133918291 16:10128905-10128927 AACAATAGTATTTCTTACCATGG + Intronic
1135707939 16:24691135-24691157 AGACCTTATATTTCTTCCCATGG - Intergenic
1135863774 16:26081657-26081679 AACATTCTTATTTCTTCACCTGG - Intronic
1138252665 16:55515181-55515203 AACACTAATCTGCCTTCCCAAGG + Intronic
1139534715 16:67563924-67563946 AACCCTCATATTTCATCGCATGG - Intronic
1139635421 16:68255588-68255610 AAGCCTTATATTTCTCCCCAGGG - Intronic
1140972746 16:80029179-80029201 AAATCTCTTCTTTCTTCCCAGGG - Intergenic
1142164442 16:88578406-88578428 AACACTCATAGTTTTTCCAACGG - Intronic
1144090186 17:11849422-11849444 ACTCCTCATACTTCTTCCCATGG + Intronic
1146678935 17:34793265-34793287 TGCACCCATATTTCTTCCCAAGG + Intergenic
1147162565 17:38576699-38576721 AACCCTCCTATTTCTCTCCAAGG + Intronic
1147642323 17:42010892-42010914 ACCACTCATATTCTTACCCATGG + Intronic
1149341389 17:55690013-55690035 AACATTCAAGTTTCTTCCCTTGG + Intergenic
1150704537 17:67475248-67475270 AACAATCAAGTTGCTTCCCACGG - Intronic
1151131477 17:71901643-71901665 TACACTAACATTTCTTCCCATGG + Intergenic
1153495980 18:5700148-5700170 GACTATCAGATTTCTTCCCAGGG - Intergenic
1156686324 18:39651402-39651424 AAAACTCAAATATCTTCACATGG + Intergenic
1159342491 18:67154110-67154132 AACACTCATCTTAATTGCCAAGG + Intergenic
1160916339 19:1498526-1498548 AACCCTGATATATTTTCCCAAGG + Intergenic
1160985334 19:1835999-1836021 AAAGATGATATTTCTTCCCAGGG + Intronic
1161969735 19:7571033-7571055 CACCCTGATATTTCTTCCCAAGG - Intergenic
1163219733 19:15909579-15909601 CACACTCATTGTTCTTACCAGGG - Intergenic
1164458663 19:28429341-28429363 AACACTCACATTGTTTCCAATGG + Intergenic
1166960115 19:46492146-46492168 AACCCTCCTATTCCTTCCCAGGG + Exonic
1168077116 19:53986977-53986999 AAAATTCAGATTTCTTCCCAAGG - Exonic
925643664 2:6012363-6012385 AACACACATAATTCTTCTAAGGG + Intergenic
925820262 2:7793123-7793145 AACACCCATATTTTGTCCCAGGG - Intergenic
926587516 2:14704473-14704495 AACACACATTTTAATTCCCAAGG - Intergenic
928635997 2:33247451-33247473 AACAAACAGATTTTTTCCCATGG - Intronic
928639348 2:33281537-33281559 AACACCTAAATGTCTTCCCAGGG - Intronic
929609937 2:43263436-43263458 AACATACATTTTTCTTCTCACGG - Intronic
930203598 2:48566855-48566877 AACACTAATATTGCTTCCAATGG - Intronic
930551495 2:52840544-52840566 AAGACTCTCAATTCTTCCCATGG + Intergenic
931889028 2:66649145-66649167 AAGACACTTTTTTCTTCCCATGG - Intergenic
932509153 2:72267934-72267956 AACACTCATATATATGCACAAGG + Intronic
932931858 2:76050671-76050693 GACACTCATGATGCTTCCCATGG + Intergenic
933375795 2:81478370-81478392 AGCACACATCTTTCTTCACATGG + Intergenic
935422864 2:102887667-102887689 ACTACTCATATTCATTCCCAAGG - Intergenic
935659504 2:105453915-105453937 AACCTTCCTATTTCTTGCCAGGG - Intergenic
936452096 2:112641452-112641474 AAAACTCAGCTTTCTTGCCATGG + Intergenic
938110627 2:128562600-128562622 CTGACTCATATTTTTTCCCATGG - Intergenic
938364321 2:130722319-130722341 AACATTCATTTTTCAGCCCATGG + Intergenic
938574850 2:132594221-132594243 AAGACTCAAATGCCTTCCCAGGG - Intronic
939201464 2:139041265-139041287 AATTCTCAGATTTATTCCCAAGG + Intergenic
940815239 2:158290291-158290313 TACAATCACATTTCATCCCATGG + Intronic
941897831 2:170647498-170647520 GACACTCAGATTTCTTCCAATGG + Intronic
942326290 2:174779483-174779505 CACACTCAGATGTGTTCCCAGGG + Intergenic
944156271 2:196610828-196610850 AAAACTCATCCTTCTTCACACGG + Intergenic
945143850 2:206715488-206715510 TGCACCCATATTTCTTCCCAAGG - Intronic
946520307 2:220457306-220457328 AACACTCATAATTATTGCCCAGG - Intergenic
946611840 2:221466890-221466912 AAGTCTCCTATTTCTTACCATGG - Intronic
946708249 2:222480358-222480380 TACACTGATATTTCTTTCCACGG + Intronic
948533851 2:238631774-238631796 AAAAGTTATATTTCTACCCACGG - Intergenic
1168805791 20:671689-671711 AACTCTCCTACTTCTACCCATGG - Intronic
1170093027 20:12613870-12613892 AAAACACATCTTTCTTCACATGG + Intergenic
1170382791 20:15780050-15780072 AACACACATCTGTCTTCTCAGGG + Intronic
1170814963 20:19706026-19706048 AAAACTCATATTTCTAGCTAGGG + Intronic
1171160566 20:22918803-22918825 AACACTCTGATTTCTTTCTAAGG - Intergenic
1171375790 20:24693496-24693518 AACACTGAACTTTGTTCCCATGG + Intergenic
1171526839 20:25820089-25820111 ACCACACATATATCTTGCCAGGG + Intronic
1171549988 20:26035796-26035818 ACCACACATATATCTTGCCAGGG - Intergenic
1174490638 20:50892091-50892113 AACTGTCATCTTCCTTCCCAAGG + Exonic
1178465007 21:32840088-32840110 AACATTCTGCTTTCTTCCCAAGG - Intergenic
1181466462 22:23113165-23113187 AACACTCAGCTGTCTTCCCAGGG - Intronic
1183383057 22:37500063-37500085 ACTACTCAGATATCTTCCCACGG - Intronic
949157313 3:844901-844923 AAGACTCATAGATTTTCCCAGGG + Intergenic
951835275 3:26976488-26976510 AAAACCCAAATTTCTTGCCACGG + Intergenic
955077555 3:55628106-55628128 TACCCCCATTTTTCTTCCCAAGG + Intronic
956633566 3:71340549-71340571 AAAAAGCATATTTTTTCCCATGG + Intronic
959159636 3:102707765-102707787 AACAAGCATATCTCTTCCCAAGG - Intergenic
959449803 3:106485244-106485266 AATCCTCATACTTCTTTCCAGGG - Intergenic
959780806 3:110231132-110231154 AGCACTCATTTTTCTTCTGAGGG + Intergenic
962058209 3:131896900-131896922 AACACTCATTTTTCTGGCCATGG - Intronic
962342225 3:134595284-134595306 AAAACACATACTTCTTCTCATGG - Intergenic
962459310 3:135594254-135594276 CACACACATATTTCTTGCCTGGG + Intergenic
963449087 3:145454582-145454604 AACACTTATATTTCCTAACATGG - Intergenic
964548564 3:157861562-157861584 CACCCTCTGATTTCTTCCCAAGG - Intergenic
967854264 3:194104570-194104592 AACACTCATATGTGCTCCCCTGG - Intergenic
969136502 4:5033381-5033403 AACACTCAAAATGCTTCCCAAGG - Intergenic
977276174 4:94980020-94980042 AACACAAATATATCTTCACAGGG + Intronic
977290250 4:95158436-95158458 AACAGTCATGTTTTTTTCCAAGG - Exonic
977508040 4:97926948-97926970 AACACACTTAATTCTTACCATGG + Intronic
977895424 4:102359273-102359295 ATCACTTATATTTTATCCCAAGG + Intronic
979354618 4:119688251-119688273 ATCACTCAAATTTCTTCCCTTGG - Intergenic
980320647 4:131268666-131268688 CACCCTCATATCTCTTCACATGG + Intergenic
980494441 4:133572990-133573012 AACAAAATTATTTCTTCCCAAGG + Intergenic
981134220 4:141191752-141191774 AACACACATATGTCTTAGCAAGG + Intronic
981894657 4:149784130-149784152 AAAACTAATATTTCCTCCAATGG + Intergenic
982209230 4:153021355-153021377 AACACTGAGCTCTCTTCCCATGG - Intergenic
982731930 4:158965046-158965068 AGCATTCATATTGCTTCTCAGGG - Intronic
983715113 4:170772909-170772931 AACATTGATAATTCTTTCCATGG + Intergenic
984559257 4:181249705-181249727 AGCACTCATCTATGTTCCCATGG - Intergenic
984663027 4:182394231-182394253 AATTCTCAGATTTCTTCCCTAGG - Intronic
986256740 5:6107207-6107229 CCCACTCATAATTGTTCCCAGGG + Intergenic
986858315 5:11898140-11898162 AAAACTGATATTTTTGCCCATGG + Intronic
987483109 5:18484574-18484596 AACATTCATTCTTCTTCTCAAGG + Intergenic
988084135 5:26451769-26451791 AACACTGATATTACTTCTAATGG - Intergenic
988653764 5:33184053-33184075 AATACTCATCTTTTTTACCATGG + Intergenic
990524206 5:56608550-56608572 AAAACACACACTTCTTCCCAGGG - Intergenic
991298660 5:65106327-65106349 AACACCCAGATTTATTTCCAAGG + Intergenic
992789079 5:80197708-80197730 AACACCCATGTGGCTTCCCAGGG + Intronic
993433679 5:87864074-87864096 TACACTCATATTTCTGACCCTGG - Intergenic
995987324 5:118194121-118194143 AACACTCAGAATTCTTTTCATGG - Intergenic
996784935 5:127228531-127228553 AACACCCATTTATCTTTCCAAGG + Intergenic
998409028 5:141894083-141894105 AACTCTCATATTTTTAACCATGG + Intergenic
1000314761 5:160079080-160079102 AAAATTCATCTTTCTTTCCACGG - Intronic
1000530487 5:162413790-162413812 AAAGTTCATCTTTCTTCCCAGGG + Intergenic
1002583319 5:180224078-180224100 AACACTCTTCTTTATTCCCTTGG - Intergenic
1003491919 6:6630206-6630228 AACTCTTAAATTTATTCCCAGGG - Intronic
1006090637 6:31626751-31626773 AATACTCATATTTCCCCTCAGGG + Exonic
1006218910 6:32471175-32471197 AAAATTCAAATTTCTTACCATGG + Intergenic
1007010814 6:38415879-38415901 CTCACTCATATTTCTTCAAATGG + Intronic
1007825883 6:44600297-44600319 AGCTCTCAGATTTCTTCCCTTGG - Intergenic
1008306256 6:49904350-49904372 AACTCACACATTTCTTCCCATGG - Intergenic
1008534528 6:52497794-52497816 AACACTCAAATCTGTACCCAAGG + Exonic
1009044720 6:58224673-58224695 AACACTCATACTTCAGCTCAGGG - Intergenic
1009220535 6:60978954-60978976 AACACTCATACTTCAGCTCAAGG - Intergenic
1009337767 6:62514272-62514294 AACAGCTATATTTCATCCCAAGG - Intergenic
1010099409 6:72086237-72086259 ATAATTCATATTTCTTCCAAAGG + Intronic
1010729164 6:79369964-79369986 CACAATCATGTTTCTTTCCATGG + Intergenic
1011775362 6:90724450-90724472 ACCACTCACCTTTTTTCCCAAGG - Intergenic
1011905766 6:92365384-92365406 AAAACTAAAATTTCTTCCCAGGG - Intergenic
1011975899 6:93298156-93298178 AAGACTAATATTTTTTTCCAAGG - Intronic
1012677958 6:102140740-102140762 AACATTCAAATTTCTACCTAAGG - Intergenic
1013183451 6:107737323-107737345 AACAAACAAATTTCTCCCCATGG - Intronic
1014016846 6:116541029-116541051 AAAACTCATTTTTCATTCCAGGG + Intronic
1014734237 6:125073568-125073590 AAAACTCATGTTTCTTGCTATGG - Intronic
1015138538 6:129902523-129902545 AACATCCATATTTCTACCAATGG + Intergenic
1015447452 6:133324017-133324039 AATACTCAAACTTCTTCACATGG - Intronic
1015683252 6:135831516-135831538 GACACTTCTATTTCTTCCAAGGG + Intergenic
1016315608 6:142782747-142782769 AACAAACATATTTTTTCACATGG + Intronic
1016339539 6:143048249-143048271 AACTCTCATTTTTTTTCTCATGG + Intergenic
1018111093 6:160537515-160537537 AGCATTCATATTGCTTCCCCAGG - Intronic
1020377163 7:7501337-7501359 ATCCCTCATGTTTTTTCCCAAGG - Intronic
1021359996 7:19700942-19700964 AAAACTTATTTTTCTTCTCAGGG + Intronic
1021890895 7:25185232-25185254 AACAACCTCATTTCTTCCCATGG - Intergenic
1024848988 7:53687132-53687154 AACATTACTACTTCTTCCCATGG + Intergenic
1025111327 7:56218729-56218751 AACACCCAGATTTCTTCAGATGG + Intergenic
1026514806 7:71059603-71059625 AATACTCACATTTCATCCCCAGG - Intergenic
1027832037 7:83189790-83189812 AACAATAATAATTCTTCTCATGG + Intergenic
1028095359 7:86753930-86753952 ATTACACATATCTCTTCCCAAGG - Intronic
1028356391 7:89915211-89915233 CCTTCTCATATTTCTTCCCAAGG - Intergenic
1028465515 7:91147197-91147219 CACACACACACTTCTTCCCATGG + Intronic
1030166922 7:106564509-106564531 AGCACTCATCATTCCTCCCATGG - Intergenic
1030430546 7:109441745-109441767 GACACTTATACTTGTTCCCAAGG - Intergenic
1031233315 7:119139202-119139224 CTCACTCTTCTTTCTTCCCAAGG - Intergenic
1031967615 7:128038970-128038992 AACAACCATACTGCTTCCCATGG + Intronic
1033966161 7:146976984-146977006 TCCACTCATTTTTCTCCCCAGGG - Intronic
1034879163 7:154750502-154750524 AACACTCTTTTCTCCTCCCACGG + Intronic
1035179270 7:157077491-157077513 AACACCCTCTTTTCTTCCCAAGG - Intergenic
1036198322 8:6743449-6743471 TACACTCATATTTCTTGTCTTGG + Intronic
1036791245 8:11721703-11721725 AACACTCCTCTTCCTTCCCAGGG - Intronic
1038991197 8:32870208-32870230 AAGACTAATATTTCTTCTGAGGG + Intergenic
1040609689 8:48971128-48971150 AAAACTCATATTCCTTCCAATGG - Intergenic
1041020732 8:53635760-53635782 CACAATCTAATTTCTTCCCAGGG + Intergenic
1041713669 8:60914665-60914687 CTCCCTCATATTTCTTCCCAAGG - Intergenic
1042880969 8:73488522-73488544 TTTCCTCATATTTCTTCCCAGGG - Intronic
1043099529 8:76023650-76023672 AACACTCACATTTGCTCCCATGG - Intergenic
1044276063 8:90300554-90300576 AACATTGTTATTTATTCCCAAGG - Intergenic
1044552295 8:93525776-93525798 AACTTTCACCTTTCTTCCCATGG + Intergenic
1045180637 8:99777587-99777609 AACAGACATATTTCTTTCAAAGG - Intronic
1048372012 8:133786851-133786873 AAATCTCTTATTTGTTCCCAGGG - Intergenic
1048396313 8:134017379-134017401 AACATTCATATTTTATCCAAAGG - Intergenic
1050375407 9:4967420-4967442 AACACTCATATTTAATCTCTGGG - Intergenic
1052174978 9:25449599-25449621 AGCACTCACATTTCTTTCCTTGG - Intergenic
1056256682 9:84806407-84806429 AACACCCCTTTTGCTTCCCAAGG - Intronic
1056340793 9:85629863-85629885 AACCCTCTTATTTCCTCTCATGG - Intronic
1057690050 9:97275888-97275910 CAGAGTCATATTTCCTCCCACGG - Intergenic
1059789806 9:117628873-117628895 TATACTCATCTTTCTTCCCTGGG + Intergenic
1059944091 9:119389033-119389055 AAAAGTCACATTTCTTCCAAAGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1186582468 X:10835439-10835461 AACACTGATATTCCTTCCAGTGG - Intergenic
1188550482 X:31358957-31358979 AACAATCATTTATCTTCCTAGGG - Intronic
1189217341 X:39337530-39337552 AACACTGCTCTCTCTTCCCACGG - Intergenic
1190768388 X:53494678-53494700 GACACTCACATTTTTTGCCATGG + Intergenic
1190998287 X:55634150-55634172 AAAATTCATATTTTGTCCCAAGG - Intergenic
1193124381 X:77855718-77855740 AAGGCTTATATTTCATCCCAAGG + Intronic
1193358921 X:80556965-80556987 AACACTGAAACTTCTCCCCAAGG + Intergenic
1195073593 X:101304786-101304808 GACACTCATGATGCTTCCCATGG + Intergenic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1195644980 X:107220693-107220715 GACCCTCATACTTCTCCCCAAGG - Intronic
1201604348 Y:15769118-15769140 ATCACACAGATTTCTTCCCTAGG - Intergenic