ID: 1119133603

View in Genome Browser
Species Human (GRCh38)
Location 14:72196497-72196519
Sequence GACATGCCCCCTGTTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119133596_1119133603 30 Left 1119133596 14:72196444-72196466 CCCACAGTTGCTGTGGTGCATGG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 176
1119133602_1119133603 -1 Left 1119133602 14:72196475-72196497 CCTAGAATCACTGCTATCACGTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 176
1119133598_1119133603 29 Left 1119133598 14:72196445-72196467 CCACAGTTGCTGTGGTGCATGGA 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119133603 Original CRISPR GACATGCCCCCTGTTCCTCC TGG Intronic
900538280 1:3189814-3189836 GACGCGCACCCTGTTCCTGCAGG - Intronic
900996646 1:6126563-6126585 GGCACGCACCCTGGTCCTCCTGG + Exonic
901809920 1:11761819-11761841 GACATGCCCCCGGCTCCCACTGG - Exonic
904566806 1:31433214-31433236 GACCTGCACCCTGCACCTCCGGG - Intronic
904889813 1:33771305-33771327 GAGCTGCTCCCTGCTCCTCCAGG + Intronic
905244681 1:36604392-36604414 AAAATGTCCCCTGTTCCTCTGGG + Intergenic
906524564 1:46486743-46486765 GACAGGTCCCCAGTTCCTCAGGG + Intergenic
908748173 1:67395656-67395678 GACATCCCCCCTGCTCCAACTGG + Exonic
910805858 1:91189346-91189368 GGCCTGCCCCCTGCTCCTGCTGG - Intergenic
915797432 1:158751981-158752003 GAGATGCCCTCTGTGCCCCCTGG + Intergenic
916530051 1:165648252-165648274 GGCATGCCCGCTGCCCCTCCGGG - Intronic
917641684 1:176989079-176989101 GAAATGCCCCTTTTTACTCCTGG - Intronic
917848994 1:179043949-179043971 GAAAGGCCCTCTGGTCCTCCCGG - Exonic
918883893 1:190165889-190165911 GAAATGGCACCTGCTCCTCCAGG + Intronic
919872724 1:201835123-201835145 GACAAGCCCCCTATTTCTCATGG - Intronic
922324501 1:224515803-224515825 GGGATGCCCACTGTTCCCCCAGG + Intronic
1062862521 10:821951-821973 ACCAAGCCCCCTGTTCCTACAGG - Intronic
1062989465 10:1802613-1802635 GACATCACCCATGTTCCTTCTGG - Intergenic
1063437657 10:6047447-6047469 AGCATGCACCCTGTGCCTCCGGG + Intronic
1063467374 10:6255919-6255941 GACATTCACCCGGTTCCTCCTGG + Intergenic
1066413123 10:35192977-35192999 GCCATGCCCTCTCTCCCTCCAGG + Intronic
1066550027 10:36545839-36545861 GCCATGTCCTCTGTTCCTACAGG + Intergenic
1067683381 10:48453822-48453844 GACATACCCTCTGTCCCTCCTGG - Intronic
1067809728 10:49417661-49417683 GACAGCCGCCCTTTTCCTCCAGG - Intergenic
1073830925 10:107382225-107382247 GACAAGGGCCCTGTTCCTCCTGG + Intergenic
1075025474 10:118980346-118980368 GGCCTCCCGCCTGTTCCTCCTGG - Intergenic
1076759771 10:132597362-132597384 GCCATCTCCCCTGTTCCTGCAGG + Intronic
1078486135 11:11725107-11725129 GTGATCCCCCCAGTTCCTCCAGG - Intergenic
1080590179 11:33716574-33716596 GACATGCCCTCTGTTCTTGCTGG - Intronic
1081671203 11:44943604-44943626 ACCATGCTCCTTGTTCCTCCAGG + Intronic
1081738679 11:45423149-45423171 GGCATGCTCCCTGCTCCTCAAGG + Intergenic
1081861110 11:46333797-46333819 GAGATGCCCCCTGGCCCTTCTGG + Intronic
1083705606 11:64512224-64512246 CTCCTGCCCCCTGTTCCTCCAGG + Intergenic
1084468722 11:69342783-69342805 GGCCTGCCCCTTGTTTCTCCAGG - Intronic
1085730427 11:78993239-78993261 GTAATGCCCCCTCTTCCTCCAGG - Intronic
1091368035 11:135038133-135038155 TACATGGCCCCTGTTCAGCCTGG - Intergenic
1092940179 12:13400904-13400926 GAGATGCCCCCGAATCCTCCAGG + Intergenic
1093144650 12:15550929-15550951 GACGTGACCCCTGTTCTTCAGGG + Intronic
1095968053 12:47882693-47882715 TACCTGCCCCCTGCTCCTTCAGG - Exonic
1101875146 12:108592474-108592496 TTCATGCTCCCTGTTCCTCCTGG - Intronic
1103033729 12:117639791-117639813 GAAATGCCCCTTGATCTTCCTGG - Intronic
1103166742 12:118776435-118776457 GACATGGCCTCTGTTCTTCAGGG + Intergenic
1103348168 12:120265123-120265145 GACCTGCTCCCCGTCCCTCCAGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104368571 12:128200470-128200492 GACATGGCCCTTGTTACTGCTGG - Intergenic
1104567371 12:129897410-129897432 GACATGGCCTCTGGTCTTCCAGG - Intronic
1105522183 13:21140885-21140907 GACATGCCCACTGTTGCTACGGG + Exonic
1105615382 13:22007464-22007486 GTCATGTCCCATGGTCCTCCTGG + Intergenic
1118225787 14:63897906-63897928 AACATGCTCGCTGTTCCTCTGGG - Intronic
1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG + Intronic
1119312145 14:73657234-73657256 GACAGGGTCTCTGTTCCTCCAGG + Intronic
1119925113 14:78486345-78486367 GAGATGCCTCCTGTTCCTTTGGG + Intronic
1122171617 14:99880613-99880635 GACATGTCCATTGTTCCTGCAGG + Intronic
1122230641 14:100305025-100305047 GACACGCCCCCTCTGTCTCCAGG + Intronic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1127630260 15:60821178-60821200 GAGATGCCTCCAGTGCCTCCAGG + Intronic
1127651817 15:61016397-61016419 GGCATGCCACCTGTTTATCCTGG - Intronic
1129071041 15:72952034-72952056 GACAGGCCACCTGTGCCTCCAGG + Intergenic
1129893430 15:79086996-79087018 GCCATGCCCCCTATTCCATCTGG - Intronic
1130297421 15:82657007-82657029 AACAGGCCCCATGCTCCTCCTGG + Intergenic
1131706267 15:94999637-94999659 GAGATGCTCCCTGTGGCTCCAGG + Intergenic
1133034549 16:3027555-3027577 GTCATGCCCCTCTTTCCTCCAGG + Exonic
1134381674 16:13733057-13733079 ATCATGCCCCCAATTCCTCCTGG + Intergenic
1136452187 16:30359684-30359706 GAGATCCCCCCTGCCCCTCCCGG + Intronic
1140558383 16:75947733-75947755 GACTTAGTCCCTGTTCCTCCAGG - Intergenic
1141065271 16:80908918-80908940 GACATGCCCCAAGTTCCTGTGGG + Intergenic
1141767720 16:86069945-86069967 TCCCTGCCTCCTGTTCCTCCAGG + Intergenic
1142001278 16:87665710-87665732 GAACTGCCCCCTCTTCCTCCCGG + Intronic
1142137122 16:88456564-88456586 GACGTGCCCCCTGCTCCCCTTGG - Intronic
1142423953 16:89990869-89990891 GCCATGCTCACTGGTCCTCCTGG + Intergenic
1142817115 17:2435388-2435410 GACTTTCCCCCTCTTGCTCCTGG - Intronic
1143428492 17:6861087-6861109 TATATGCCCCCTGTGCCTTCTGG + Intergenic
1143539909 17:7562604-7562626 CCCATGCCCCCCGTTCATCCAGG + Intronic
1143940331 17:10534229-10534251 GACATGTTCCCTCTGCCTCCAGG + Intronic
1144520237 17:15948131-15948153 GACCTACCCCCAGTTCCTCCCGG + Intronic
1146105146 17:30028076-30028098 GGCATGGCCCTTATTCCTCCTGG - Intronic
1152002237 17:77654147-77654169 GACCTTCCTCTTGTTCCTCCTGG + Intergenic
1152405331 17:80095103-80095125 TCCATGTCCCTTGTTCCTCCTGG + Intronic
1157478007 18:48035722-48035744 CACATGCTCCCTGTTCTTCTAGG + Intronic
1158402201 18:57131214-57131236 GAGATGCCCCCAGCTCCTGCAGG - Intergenic
1160415227 18:78705294-78705316 GAAATCCCCCCTCTCCCTCCGGG - Intergenic
1161060061 19:2210396-2210418 GGGCTGCCTCCTGTTCCTCCTGG - Exonic
1163173884 19:15551272-15551294 GCCCTGTCCCCTCTTCCTCCAGG + Exonic
1164590190 19:29502393-29502415 GGCATGCCCCCTGTACCTCCTGG - Intergenic
1164607814 19:29612620-29612642 GAGATGCCCCCTGAACATCCAGG - Intronic
1164868924 19:31627209-31627231 AAAATGCCCCCTGTACCTCAAGG - Intergenic
1166461482 19:42991993-42992015 AACATGCACCGTGTTCCACCAGG + Intronic
1166478776 19:43151978-43152000 AACATGCACCGTGTTCCACCAGG + Intronic
1168504742 19:56923853-56923875 GCCATGACCCCTGTCTCTCCTGG + Intergenic
925658594 2:6178614-6178636 GACATGCCACCTTTCCTTCCTGG - Intergenic
926314760 2:11701109-11701131 CACATGCTCCCTTTTCCTCCTGG + Intronic
927004482 2:18833903-18833925 GACAGGCCCCTTGTGCTTCCTGG + Intergenic
927732581 2:25487615-25487637 TTCTTGCCCCTTGTTCCTCCAGG - Intronic
928115512 2:28542997-28543019 GACGTGCCACCTGCTCCTGCAGG + Intronic
933721759 2:85401648-85401670 CACAGGCCCCCTGCTCATCCCGG + Exonic
934300417 2:91773230-91773252 TGGATGCCCCCTGCTCCTCCAGG + Intergenic
935217822 2:100988711-100988733 CAGGTGCCCCCTGCTCCTCCAGG + Intronic
937316872 2:120937383-120937405 TACATGCCCCTTCTACCTCCAGG + Intronic
940281124 2:151990522-151990544 GACCCGGTCCCTGTTCCTCCTGG - Intronic
940716984 2:157237303-157237325 CACAAGCCCTCTGTTGCTCCGGG + Intergenic
941629599 2:167869372-167869394 GATAGCCACCCTGTTCCTCCTGG + Exonic
943370615 2:187011109-187011131 GCTATGCTCCCTGTTCATCCGGG + Intergenic
944780762 2:203014828-203014850 GCCCCGCCCCCTGCTCCTCCCGG + Intergenic
946172752 2:217905327-217905349 GGCATGCTCCCTGCTCCACCTGG + Intronic
946477346 2:220020394-220020416 GAAAAGCCCCCTCTTCTTCCAGG - Intergenic
947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG + Intergenic
947436971 2:230081150-230081172 GACATGTCCCTGGTTCCTGCAGG + Intergenic
947751255 2:232533918-232533940 GACATGGCCCCAGCTCTTCCTGG + Exonic
948793626 2:240391487-240391509 GACCCACCCCCTCTTCCTCCAGG + Intergenic
948861731 2:240755838-240755860 GCCAGGCCCCCTGCACCTCCTGG - Intronic
949007226 2:241656532-241656554 GCCATGCTCGCTGTTTCTCCTGG + Intronic
1169911425 20:10650624-10650646 GAGATGTCCTGTGTTCCTCCTGG - Intronic
1172124706 20:32618647-32618669 GACATGCACTATTTTCCTCCTGG - Intergenic
1172241096 20:33412871-33412893 GACATCCCCCTGGTTTCTCCTGG - Intronic
1172427898 20:34868209-34868231 GACATGTCACCTTTACCTCCTGG - Intronic
1173408860 20:42791919-42791941 GACATACCCTCTGTTTCTGCTGG - Intronic
1173952757 20:47006260-47006282 GACCTGACCCCTGGTCCTGCGGG - Intronic
1174282439 20:49448987-49449009 AAGAAGCCCCCTCTTCCTCCAGG - Intronic
1175330626 20:58161585-58161607 GACATGCCGGCTTTTCCTTCTGG - Intergenic
1175411958 20:58776341-58776363 CACATGCCTCCTTTTCCTCAAGG + Intergenic
1179545815 21:42111579-42111601 GGCATGCCACCCGTTCCACCCGG + Exonic
1181047158 22:20220572-20220594 GACTGGCCCCCTGTGTCTCCTGG - Intergenic
1182015803 22:27038745-27038767 GTCTTGCCCCCTGCTCTTCCTGG - Intergenic
1183830718 22:40417243-40417265 CGCCTGCCCCCTATTCCTCCGGG + Intronic
1184067425 22:42128622-42128644 GAGATGTCCCCTCCTCCTCCAGG + Intronic
1184070155 22:42142317-42142339 GAGATGTCCCCTCCTCCTCCAGG + Intergenic
1185362967 22:50420152-50420174 GACATGCACCCAGTGCCTCGGGG + Intronic
954249762 3:49358507-49358529 GACATGCCTGCTGCTCCTTCCGG - Exonic
957894929 3:86410120-86410142 TACATGCCCCCCCTTCTTCCAGG + Intergenic
958918320 3:100074216-100074238 GACAGCCCCCCTGGGCCTCCAGG + Intronic
961125748 3:124416175-124416197 GACAAGCCTCCTTTTCCTGCTGG - Intronic
961325217 3:126105467-126105489 GAGAGGCCCCCAGTGCCTCCTGG + Intronic
962221259 3:133566363-133566385 GACATGCACTTTGTTCCTCCAGG + Intergenic
966933375 3:184690290-184690312 GAGAAGCCCCCTCCTCCTCCCGG + Intergenic
969680513 4:8640634-8640656 GCCAGGCCCCGTGTTCCACCAGG + Intergenic
973547634 4:51997767-51997789 GACATTCCACTTTTTCCTCCAGG + Exonic
973638848 4:52884249-52884271 GACATCCTCCCTGTTGCTCCAGG - Intronic
975359469 4:73450931-73450953 GCCATGCTTCCTATTCCTCCAGG + Intronic
976367537 4:84247066-84247088 GACATCACCCCTGTTTTTCCTGG - Intergenic
976758535 4:88523790-88523812 GCCCCGCCCCCTGGTCCTCCAGG + Exonic
984756697 4:183331454-183331476 GACCTGCCCCCTGAACCTCAAGG + Intergenic
985559942 5:579976-579998 GCCGTGCGCCCTGTGCCTCCAGG + Intergenic
985561208 5:587028-587050 AACAGGCCCCCTGGCCCTCCTGG + Intergenic
985762675 5:1758849-1758871 GACAGGCTCACTGTTCTTCCTGG - Intergenic
985892658 5:2727810-2727832 GACATGCATCCTGCTCCACCTGG + Intergenic
992616110 5:78547823-78547845 AACAGGCCCCCTGTACCTCTGGG - Intronic
997918467 5:137953201-137953223 TACATGATCACTGTTCCTCCGGG + Intronic
997943482 5:138179175-138179197 GACGTGCCACTTGCTCCTCCTGG - Exonic
998473135 5:142398896-142398918 CTCATGCCCCTTGTTCCCCCTGG + Intergenic
1001483192 5:172102419-172102441 GAGATGCCCACTGGACCTCCGGG + Intronic
1002408076 5:179051930-179051952 GCAAGGTCCCCTGTTCCTCCCGG - Intergenic
1002439984 5:179259219-179259241 GCCCTGGCCCCTTTTCCTCCTGG + Intronic
1002545838 5:179944636-179944658 GACAGTCCCCCAGTTCCTCAGGG + Intronic
1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG + Intronic
1005173566 6:23016845-23016867 GACATTCCAGCTGTTCCTCATGG - Intergenic
1007264357 6:40585949-40585971 GACATGTTCCCTGTCCCTGCAGG + Intronic
1007498907 6:42280597-42280619 GACATCTCCCCTGTTCTTCATGG + Intronic
1007978867 6:46130082-46130104 GGCATCGCCCCTCTTCCTCCAGG + Exonic
1013305167 6:108841077-108841099 GACATGCCTCCTGGTTCTCTTGG - Intergenic
1017175003 6:151494261-151494283 GATTTGCACCCTTTTCCTCCCGG + Intronic
1018419537 6:163630236-163630258 GCCGTGCCCCCGGGTCCTCCTGG + Intergenic
1019221719 6:170478631-170478653 GGCCTCACCCCTGTTCCTCCTGG - Intergenic
1019733766 7:2640700-2640722 GCCATGCCCACTCTGCCTCCAGG - Intronic
1021635490 7:22688444-22688466 GAATTGCCTCCTTTTCCTCCTGG - Intergenic
1024196740 7:47066583-47066605 GACAAGTCCCCTGTTGCTTCCGG - Intergenic
1028184181 7:87761804-87761826 GCCATGCTCCCTTTTCCCCCAGG - Intronic
1028581486 7:92413777-92413799 ATCCTGACCCCTGTTCCTCCTGG - Intergenic
1036008278 8:4692143-4692165 AACCTGCCCCCTGTCCCTTCTGG + Intronic
1036678768 8:10855353-10855375 GACATGCCCTCCCTCCCTCCTGG + Intergenic
1037278569 8:17209360-17209382 GGCATGACACCTGTTGCTCCAGG + Intronic
1039310486 8:36313353-36313375 GCCATGCCTCCTGTTCAGCCTGG - Intergenic
1043068464 8:75607321-75607343 GACATGCTCCCTGTTCCACCTGG + Intergenic
1048840676 8:138563211-138563233 GAAATGCCCCCTGGTCCACAGGG - Intergenic
1049690882 8:143958326-143958348 GAGATGACCTCTGTGCCTCCTGG - Intronic
1049705792 8:144041388-144041410 AACCTGCCCCCTGTCCCTGCAGG - Intronic
1052206271 9:25844947-25844969 GGCATGCCCTCTGATACTCCAGG + Intergenic
1053173178 9:35905248-35905270 CAAATCCCCTCTGTTCCTCCTGG - Intergenic
1054463794 9:65480803-65480825 AACATGCCCCCAGCTCCCCCAGG - Intergenic
1054805713 9:69394149-69394171 GACAGGCCCCCCCTTGCTCCTGG - Intergenic
1057033298 9:91795744-91795766 GATGTGCCTCCTGTTTCTCCAGG + Intronic
1060821958 9:126666296-126666318 GGCCTGCCCCCTGCCCCTCCAGG - Intronic
1061561320 9:131405775-131405797 GCCATGCCCCCTCTTCCTGGTGG + Intronic
1061933500 9:133845287-133845309 GCCATGCGGGCTGTTCCTCCTGG - Intronic
1062010853 9:134265924-134265946 GACAGGCCCCCTGCCCCTCCAGG + Intergenic
1062636284 9:137493321-137493343 GACATACCCCTTGTACCTGCTGG - Intronic
1187915477 X:24149554-24149576 GACAGGCCCCCTCCTCCGCCCGG - Intronic
1190111271 X:47590567-47590589 GACATGGCCTCTGTCCCTCCAGG + Intronic
1192541346 X:71975745-71975767 GACATGCCCCAAGACCCTCCGGG - Intergenic
1197452707 X:126640162-126640184 GACATGTGTCCTCTTCCTCCTGG + Intergenic
1197773718 X:130106834-130106856 GCCATGCCCCCTGTCTCCCCAGG - Intronic
1197787908 X:130218316-130218338 ATCATGCCCCCTGATCCCCCAGG - Intronic
1197938116 X:131761501-131761523 GATATGCCGCCTGTTACTCGGGG + Intergenic
1197939737 X:131777276-131777298 GATATGCCGCCTGTTACTCGGGG + Intergenic
1200934204 Y:8724033-8724055 TACATCCCTCCTGTTCTTCCTGG - Intergenic
1201731665 Y:17211071-17211093 CACATGCCCTCTGTGGCTCCAGG + Intergenic