ID: 1119133732

View in Genome Browser
Species Human (GRCh38)
Location 14:72197517-72197539
Sequence TCCCTACCCACTGTAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119133732_1119133741 17 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133741 14:72197557-72197579 GACAATATATGGGTTAAATGAGG 0: 1
1: 0
2: 0
3: 16
4: 162
1119133732_1119133738 7 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133738 14:72197547-72197569 AGACCCAGGGGACAATATATGGG 0: 1
1: 0
2: 0
3: 9
4: 106
1119133732_1119133734 -6 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133734 14:72197534-72197556 TAGGGAGTACCAGAGACCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
1119133732_1119133735 -5 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133735 14:72197535-72197557 AGGGAGTACCAGAGACCCAGGGG 0: 1
1: 0
2: 0
3: 34
4: 256
1119133732_1119133733 -7 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133733 14:72197533-72197555 GTAGGGAGTACCAGAGACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 144
1119133732_1119133737 6 Left 1119133732 14:72197517-72197539 CCTGGGGCTACAGTGGGTAGGGA 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1119133737 14:72197546-72197568 GAGACCCAGGGGACAATATATGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119133732 Original CRISPR TCCCTACCCACTGTAGCCCC AGG (reversed) Intronic
900474609 1:2870264-2870286 TCTCCACCCAGTGCAGCCCCCGG + Intergenic
902609251 1:17587672-17587694 TCCATGCTCCCTGTAGCCCCAGG - Intronic
903372991 1:22848834-22848856 TCCAGAACCACTGTATCCCCCGG - Intronic
903621362 1:24700676-24700698 TCCCTTCCCTGTGGAGCCCCTGG - Intergenic
904373838 1:30067009-30067031 TCACTCACCCCTGTAGCCCCAGG + Intergenic
904811588 1:33166467-33166489 GCCCAGCCCACTGTAGCCCTCGG - Intronic
905077874 1:35290033-35290055 TCTCAACTCACTGCAGCCCCTGG + Intronic
907029219 1:51153987-51154009 TCCATACCCACTAGAGCTCCTGG + Intergenic
907525297 1:55050417-55050439 CCCCTTCCCAGTGTAGCACCGGG + Intronic
908840065 1:68270845-68270867 CCCCTACACTCTCTAGCCCCTGG + Intergenic
913326887 1:117635300-117635322 TCCCTACCCACTGCCCCCACAGG - Intergenic
915778763 1:158521656-158521678 TCCATACCCACTGGAGGCCCTGG + Intergenic
916551251 1:165851749-165851771 TCCCTACCCCCAGCAGGCCCTGG + Intronic
919778104 1:201207016-201207038 TCCTGACCCCCAGTAGCCCCTGG - Exonic
920205179 1:204286175-204286197 TCCCTCCCCTCTGTAAGCCCCGG - Intronic
922898091 1:229115983-229116005 TCCCCATCTACTGGAGCCCCTGG + Intergenic
1062834586 10:627270-627292 TCCCGACCCACAGCAGCCCTGGG - Intronic
1067991884 10:51223185-51223207 CCCCCACCCTCTGTAGCTCCTGG + Intronic
1068000479 10:51328133-51328155 TCCCTCCCCACTCCAGCCCCTGG + Intronic
1070003709 10:72401868-72401890 TCCCTGCCTCCTGTAGCCCCTGG + Intronic
1070061399 10:72986745-72986767 TCCCACCCCACTGTTGCCCGTGG + Intergenic
1070546586 10:77457522-77457544 TCCCTTCCCCCTCTAGCCCTAGG + Intronic
1070560591 10:77563749-77563771 TCCCTACACATTGCAGGCCCAGG + Intronic
1070599965 10:77858706-77858728 TCCTGACCCTCTGTAGCCCTAGG + Intronic
1073097112 10:100986705-100986727 GCCCCACCAACTGCAGCCCCAGG - Intronic
1076322176 10:129591381-129591403 TCCCTGCCCTCTGTCTCCCCAGG + Intronic
1076747156 10:132520171-132520193 TCACCCCCCACTGCAGCCCCTGG + Intergenic
1077216059 11:1395598-1395620 TCCCCACCCACTGTGGCCCTGGG + Intronic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1079244205 11:18741206-18741228 ACCCTCCCCACTGCAGTCCCGGG + Intronic
1081506820 11:43726325-43726347 TCCTCACCCACTCTATCCCCTGG - Intronic
1082641872 11:55670729-55670751 CCCTTACCCACAGTTGCCCCAGG - Intergenic
1083393514 11:62372664-62372686 GCCATAGCCACTGAAGCCCCAGG - Intronic
1084876736 11:72138950-72138972 TCCCCACCCAGTGCAGTCCCTGG + Exonic
1084887512 11:72220859-72220881 TCCCCACCCAGTGCAGTCCCTGG + Exonic
1089284311 11:117395850-117395872 TCCCTACAAAATGTAGCCACAGG - Intronic
1090333987 11:125950803-125950825 CCCCTACCCACTGACACCCCTGG + Intergenic
1090736598 11:129616656-129616678 TCCCTGCCCACTCTAGCTCTTGG - Intergenic
1091901261 12:4145819-4145841 TCCCTATCCCCTGTAGCTCTAGG - Intergenic
1093439047 12:19171861-19171883 TCCTGACCCTGTGTAGCCCCAGG - Intronic
1094452903 12:30601235-30601257 GCCCTATCCACTCTAGCCACAGG + Intergenic
1094454381 12:30616067-30616089 TCCCCACCCACCCTTGCCCCAGG - Intergenic
1095419966 12:42015313-42015335 TCCCAACCCACTCCAGCCCAGGG + Intergenic
1096581299 12:52587283-52587305 TACCTCCCCATTGGAGCCCCAGG + Intronic
1099677003 12:85773658-85773680 TTCCTACACACTCTAGCCCAAGG + Intergenic
1101499772 12:105292188-105292210 TCCCTACCCTCTGCAGCCTCTGG - Intronic
1102760346 12:115379772-115379794 TCCCTATTCACTGTGGCCCTTGG - Intergenic
1103520715 12:121535912-121535934 CCCCTTCCCACTAGAGCCCCAGG + Intronic
1103568743 12:121830385-121830407 ACACTACCCCCTGGAGCCCCTGG + Exonic
1103701064 12:122848964-122848986 GCCCCTCCCACTGTCGCCCCTGG - Intronic
1105235209 13:18544908-18544930 TCCCTGCCTAGTGTAGGCCCAGG + Intergenic
1105596759 13:21846434-21846456 TTCCTCCCCCCTCTAGCCCCTGG + Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106980009 13:35268337-35268359 TCCCCACTCCCTGCAGCCCCTGG - Intronic
1107095120 13:36527583-36527605 TCTGTGCCCACTGTAGCCCTTGG + Intergenic
1109535160 13:63707167-63707189 TCCCTCCCCACTATAGCTCCAGG + Intergenic
1109660706 13:65457056-65457078 TCCCGACCCCGTGTAGGCCCAGG - Intergenic
1110606401 13:77437975-77437997 TCCCACCCCACAGTAGGCCCCGG + Intergenic
1112734150 13:102399460-102399482 GCCCTTCCCACTGCAGCCCTTGG + Intronic
1114600566 14:23953031-23953053 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1114604800 14:23988175-23988197 TCCCTAACCACTCTGTCCCCAGG - Intronic
1114610250 14:24035741-24035763 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1116477856 14:45362552-45362574 TTCCTAACCTCTGTAGGCCCTGG - Intergenic
1118148230 14:63163704-63163726 TCTTTTCCCACTGTAGGCCCTGG - Intergenic
1118869210 14:69727251-69727273 CCCCTACCCGCTGGAGGCCCTGG - Intronic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1119225877 14:72944062-72944084 TCCCCACCCACTTTACCCCAGGG - Intronic
1119804866 14:77475996-77476018 TGCCTACCCACTGGAGGCCATGG - Exonic
1122242931 14:100381203-100381225 TCCCGGGCCACTGTAGCCTCTGG - Exonic
1122877028 14:104672262-104672284 TCCCCAGCCCCTGTACCCCCAGG - Intergenic
1124226203 15:27897286-27897308 TCCCTGCCCTGTGTAGCCCAGGG + Intronic
1124719805 15:32101692-32101714 TCCCTGCCCTCTGTGGCCTCCGG + Intronic
1125465500 15:39947590-39947612 TCCCTTCCCAGTGTAGCCCATGG - Intronic
1125761654 15:42100307-42100329 TCCCCACCTACTTTAACCCCAGG + Intergenic
1126209954 15:46090556-46090578 TCCCAACCCACCATAGCCCCTGG - Intergenic
1127805045 15:62511556-62511578 CCCCTACCTGCTGTAGGCCCTGG + Intronic
1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG + Intronic
1130994246 15:88895253-88895275 TCCCTCCCCACTTGTGCCCCGGG + Intronic
1132675755 16:1120677-1120699 TCCCCACCCACCGCAGGCCCTGG + Intergenic
1132864144 16:2085369-2085391 TCCCTACCCACTGCAGGCTGAGG - Intronic
1132936969 16:2486141-2486163 TCGCTCCCCACGGAAGCCCCTGG - Intronic
1133320761 16:4912210-4912232 TCCCCACCCGCTCCAGCCCCTGG + Intronic
1133625121 16:7563893-7563915 ACCCTGCCCACTGTACCACCGGG + Intronic
1134813806 16:17189310-17189332 TCTCTACCCATGCTAGCCCCTGG - Intronic
1135379993 16:21987853-21987875 TCCCTACCCTCTTTAGCCACTGG - Intronic
1136016735 16:27405632-27405654 TCCCTGCCCTCCGGAGCCCCCGG + Intronic
1138259611 16:55606075-55606097 ACACTACCCACTGTAGTCTCTGG - Intergenic
1138279825 16:55764263-55764285 TCCTTCCCAGCTGTAGCCCCAGG + Intergenic
1138288671 16:55829385-55829407 TCCTTCCCAGCTGTAGCCCCAGG - Intronic
1138659318 16:58508283-58508305 TCCCTACCCACCTCAGGCCCAGG + Intronic
1139545227 16:67646848-67646870 TCCCTGCCCCTTGTGGCCCCAGG + Intronic
1139971055 16:70775532-70775554 TGCCTGCCCCCTGTAGACCCAGG + Intronic
1141705022 16:85660036-85660058 TCCCTCCCCACTGTCCCCGCAGG - Intronic
1141848429 16:86627111-86627133 TCCCTACTCCCTTTGGCCCCTGG + Intergenic
1141998524 16:87649737-87649759 CCCCTCCCCACTTTGGCCCCTGG + Intronic
1142399727 16:89852563-89852585 TCCCCACCCCCTGGATCCCCTGG + Intronic
1143189958 17:5033809-5033831 TCACTACCCTCTGTAACCACAGG - Exonic
1143378494 17:6480939-6480961 TCCTTGCCCACTGTGGGCCCTGG - Intronic
1143890414 17:10098217-10098239 TCCCTACCCCTTGTAGCCCGCGG - Intronic
1144671011 17:17132576-17132598 TCCCTGACCTCTGTAGCCCGTGG - Intronic
1146214952 17:30971430-30971452 TCCCTACCCGCTGCAGTTCCGGG - Exonic
1146618716 17:34378763-34378785 TCCCTGCTCACTGTTGTCCCTGG - Intergenic
1147316093 17:39621189-39621211 TCCCTCCACACTGGAGCCTCAGG + Intergenic
1148051377 17:44771658-44771680 CCCATACTCACTGCAGCCCCTGG - Exonic
1150540038 17:66088166-66088188 TGGCTAGCCTCTGTAGCCCCAGG + Intronic
1151224257 17:72636957-72636979 TTCCTCCCCACTTGAGCCCCTGG + Intergenic
1152088128 17:78232401-78232423 TCCCTCCCTCCTGTAGCCCTTGG - Intronic
1152274739 17:79349676-79349698 TCCTTTCCCCCTGTATCCCCGGG + Intronic
1152801044 17:82330795-82330817 TCCCCAACCACTGCAGCCCAGGG - Intronic
1154514331 18:15145099-15145121 TCCCTGCCTAGTGTAGGCCCAGG - Intergenic
1155302423 18:24442785-24442807 TCCCAACCCACTGCTTCCCCTGG + Intronic
1155517095 18:26635302-26635324 TCCCTGCCCACTGTGCCCACAGG + Intronic
1157439342 18:47698002-47698024 TCCCTCCCCACCTTACCCCCTGG + Intergenic
1157546501 18:48550296-48550318 TACCAACCCACTGGAGCCTCAGG - Intronic
1161221686 19:3120787-3120809 GCCAATCCCACTGTAGCCCCAGG - Intronic
1161591490 19:5131203-5131225 GCCATCCCCACTGGAGCCCCCGG + Exonic
1162824644 19:13244147-13244169 TCCCTCCCCACTTCAGCACCTGG + Intronic
1163508497 19:17721794-17721816 TCCCTGCCTACTGTATACCCAGG - Intronic
1163830922 19:19546850-19546872 TCCCTGCCTGCTGTAGCCCCGGG - Intergenic
1164432543 19:28200738-28200760 CCCCTCCCCACTGAAGCCTCTGG + Intergenic
1165221132 19:34317521-34317543 TCCCCACCCACTGCAGACACAGG - Intronic
1165800018 19:38543674-38543696 TCCCTTCCCACTCCCGCCCCAGG - Intronic
1165935392 19:39385544-39385566 TCCCTACCCACTTCTGTCCCCGG + Intronic
1166485314 19:43206864-43206886 TGCCTGCCCACTGCAGCCCAGGG - Intronic
1167517580 19:49932400-49932422 TCCCTCCCCACTTTAATCCCAGG + Exonic
1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG + Intronic
925060862 2:889034-889056 TCCACACCCCCTGGAGCCCCAGG + Intergenic
925448758 2:3951193-3951215 ACAGTACCCACTGTACCCCCTGG + Intergenic
925666081 2:6257934-6257956 TCCCACCCCCCTGTATCCCCAGG + Intergenic
927052770 2:19347153-19347175 TCCCAACCTACTGTATTCCCAGG - Intergenic
927603296 2:24463294-24463316 TCTATACCCACTGTGGCCCCTGG - Intergenic
929619322 2:43338516-43338538 TTCCTCCTCTCTGTAGCCCCTGG + Intronic
929823132 2:45289489-45289511 TTCCTCCCCACTGGAGGCCCTGG + Intergenic
930032775 2:47068664-47068686 TCCCTACCCACCTTATCCCTGGG + Intronic
930700079 2:54450871-54450893 TCCCCACCCACCCTAGCTCCTGG + Intergenic
931424279 2:62156894-62156916 TCACTGCCCACTCTAGCCTCAGG - Intergenic
933354572 2:81196270-81196292 TCCCTCCACTCTGCAGCCCCAGG - Intergenic
933639242 2:84741528-84741550 GCCCCACCCTCTTTAGCCCCAGG - Intronic
937141724 2:119607669-119607691 TCCCCACCCCCTGGAGCCCCTGG + Intronic
938243082 2:129758029-129758051 TTCCTCCCCACTCTTGCCCCAGG + Intergenic
938514573 2:131989709-131989731 TCCCTGCCTAGTGTAGGCCCAGG - Intergenic
941544404 2:166830107-166830129 ACCCTAACCTCTGTAGCTCCAGG + Intergenic
942745142 2:179223267-179223289 TCCATACCCACTCCAGCCCTAGG - Intronic
948424398 2:237878093-237878115 TACTCACCCACTGCAGCCCCAGG - Intronic
948487519 2:238290184-238290206 GCCCTTCCCACAGAAGCCCCGGG + Intergenic
1169460752 20:5792739-5792761 TCCCGGCTCACTGTAGCCTCTGG + Intronic
1173965027 20:47106255-47106277 TGCCTCCCAGCTGTAGCCCCCGG + Intronic
1175251808 20:57614490-57614512 CCCCTACCGGCTGGAGCCCCAGG - Intronic
1175368632 20:58471865-58471887 TCCTGACCCACTCCAGCCCCAGG - Intronic
1175796915 20:61777009-61777031 TCCCTAGTCACTGGAGCCCTGGG + Intronic
1176090523 20:63316439-63316461 TCCCACCGCACTGCAGCCCCTGG + Intronic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1176779200 21:13173191-13173213 TCCCTGCCTAGTGTAGGCCCAGG + Intergenic
1179302490 21:40124883-40124905 TCCCAACCCATTTCAGCCCCTGG + Intronic
1179311357 21:40198697-40198719 TTCCTGCCCCCTGGAGCCCCAGG - Intronic
1180092529 21:45540382-45540404 TCCCCACCCACAGGACCCCCAGG + Intronic
1183026306 22:35068086-35068108 TCCCTGTCCACTGCAGCCTCAGG + Intronic
1183307024 22:37088050-37088072 TTCCTACTCACTGTGGCTCCTGG - Intronic
1183878299 22:40803311-40803333 TTCCTACCATCTCTAGCCCCTGG + Intronic
1183947951 22:41337567-41337589 TCCTCTCCCACGGTAGCCCCAGG - Intronic
1184057180 22:42060407-42060429 TCCCTCCCCACTGCAGGCCCAGG - Exonic
1184465250 22:44665187-44665209 TCCCTCCCTTCTGCAGCCCCAGG - Intergenic
1185094734 22:48800124-48800146 TCCCTCCCCACGGGAGTCCCTGG - Intronic
1185276938 22:49953893-49953915 CCCCTACCCACCGCAGGCCCTGG + Intergenic
950769775 3:15302156-15302178 GTCCTACCCACTGTAGGCCAAGG - Intronic
953509726 3:43523943-43523965 TCCACCTCCACTGTAGCCCCTGG - Intronic
953707988 3:45245577-45245599 TCCTTACCCAGGGCAGCCCCAGG - Intergenic
954362735 3:50130822-50130844 TCCCTAGCCCAGGTAGCCCCAGG + Intergenic
954689625 3:52388725-52388747 GCCCTACCCACTGTGGCACCTGG - Intronic
955293427 3:57713696-57713718 TCCCTCCTCCCTCTAGCCCCGGG - Intergenic
957020222 3:75118323-75118345 TCCCTACCCACTGGGGCTCACGG - Intergenic
959578494 3:107960713-107960735 TCCCTCCCCACTGTAGTCTCAGG - Intergenic
961417062 3:126766914-126766936 GCCATAGCCACTGAAGCCCCAGG + Intronic
962755776 3:138464575-138464597 TCCCTGCCTAGTGTTGCCCCTGG - Intronic
964239542 3:154575002-154575024 TCCATAGCCACTGTCACCCCAGG - Intergenic
968286637 3:197512914-197512936 TCCCTCCCAGCTGCAGCCCCAGG - Intronic
968520493 4:1032761-1032783 CGCCTACCCACTGTAACTCCAGG - Intergenic
968576448 4:1368521-1368543 CCCCTCCCCACTGAAGCCCAGGG + Intronic
969501806 4:7558087-7558109 TCACTGCCCACTGTGCCCCCAGG + Intronic
970039874 4:11784149-11784171 TGCTTACTCACTGTATCCCCAGG + Intergenic
970820509 4:20206048-20206070 TCCTGACCCTCTGTAGGCCCAGG - Intergenic
974293260 4:59961839-59961861 TGCCTACTCTCTGTAGGCCCTGG + Intergenic
974952973 4:68604073-68604095 TCCCAACCCAGTGTCGCCACTGG + Intronic
976114512 4:81712608-81712630 TCACTACCCCCTGTAGGCTCTGG - Intronic
978382061 4:108139518-108139540 TCCCTAACCACTGTGGAGCCCGG - Intronic
978635605 4:110801895-110801917 TCCCTCCTCACTCTAGCCCCTGG - Intergenic
978927089 4:114260068-114260090 TCTCTACCCACTGTAATCCTTGG + Intergenic
980065582 4:128184741-128184763 CCCCTACCCATTCTAGTCCCTGG + Intronic
983234907 4:165168245-165168267 CCCCTCCTCCCTGTAGCCCCTGG + Intronic
985513156 5:323121-323143 ACCCTACCCACTGCAGCCAGGGG - Intronic
991550150 5:67826593-67826615 TCCCAACCCACTGTGGGCTCAGG + Intergenic
994297926 5:98113372-98113394 TCCCCAACCACTTTAGCACCAGG - Intergenic
996146652 5:119985308-119985330 CCCCTACCCCCTGCAGGCCCCGG + Intergenic
999645455 5:153712943-153712965 TCCCCACCCACTTCTGCCCCAGG + Intronic
1000345679 5:160312032-160312054 TCCCTATCCTCTCTCGCCCCTGG + Intronic
1001035835 5:168295726-168295748 TCCCTACCCCCAGCAGCTCCTGG - Intronic
1001154273 5:169259404-169259426 TCCCTACCTGTTGTAGCCCGTGG - Intronic
1001244569 5:170096283-170096305 TACCTCCCCACCGTACCCCCAGG + Intergenic
1001771058 5:174296141-174296163 TCCCAACTCACAGTTGCCCCTGG + Intergenic
1002415560 5:179119296-179119318 TCCCTCCCCAGGCTAGCCCCCGG + Intronic
1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG + Intronic
1003414129 6:5892990-5893012 TTCCTGACCACTGTAGCCCATGG - Intergenic
1003501875 6:6709953-6709975 TCCATTCCCACTGTGGCTCCTGG - Intergenic
1004199769 6:13536738-13536760 TTCCAAGCCACTCTAGCCCCAGG - Intergenic
1006448621 6:34093184-34093206 TCCCCACCCACAGTTGCCACTGG - Intronic
1007790429 6:44305400-44305422 TTCCTGCCCACTGCTGCCCCTGG + Intronic
1008296180 6:49781194-49781216 TCCTGACCCTCTGTAGGCCCAGG - Intergenic
1010792075 6:80075982-80076004 TCCCTGCCCACTGTGGCCAGTGG - Intergenic
1014215674 6:118750622-118750644 TCCTTGCCCACCATAGCCCCAGG - Intergenic
1017796733 6:157851499-157851521 TTCCCACTCCCTGTAGCCCCTGG + Intronic
1018731275 6:166652987-166653009 TGCCTTCCCAGGGTAGCCCCGGG + Intronic
1019499135 7:1355679-1355701 TCGCTCCCCACTGCAGCCCGTGG + Intergenic
1019707922 7:2505210-2505232 TCCCTCCCCTCTCTGGCCCCTGG + Intergenic
1023932287 7:44713242-44713264 TCCCTCCCCACTGGTGCTCCAGG + Intergenic
1024277151 7:47687280-47687302 TCCTTACCCTGTGTAGGCCCAGG - Intergenic
1024698405 7:51880607-51880629 CCCCCACCCACTGCAGGCCCTGG + Intergenic
1024785641 7:52903978-52904000 TCCCCACCCCCAGCAGCCCCTGG - Intergenic
1026491099 7:70864299-70864321 TCCCTCCCCACTCCAGCCCTTGG + Intergenic
1026942538 7:74295591-74295613 TCCCTCTCCTCTGTGGCCCCTGG - Intronic
1029097332 7:98098550-98098572 TCCCTTCCCTCTTCAGCCCCTGG + Intergenic
1029302904 7:99598700-99598722 TCCCTTCCCACTGTTTCCTCCGG - Intronic
1030812438 7:113990236-113990258 TCAATACCCATTGGAGCCCCTGG + Intronic
1032730709 7:134640063-134640085 TCTCTACCTAGTGCAGCCCCTGG + Intergenic
1034119894 7:148617567-148617589 GCCCTACCCACTGTAGTAGCAGG - Intergenic
1034669472 7:152847141-152847163 TCACTACAGACTGCAGCCCCGGG - Intronic
1035074489 7:156169098-156169120 ACCCCACCCACTGTCCCCCCAGG - Intergenic
1035835241 8:2743236-2743258 TCCAGACCCACTCCAGCCCCAGG + Intergenic
1038452138 8:27646606-27646628 TACCTCCCCACGGTAGCCCCGGG + Intronic
1041556834 8:59167101-59167123 TCCCCACACCCTTTAGCCCCTGG + Intergenic
1045056177 8:98370164-98370186 TCCCTAACACCAGTAGCCCCCGG + Intergenic
1046655079 8:116885036-116885058 TTCCTCCTCCCTGTAGCCCCTGG + Intergenic
1048550989 8:135433468-135433490 TCCCTATGTACTGTGGCCCCAGG - Intergenic
1049597117 8:143489928-143489950 ATCCTACCCACTGTGGTCCCTGG + Intronic
1049747896 8:144270737-144270759 TCCCTGCCCACCACAGCCCCTGG + Intronic
1051263912 9:15292663-15292685 TCCTTACCCTATGTAGGCCCAGG + Intronic
1051389864 9:16552477-16552499 TCCCCACCCACAGTCGGCCCCGG + Intronic
1054735715 9:68748045-68748067 TCCCTACTCCCTGTAGCCCGAGG + Intronic
1057549571 9:96042109-96042131 TCCCTACCCAGTGTGGCTCCAGG - Intergenic
1058147861 9:101431423-101431445 ACCCAACCCTCTGTAGCCCGAGG - Intronic
1061007812 9:127938137-127938159 TCCCATCCCACTCTGGCCCCGGG - Exonic
1062535663 9:137020131-137020153 TGCCTTCCCACAGCAGCCCCTGG + Intronic
1185743023 X:2549137-2549159 TCCATAGCCAGAGTAGCCCCAGG + Intergenic
1186809328 X:13172211-13172233 CCCCTACCCACTCCTGCCCCAGG + Intergenic
1187973362 X:24680939-24680961 TCCCCACTCTCTCTAGCCCCTGG - Intergenic
1189375656 X:40464633-40464655 TCCCTAACTACTATACCCCCAGG + Intergenic
1189911307 X:45813047-45813069 TCCCCACCCCCAGTAGGCCCTGG + Intergenic
1192986735 X:76407681-76407703 TCCCTCCCCGCTTCAGCCCCTGG - Intergenic
1193089628 X:77480519-77480541 TCCCGACCCTCTGTAGGCCTAGG - Intergenic
1193218336 X:78891956-78891978 TCCCCCCTCACTCTAGCCCCTGG - Intergenic
1194403070 X:93461718-93461740 CCCCTACCCCCTGTTGCTCCCGG - Intergenic
1194534980 X:95094977-95094999 TCCATGCTCACTATAGCCCCTGG + Intergenic
1197494750 X:127164067-127164089 CCCCTACCATCTGTAGCCTCTGG - Intergenic
1198117630 X:133559404-133559426 TCCGTACCCACTATGGCACCTGG - Intronic
1199347766 X:146761588-146761610 CCCATGCCCACTGAAGCCCCTGG + Intergenic