ID: 1119137900

View in Genome Browser
Species Human (GRCh38)
Location 14:72237745-72237767
Sequence GCATGCAGGTGAGCAGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 5, 1: 30, 2: 60, 3: 141, 4: 454}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119137890_1119137900 6 Left 1119137890 14:72237716-72237738 CCATGCTCAAACCCCCTGCCTGA 0: 1
1: 1
2: 0
3: 26
4: 260
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137894_1119137900 -6 Left 1119137894 14:72237728-72237750 CCCCTGCCTGAGAGGGAGCATGC 0: 1
1: 0
2: 0
3: 20
4: 285
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137888_1119137900 24 Left 1119137888 14:72237698-72237720 CCACTTATTTGACTGCCACCATG 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137887_1119137900 25 Left 1119137887 14:72237697-72237719 CCCACTTATTTGACTGCCACCAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137889_1119137900 9 Left 1119137889 14:72237713-72237735 CCACCATGCTCAAACCCCCTGCC 0: 1
1: 0
2: 2
3: 35
4: 810
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137895_1119137900 -7 Left 1119137895 14:72237729-72237751 CCCTGCCTGAGAGGGAGCATGCA 0: 1
1: 0
2: 3
3: 37
4: 292
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137893_1119137900 -5 Left 1119137893 14:72237727-72237749 CCCCCTGCCTGAGAGGGAGCATG 0: 1
1: 0
2: 0
3: 27
4: 262
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454
1119137896_1119137900 -8 Left 1119137896 14:72237730-72237752 CCTGCCTGAGAGGGAGCATGCAG 0: 1
1: 0
2: 0
3: 27
4: 268
Right 1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG 0: 5
1: 30
2: 60
3: 141
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119137900 Original CRISPR GCATGCAGGTGAGCAGGTAC AGG Intronic
900164020 1:1237568-1237590 GGATGCAGCTGAGGAGGTCCTGG - Intergenic
900187894 1:1341120-1341142 GCGTGCAGGTGTGCATGTGCAGG - Intronic
900817212 1:4857627-4857649 GCAGGCAAGAGAGCATGTACAGG - Intergenic
901550144 1:9989959-9989981 GCATGCAGGTGAGCGGGTGCAGG - Intergenic
901775666 1:11559002-11559024 GCAGGCAGGTGAGGAGGTGCAGG - Intergenic
902246949 1:15127313-15127335 ACATGCAGGTGAGCATTTGCAGG - Intergenic
903033724 1:20481187-20481209 GCAGGGAGGAGAGCAGGTTCTGG + Intergenic
903448423 1:23437000-23437022 GGATGCAGGTGAGCACGCCCAGG + Exonic
903602610 1:24553702-24553724 GCAGGCAGGTGAGGAGGGGCTGG - Intergenic
903882254 1:26519034-26519056 GCATGCAGGTGGGATGGTCCAGG - Intergenic
903963642 1:27072787-27072809 GCAGGCATGGGGGCAGGTACGGG + Intergenic
904526409 1:31137049-31137071 ACATGCAGGTGAGCAGGTGCAGG - Intergenic
904577951 1:31517521-31517543 GCATGCAGATGGGCAGGTTGTGG + Intergenic
905349220 1:37333093-37333115 GCAGGCAGGAGAGCAGGGTCTGG - Intergenic
907018013 1:51036043-51036065 GCATGCATGTGTGCATGTGCTGG - Intergenic
907181392 1:52573325-52573347 GGATGAATGTGAGCAGGCACTGG + Intergenic
907241347 1:53082927-53082949 GCATGCAGGTGTGCATGTAAGGG - Intronic
908207877 1:61869839-61869861 GCACTCAGGTGAGCGGGTGCAGG + Intronic
908896829 1:68910250-68910272 GCATGCAGATGGGCAAGTACAGG - Intergenic
909086396 1:71174002-71174024 GCATGCAGATGGGCAGCTGCAGG + Intergenic
909432681 1:75607731-75607753 GCATGCAAGATAGCATGTACAGG - Intronic
909717645 1:78728538-78728560 GCACGCAGGTGAGCGGGTGCGGG - Intergenic
909719952 1:78755623-78755645 GCAGGCAAGAGAGCATGTACAGG - Intergenic
910149555 1:84125988-84126010 GCATGCAGGTGAGTGGGTACAGG + Intronic
911205654 1:95089673-95089695 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
911430074 1:97774080-97774102 GCATGCATATGGGCAGGTAGTGG - Intronic
911509310 1:98791652-98791674 GCGCACAGGTGAGCAGGTGCAGG - Intergenic
911766561 1:101683336-101683358 GCCTGCAGGAGGGCAAGTACTGG - Intergenic
912582143 1:110730313-110730335 GCACACAGGTGAGCGGGTACAGG - Intergenic
912607174 1:111003109-111003131 GCAGGCAAGAGAGCATGTACAGG - Intergenic
914996026 1:152543987-152544009 GCATGCAAATGGGCAGGTCCTGG - Intronic
916284762 1:163093996-163094018 GCATGCAGATGGGCAGGTTGTGG - Intergenic
918272839 1:182919959-182919981 GCATGCATGTGTGCTGGTAGGGG - Intronic
918562079 1:185880932-185880954 GCGCGCAGGTGAGCATGTGCAGG + Intronic
919656362 1:200200998-200201020 GCATGCAGATGGGCAGGTACAGG - Intergenic
920921154 1:210298338-210298360 GCCTGCAGGTGAGCAGGTGCAGG + Intergenic
920957603 1:210633513-210633535 GAAGGCAGGTGAGCAGAAACAGG + Intronic
921260968 1:213384756-213384778 ACTTGCAGGTGTCCAGGTACAGG + Intergenic
921520983 1:216153360-216153382 GCATGCAGATGGGCAGGTGTGGG - Intronic
921674867 1:217965966-217965988 GCACACAGGTGAGTAGGTGCAGG + Intergenic
921919930 1:220656288-220656310 GCATCCAGGTAGGCAGGAACAGG + Intronic
922793004 1:228320842-228320864 ACAAACAGGTGAGCAAGTACAGG - Intronic
922876513 1:228943717-228943739 GAGTACAGGTGAGCAGGTGCAGG - Intergenic
923023649 1:230187412-230187434 GCATGCAGGTGAGTGGGTGCAGG + Intronic
923306646 1:232694575-232694597 CCACGCAGGTGAACAGGTACAGG - Intergenic
923701172 1:236301723-236301745 GCATGCAGGTGAGCAGGTGCTGG - Intergenic
923911168 1:238445296-238445318 GCACGCAGGTGAGCGGGTGCAGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924674435 1:246161180-246161202 GCATGCAGGTGAGCTGTGCCAGG - Intronic
924902739 1:248418686-248418708 GCATGCAGCTGAGCAGGTGCAGG - Intergenic
1063522929 10:6757481-6757503 GCATGCAGATGGGCAGGTGCAGG + Intergenic
1063945216 10:11169478-11169500 GCATGCAGGTGCGGAAGTGCAGG + Intronic
1064600226 10:16985671-16985693 GCATGCAGATTGGCAGGTGCAGG - Intronic
1064785328 10:18888299-18888321 GCACGCAGGTGAGCAGGTACAGG - Intergenic
1064795778 10:19009740-19009762 GCATGCAGATGGGCAGGTTGTGG + Intergenic
1065011685 10:21426919-21426941 GCATGCAGATGGACAGGTGCAGG + Intergenic
1065304317 10:24354342-24354364 GCATGCAGATGGGCAGGTGCAGG + Intronic
1066305176 10:34133288-34133310 GCATGCAGATGTACAGGTACGGG - Intronic
1066446481 10:35488482-35488504 GTGTGCAGGTGTGCAGGTGCTGG + Intronic
1067509672 10:46884552-46884574 CCATGCAGCACAGCAGGTACAGG - Intergenic
1067652582 10:48167306-48167328 CCATGCAGCACAGCAGGTACAGG + Intronic
1068321652 10:55426415-55426437 TCACTCAGGTGAGCAGGTACAGG + Intronic
1068455329 10:57247530-57247552 GCAAGTGGGTGAGCAGGTACAGG - Intergenic
1068907108 10:62338805-62338827 GCATACAGATGGGCAGGTGCAGG - Intergenic
1069038870 10:63673413-63673435 GCACGCATATGGGCAGGTACGGG - Intergenic
1069760664 10:70809002-70809024 GCATGCAGGTCAGTAGGGGCAGG - Intergenic
1069877566 10:71572461-71572483 GCGTGCAGTTCAGCAGGGACAGG + Intronic
1070551254 10:77492317-77492339 GCATGCAGATCAGCAGGGGCTGG - Intronic
1071152539 10:82652110-82652132 GCATGCAGGTGAGTTGGTGCAGG + Intronic
1071195472 10:83153917-83153939 GCATGCAGATGGGCAGGTCGTGG - Intergenic
1071667675 10:87576663-87576685 GCATGCAGGTGAGTGGGTACGGG - Intergenic
1071893757 10:90041681-90041703 GCATGCAGATGGGCAGGTCATGG + Intergenic
1071960439 10:90804513-90804535 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1072528850 10:96299192-96299214 GCATGGAGGGGAGAAAGTACAGG - Intergenic
1072637812 10:97188558-97188580 GGTGGCAGGTGAGCAGGGACAGG - Intronic
1072747904 10:97954518-97954540 GCATGTAGGTAAGCAGGATCTGG - Intronic
1073283056 10:102368825-102368847 GCAGTGAGGTGAGCAGGTGCAGG + Exonic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1073971867 10:109052891-109052913 GCAGGCAGGAGAGCTTGTACAGG - Intergenic
1074104883 10:110381861-110381883 ACATGGAGGTGAGCAGTTAGAGG + Intergenic
1074710105 10:116170005-116170027 GCATGCATGTGAGTGGGTGCAGG - Intronic
1076102566 10:127794684-127794706 GCATGCAGATGGGCAAGTGCAGG - Intergenic
1076345298 10:129775130-129775152 GCATGCAGGAGCCCAGGGACTGG - Intergenic
1076498192 10:130913213-130913235 GCCAGAAGGTGAGCAGGTAAAGG + Intergenic
1076890030 10:133278896-133278918 ACATGCAGGTCAGCAGGAAGGGG + Exonic
1077128336 11:955393-955415 GAAAGCAGGACAGCAGGTACAGG - Intronic
1077159639 11:1106844-1106866 CGATGCTGGTGAGCAGGTAATGG + Intergenic
1077352595 11:2099823-2099845 GCCAGCAGGTGAGCAGGCAGAGG - Intergenic
1077356065 11:2118532-2118554 GCAAGCGGGTGAGCAGGAAAAGG + Intergenic
1077713030 11:4554675-4554697 GCATGCAGTTGGGCAGGTGCAGG - Intergenic
1077714799 11:4569878-4569900 GCATGCAGATGGGCAGATGCAGG - Intergenic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1080401553 11:31941089-31941111 GCAGGCAAGAGAGCATGTACAGG + Intronic
1080848386 11:36046238-36046260 GCATGCAACAGAGCTGGTACAGG - Intronic
1081022729 11:37967908-37967930 GCATGCAGGCGAGCGGGTGCAGG + Intergenic
1081279252 11:41187799-41187821 GCATGCAGATGGGCAGGTTGTGG - Intronic
1081332890 11:41826157-41826179 GCACACAGGTGAGCAGGTGCAGG + Intergenic
1082082159 11:48020628-48020650 GTTAGCAGCTGAGCAGGTACTGG + Intronic
1082626932 11:55497378-55497400 GCATGCAAGTGAGCAAGTGTGGG - Intergenic
1082748632 11:56995205-56995227 GCATGGAGATGAGCAGTTGCAGG + Intergenic
1082770503 11:57204020-57204042 GCATGCAGGTGATCAGGGAGAGG - Intergenic
1083169213 11:60912861-60912883 GCGTGCAGGTGAGTGGGTGCAGG + Intergenic
1083412971 11:62506448-62506470 GCCGGCAGGTGAGGAGATACAGG + Intronic
1083762509 11:64826455-64826477 TAATGCAGGTGAGCGGGTCCGGG - Exonic
1084766449 11:71312094-71312116 GCATGCAGGCAAGCAGGTGCTGG + Intergenic
1085172076 11:74457883-74457905 GCAGGCAAGAGAGCAGGTGCAGG - Intronic
1085405874 11:76261856-76261878 GCAGTCAGGGGAGCAGGCACAGG + Intergenic
1086286444 11:85256627-85256649 GCATGCAGATGGGCGGGTGCAGG - Intronic
1086312526 11:85550428-85550450 GCACGCAGGTGAGTGGGTGCAGG - Intronic
1087439288 11:98161986-98162008 GCATGCAGGTGAGTAGGTGCTGG - Intergenic
1087698840 11:101412721-101412743 GCACACAGGTAAGCAGGTACAGG - Intergenic
1087753327 11:102029115-102029137 GCATGCAGGTGAGCGGGTGCAGG - Intergenic
1087896305 11:103590260-103590282 GTATGCAGGTGAGCAGGTGCAGG - Intergenic
1088448323 11:109955436-109955458 GCATGCAGATGGGCAGGTGCAGG - Intergenic
1088715287 11:112543633-112543655 GCATGCAGATGAGCAGGTGCAGG + Intergenic
1088748599 11:112824860-112824882 ACATGTAGATGAGCAGGTGCAGG - Intergenic
1089180225 11:116578480-116578502 GCATGGAGGAGAGAAGGAACTGG + Intergenic
1089195610 11:116692558-116692580 GCAGCCAGTTGAGCAGGTTCTGG - Intergenic
1090554076 11:127855310-127855332 ACATGCAGATGGGCAGATACAGG + Intergenic
1091663110 12:2399108-2399130 GCATGCAGGTGAGTGGGTGCAGG + Intronic
1092226343 12:6750547-6750569 GCAGGCATGACAGCAGGTACAGG + Intronic
1092595863 12:10004097-10004119 GCATGCAGACGGGCAGGTGCAGG + Intronic
1092680019 12:10968740-10968762 GCACACAGGTGAACAGGTGCAGG + Intronic
1092720131 12:11433074-11433096 GCAGGCAGGTGGGCAGGCCCTGG + Intronic
1092913847 12:13172054-13172076 GCAAGTAGGTGAGGAGGTAAGGG - Intergenic
1093126369 12:15333577-15333599 GGATGCAGGTGTGCAAGCACAGG + Intronic
1093767629 12:22982825-22982847 GCGTGCAGGTGAGCGGGTGCAGG - Intergenic
1093769155 12:22999307-22999329 GCATGCAGATGAGCGGGTGCAGG - Intergenic
1093937700 12:25019076-25019098 GCATGCAGGTGAGCAGGTGTAGG + Intergenic
1096180958 12:49550059-49550081 AGCTGCAGGTGAGCAGGTGCGGG - Exonic
1096790736 12:54043197-54043219 GCATGCTGGGGAGCAAGTGCAGG + Intronic
1097746549 12:63310134-63310156 GCGTGTAGGTGAGCAAGTGCAGG + Intergenic
1098203562 12:68082959-68082981 GCATGCAAGAGAGCATGTGCAGG + Intergenic
1098327480 12:69317435-69317457 GCAGGCAGGAGAGCATGTGCAGG + Intergenic
1098545551 12:71707479-71707501 GCACACAGGTGAGCAGGTGCAGG + Intergenic
1098554676 12:71804718-71804740 GCATGTAGATGGGCAGGTGCAGG - Intergenic
1098936953 12:76490945-76490967 GTGTGTAGGTGAGCAGGTGCAGG - Intronic
1099540717 12:83904412-83904434 GCACACAGGTGAGTGGGTACAGG + Intergenic
1099543902 12:83951385-83951407 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
1099653333 12:85457042-85457064 GCATGCAGACGGGCAGGTCCTGG - Intergenic
1100293126 12:93236149-93236171 GCATGCAGGTGAGCGGGTGCAGG - Intergenic
1100757888 12:97772689-97772711 GCATGCAGATGAGCAGGTGCAGG + Intergenic
1102445302 12:112997780-112997802 GCATGCGGATGATGAGGTACAGG - Intronic
1103224426 12:119274705-119274727 GCATGCAGATGAGCAGGTCGTGG - Intergenic
1104096758 12:125565319-125565341 ACATGCAGATGGGCAGGTGCAGG + Intronic
1104164305 12:126212597-126212619 GCCTGGAGGTGAGCAGCTACTGG + Intergenic
1104238262 12:126960932-126960954 GCATGCAGATGGGCAGGTCCTGG + Intergenic
1104265927 12:127232347-127232369 GCATGCAGGTGAGTGGGCGCAGG - Intergenic
1104348123 12:128020978-128021000 ACATGCAGATGGGCAGGTCCAGG - Intergenic
1106815557 13:33403153-33403175 ACACGCAGATGGGCAGGTACAGG - Intergenic
1106847090 13:33748243-33748265 GCAGGCAGGTGAGCAGGTACAGG + Intergenic
1107294429 13:38894607-38894629 GTATGCAGGTGAGTGGGTACAGG - Intergenic
1108248659 13:48542838-48542860 GCACATAGGTGAGCAGGTGCAGG - Intergenic
1108316616 13:49243068-49243090 GCACACAGGTGAGCAGGTGCAGG - Intergenic
1108634860 13:52323265-52323287 GCTTTCAGGTAAGCAGGTCCAGG - Intergenic
1108652945 13:52499923-52499945 GCTTTCAGGTAAGCAGGTCCAGG + Intergenic
1108799869 13:54082007-54082029 GCACGCAGATGGGCAGGTATAGG - Intergenic
1108846191 13:54680200-54680222 GCATGCAGTTGGACAGGTGCAGG - Intergenic
1109006740 13:56886656-56886678 GCACGCAGGTGAGTGGGTGCTGG - Intergenic
1109184384 13:59251844-59251866 GCACGCAGGTGAGCAGGCGCAGG + Intergenic
1109204595 13:59467249-59467271 GCATGTAGATGGGCAGGTGCAGG - Intergenic
1109313912 13:60727406-60727428 GCATGCAGGTGAGCAAGTGCAGG + Intergenic
1109432255 13:62251255-62251277 GCATGCAGATGGGCAGGTCATGG - Intergenic
1109693714 13:65926896-65926918 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1109927805 13:69168643-69168665 GCATGCAGGTGAGTGCGTGCAGG - Intergenic
1110175735 13:72553623-72553645 GAATGCAGGTGAGCAGATGCAGG + Intergenic
1110348999 13:74485146-74485168 GGAGGAAGGTGAGCAGGTGCTGG - Intergenic
1110432072 13:75436141-75436163 GCAGGCAGGAGAGCATGTGCAGG - Intronic
1110433849 13:75457923-75457945 GCATGCAGATGGGCAGGTGCAGG + Intronic
1111182508 13:84687303-84687325 GCAAGCAGGTGAGTGGGTGCAGG + Intergenic
1111184900 13:84720727-84720749 GCATGCAGATGGGCAGGTCGTGG - Intergenic
1111370898 13:87314830-87314852 GCAAGCAGCTGAGCTGGTAATGG - Intergenic
1111610689 13:90603209-90603231 GCATGCAGATGGGCAGGTGCAGG + Intergenic
1111636179 13:90907266-90907288 GCATGCAGGTGAGTGAGTGCAGG + Intergenic
1112171444 13:96976895-96976917 GCATGCAGATGGGCAGGCGCAGG + Intergenic
1112261463 13:97881737-97881759 GCATGCAGGTGGGCAGGTGCAGG + Intergenic
1113288382 13:108878770-108878792 GCATGCAGATGGGCAGGTACAGG - Intronic
1114564025 14:23614808-23614830 TCAGGAAGGTGGGCAGGTACAGG + Intergenic
1115379825 14:32723054-32723076 GCCCGCAGGTGAGCGGGTGCAGG - Intronic
1115899608 14:38129936-38129958 GGATGCAGGTGAGTGGGTGCAGG - Intergenic
1116121078 14:40722928-40722950 GCATGCAGGATAGTAGGTGCGGG + Intergenic
1116125931 14:40785046-40785068 GTATGCAGGTGAGCGAGTGCAGG + Intergenic
1116495770 14:45558382-45558404 GCATGCACCTGAGCAGACACAGG - Intergenic
1116523858 14:45880770-45880792 GCACGCAGGTGAGCAGGTGCAGG - Intergenic
1117057126 14:51923901-51923923 TCATGCGGGTCAGCAGGAACGGG + Intronic
1117450505 14:55845312-55845334 ACACACAGGTGAGTAGGTACAGG + Intergenic
1117665597 14:58052942-58052964 TGATGCAGGTGTGCAGGTAGGGG - Intronic
1118082001 14:62371865-62371887 GCATGCAGGTGAGCATGTTCAGG + Intergenic
1118400309 14:65373578-65373600 GCACACAGGTGAGCAGATGCAGG - Intergenic
1118840455 14:69505966-69505988 CCATGCACATGAGCAGGTGCAGG + Intronic
1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG + Intronic
1120545966 14:85811727-85811749 GCCTGCAGATGAGCAGGTTGGGG + Intergenic
1120806176 14:88753207-88753229 GCATGCAGGTGAGAGGTTGCAGG - Intronic
1121145660 14:91579851-91579873 GCATGCAGGTGAGCGGGTGTAGG - Intergenic
1121159717 14:91726345-91726367 GCATGCAGATGGGCAGGTGCAGG - Intronic
1121475606 14:94199345-94199367 GCATGCAGATGGGCAGGTTGTGG + Intronic
1121666566 14:95676902-95676924 GCATGCAGACGGGCAGGTGCAGG - Intergenic
1122273903 14:100581411-100581433 GCTGGTAGGTGAGCAGGTCCAGG - Intronic
1122641759 14:103164173-103164195 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1122790634 14:104182840-104182862 CCCTGCAGGTGAGCAGGTACAGG - Intergenic
1124257056 15:28152871-28152893 GCATGCAGGTGACCAGGTGTGGG - Intronic
1124366186 15:29072966-29072988 GGATGCAGGGGAGCGGGCACCGG - Intronic
1124567269 15:30827637-30827659 GCATGCAGGTGACCAGGTGTGGG + Intergenic
1125355101 15:38809229-38809251 GCATGCACGTGAGCACACACAGG + Intergenic
1126212165 15:46111863-46111885 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1126654074 15:50956928-50956950 GCATGCAGGTGAGCGGGTGCAGG + Intronic
1128536866 15:68498213-68498235 GCAGGCAGGTGAGCTGGCTCAGG - Intergenic
1129231320 15:74198740-74198762 GCATTCAGCTCAGCAGGTGCTGG - Intronic
1129875350 15:78971833-78971855 GCATGCAAGTGACCAGGAAAAGG + Intronic
1130134379 15:81169734-81169756 GCACGCAGGTGGGCAGGTGTGGG - Intronic
1130420854 15:83745568-83745590 GCACACAGGTGAGCAGGTGCAGG - Intronic
1130545716 15:84856760-84856782 ACAGGCAGGTGAGAAGATACAGG + Exonic
1130554133 15:84910970-84910992 GCATGGAGGTGAGAATGTGCTGG + Intronic
1131365639 15:91837112-91837134 GCATGCATCTGGGCAGGTGCAGG + Intergenic
1131881597 15:96868090-96868112 ACGTGCAGGTGAGCAGGTGCAGG - Intergenic
1132110046 15:99096288-99096310 TCATGCATGTCAGCAGGGACTGG + Intergenic
1132659813 16:1056247-1056269 GCACGCAGGTGGGCGGGTGCAGG + Intergenic
1132941184 16:2509134-2509156 GCAGGCAGGTGGGCAGGTGGAGG - Intronic
1134602288 16:15542839-15542861 GCATGCAGGTGAGCAGATTGGGG + Intronic
1135887881 16:26328899-26328921 GCACACAGGTGAGCAGGAGCAGG + Intergenic
1137815736 16:51395939-51395961 GCGTGCAGGTGAGCAGGTGCAGG - Intergenic
1138442099 16:57041366-57041388 GCTTGCAGGAGAGGAGGGACTGG - Intronic
1138502763 16:57458287-57458309 CCATGCTGGTGAGCAGGCTCAGG - Exonic
1138745767 16:59361930-59361952 GCAGGCAAGAGAGCATGTACAGG - Intergenic
1138872721 16:60911543-60911565 GCAGGCAGGAGAGCATGTGCAGG - Intergenic
1139017897 16:62711980-62712002 GCATGCAGATGAGCAGGTCATGG - Intergenic
1139825610 16:69754841-69754863 GCATGCGGCTCTGCAGGTACGGG - Exonic
1140324739 16:73990849-73990871 GCAGGCAGGTGAGCAGGTGCAGG + Intergenic
1140805670 16:78530080-78530102 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1142126100 16:88411432-88411454 GCAGGCAGGTGAGCAGGCAGGGG + Intergenic
1142301685 16:89262350-89262372 GCAGGAGGGTGAGCAGGTGCAGG + Intergenic
1142348845 16:89570766-89570788 GGGAGCAGGTGAGCAGGCACGGG + Intergenic
1143108941 17:4542898-4542920 GCCCGCAGGTGAGCAGGGCCTGG - Exonic
1143289836 17:5820349-5820371 GCCTGGAGGTGAGGAGGTGCTGG - Intronic
1144375714 17:14638505-14638527 GCAGGCAGGCTAGCAGGTAATGG + Intergenic
1144453898 17:15403530-15403552 GAATGCAGGAGAGGAGGTTCAGG - Intergenic
1146886698 17:36475593-36475615 GCGTGCAGGTGAGCAGGTGCAGG + Intergenic
1147513505 17:41094358-41094380 GCATGCAGGTGAATGGGTGCAGG - Intronic
1148537814 17:48455471-48455493 GCACACAAGTGAGCAGGTGCAGG - Intergenic
1149067301 17:52495886-52495908 GCACGCAGGTGAGCAGGTGCAGG + Intergenic
1149722813 17:58863333-58863355 GCATGCAGGTGAGCAGTTGCAGG + Intronic
1150210504 17:63438788-63438810 GCATGAAGCTGTGCAGGCACTGG - Intronic
1150223289 17:63509180-63509202 GCACGTAGGTGTGCAGGTTCAGG - Intronic
1151190045 17:72391729-72391751 TCATGCATTTGAGCATGTACAGG + Intergenic
1151479453 17:74361720-74361742 CCATGCAGGTGAGCGGGCAGTGG - Exonic
1151845531 17:76651940-76651962 GCATGCCGGTGATCTGATACAGG + Intergenic
1152335841 17:79699942-79699964 GCATGAAAGTGGGCAGGTCCAGG - Intergenic
1153351315 18:4083742-4083764 GCATGCAGATGAGCAGGTCATGG + Intronic
1153369141 18:4294516-4294538 GCATGCAGATGAGCAGGTGCAGG + Intronic
1153571088 18:6474308-6474330 GCATGCATATGAGCACGCACAGG - Intergenic
1153770572 18:8412374-8412396 GCATGCAGCTGAGCCGGGACAGG - Intergenic
1154112226 18:11579907-11579929 TCATGCAGGAGAGCAGGTGGAGG - Intergenic
1154155878 18:11943793-11943815 GCACGCAGATGAGCAAGTACAGG + Intergenic
1155528071 18:26737414-26737436 GCAGGCAAGAGAGCATGTACAGG - Intergenic
1156311583 18:35927183-35927205 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1156439219 18:37167153-37167175 GCATGCAGATGGGCAGGTTGTGG + Intronic
1156684349 18:39626945-39626967 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1158159526 18:54465353-54465375 GCATGCAGGTTAGTGGGTACAGG + Intergenic
1158173221 18:54622617-54622639 GCAGGCAAGAGAGCAGGTGCAGG + Intergenic
1159030473 18:63225728-63225750 GCACGCAGGTGAGTAGATGCAGG + Intronic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1159215289 18:65384246-65384268 GCATGCAGATGGGCAGGTTGTGG - Intergenic
1159258203 18:65976428-65976450 GCATGCAGGTGAGCGGGTTCAGG + Intergenic
1160367314 18:78337508-78337530 GGATGCAGGTGCGCTGGAACTGG - Intergenic
1160522760 18:79518180-79518202 GCGTGCAGGTGACCAGGTAGAGG + Intronic
1160557511 18:79735724-79735746 GCAGGCAAGTGAGCAGGTGATGG - Intronic
1160922589 19:1528018-1528040 GCAGACAGGTGAGCGGGTTCGGG - Exonic
1161007319 19:1943046-1943068 GCATGCAGGGGAGCCGGGTCTGG + Intronic
1161008338 19:1947695-1947717 GCCTGCAGGTGGGCTGGGACAGG + Intronic
1162612167 19:11765302-11765324 GCAGGCAAGAGAGCATGTACAGG + Intergenic
1163595374 19:18218295-18218317 GCAGGCAGGTGGGCGGGTGCAGG - Intronic
1165137979 19:33682569-33682591 GAATGCAGGTTACCAGGGACTGG - Intronic
1168712631 19:58510774-58510796 GCACGCAGGTCAGCAGGCACTGG + Exonic
924973006 2:147972-147994 GCAGGCAAGAGAGCTGGTACAGG + Intergenic
925504226 2:4543086-4543108 GCAGGCAGGAGAGCATGTGCAGG - Intergenic
926197443 2:10772426-10772448 GCCTGAAGGTGAGCAGGGATGGG - Intronic
927139859 2:20122534-20122556 GCATGCATGGGAGCCGGTGCAGG + Intergenic
928494040 2:31813520-31813542 GCACACAGGTGAGCAGGCGCAGG + Intergenic
928710678 2:34001701-34001723 GCATGCAGACGAACAGGTGCAGG - Intergenic
928859970 2:35846041-35846063 TCACACAGGTGAGCAGGTTCAGG + Intergenic
930320056 2:49843446-49843468 GCATGCAGGTGAGTGGGTACTGG + Intergenic
930527328 2:52546041-52546063 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
931458717 2:62432512-62432534 GCATGCAGGTGAGCGGGTGCAGG - Intergenic
933165520 2:79070556-79070578 GCATGCAGTTGAGCAGGTGCAGG - Intergenic
933250575 2:80024566-80024588 GCACGCAGGTGAGCGGGTGCAGG + Intronic
933425995 2:82112783-82112805 GCATGTAGATGGGCAGGTGCAGG - Intergenic
933442690 2:82333921-82333943 GCACACAGGTGAGCAGGTGCAGG + Intergenic
934211496 2:89983297-89983319 GGATGCGGGTTAGCAGGTCCAGG + Intergenic
934791717 2:97067799-97067821 GCATGCAGATGGGTAGGTGCAGG + Intergenic
934913292 2:98278238-98278260 GCACGCAGGTGAGTGGGTGCAGG + Intronic
934969418 2:98750886-98750908 GCATGCGAGTGAGCAGGTGCGGG - Intergenic
935175951 2:100648905-100648927 GCATGCAGGTGAGTGGGTGTGGG - Intergenic
935260977 2:101355757-101355779 GTACACAGGTGAGCAGGTTCAGG + Intronic
935385070 2:102491492-102491514 GCAGGCAAGAGAGCATGTACAGG + Intronic
935385352 2:102493460-102493482 GCAGGCAAGAGAGCATGTACAGG + Intronic
935876686 2:107515073-107515095 GCATGCAGATGGGCAGGTTGTGG + Intergenic
936411745 2:112264674-112264696 GCATCCAGTTGAACAGGCACTGG + Intergenic
936501650 2:113071695-113071717 GGAGGCAGGTGAGAAGGAACAGG - Intronic
937612158 2:123875340-123875362 GCAGGCAGGAGAGCATGTGCAGG - Intergenic
938150642 2:128879583-128879605 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
938408635 2:131046281-131046303 GCCTGCAAGTGAGCAGGGATGGG + Exonic
938549904 2:132370534-132370556 GCATGCAGATGGGCAGGTGCAGG + Intergenic
939700725 2:145387180-145387202 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
939798512 2:146678503-146678525 GCGTGCAGGTAAGCAGGTGCAGG + Intergenic
939829432 2:147054262-147054284 GCATGCAGGTGGGCAGGTGCAGG - Intergenic
940418878 2:153455543-153455565 GCACATAGGTGAGCGGGTACAGG + Intergenic
940717007 2:157237409-157237431 GCATGCAGGTGAGTGAGTGCAGG - Intergenic
941661712 2:168202055-168202077 GCAACCAGGTGAGCATGTAGCGG - Intronic
941858050 2:170250516-170250538 GCATGCAGATGGACAGGTGCAGG + Intronic
942319430 2:174723730-174723752 GCAGGCAAGCGAGCATGTACAGG - Intergenic
943256199 2:185596382-185596404 GCAGGCAGGAGAGCATGTGCAGG - Intergenic
943521053 2:188949628-188949650 GCATGCAGGTGAGCCAGTGCAGG - Intergenic
944067352 2:195633303-195633325 GCACGCAGGTGAGCGGTTGCAGG + Intronic
944243521 2:197508638-197508660 TCAGGCAGGTGAATAGGTACAGG - Intronic
944512275 2:200476568-200476590 GCATGCAGGTGAGCAGGTGCAGG + Intronic
944891953 2:204127049-204127071 GCAGGCAGGGGAGCATGTGCAGG - Intergenic
944945377 2:204678179-204678201 GCACGCAGGTGAGCAGGTGCAGG + Intronic
945154859 2:206827909-206827931 ACATGCAGGTGTGGAGGTCCAGG - Intergenic
945769011 2:214016308-214016330 GCATGCAAGAGAGCATGTGCCGG + Intronic
945868560 2:215202945-215202967 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
946210422 2:218143229-218143251 GCATGCAGGTGGGCAGGTCGTGG + Intergenic
946472538 2:219975581-219975603 GCAGGCAAGAGAGCATGTACAGG - Intergenic
947596956 2:231419016-231419038 GCACACAGTTGAGCAGGTGCAGG - Intergenic
948362559 2:237433259-237433281 ACGTGCAGGTGAGAAGCTACGGG - Intergenic
948468746 2:238164316-238164338 GGATGCAGATGAGCAGGCGCAGG - Exonic
1168891803 20:1299807-1299829 GCATGCAGGTGTGAATGGACTGG + Intronic
1169141460 20:3229430-3229452 GCACGCAGGGGTGCAGGTAGGGG + Exonic
1169190615 20:3657034-3657056 GCATGCAGCCCTGCAGGTACTGG + Intergenic
1169440185 20:5627296-5627318 GGATGCAGGTGAGCAGGTGCAGG - Intergenic
1169817438 20:9672533-9672555 GCAGGCAGGAGAGCGTGTACAGG - Intronic
1170304120 20:14918499-14918521 GCATGTAGGTCAGCTGGCACAGG + Intronic
1171211510 20:23320724-23320746 GCATGCAGACAAGCAGGTGCAGG + Intergenic
1172857230 20:38014696-38014718 GCAAGCAGGCGAGCAGGCAAAGG + Intronic
1174057176 20:47806142-47806164 GCATGTAGATGAGCGGGTTCAGG + Intergenic
1175153715 20:56955113-56955135 GTTTGCAGGAGAGCAGGTACAGG + Intergenic
1175445687 20:59018048-59018070 AGGTGCAGGTGGGCAGGTACAGG - Intergenic
1176141367 20:63546530-63546552 GAAGGCAGGTGAGCAGGGGCTGG - Intronic
1176179205 20:63741660-63741682 GCGTGGAGGTGAGCAGGTCAGGG - Intronic
1176695461 21:9972151-9972173 GCATGCAGGTGAGCAGGTATAGG + Intergenic
1176981059 21:15381337-15381359 GCATGCAGATGGGTAGGTGCAGG - Intergenic
1176981586 21:15387116-15387138 ACATACAGGTGAGCAGGTTCAGG - Intergenic
1177555153 21:22679371-22679393 GCATGCAGGTGAGTGGGTGCGGG - Intergenic
1177564070 21:22795922-22795944 GCATGCAGATGGGCAGGTTGTGG + Intergenic
1177605004 21:23366962-23366984 GCATGCAGAGGGGCAGGTGCAGG + Intergenic
1177640187 21:23835238-23835260 GTGTGAAGGGGAGCAGGTACAGG - Intergenic
1177647498 21:23918056-23918078 GCATGCAGATGGGCAGGAACGGG - Intergenic
1178223710 21:30689978-30690000 GAATGCAGGTGAGCGGGTGCAGG - Intergenic
1178747440 21:35266590-35266612 GCAAGAAGGTGAGGAGGTGCTGG - Intronic
1179183505 21:39064678-39064700 CCAGGCAGTTGAGCAGGGACTGG - Intergenic
1179921770 21:44511243-44511265 ACATGCAGGTGTGCAGGTATGGG - Intronic
1179982324 21:44902121-44902143 GTATGCATGTGAGCATGTTCAGG + Intronic
1181327579 22:22061646-22061668 GTATGCAGGTCAGCAGACACTGG - Intergenic
1181900147 22:26147112-26147134 GCATGCATGCGTGCATGTACGGG + Intergenic
1184205390 22:42999213-42999235 GCATGCAGGTGAGCAAGTACAGG - Intronic
1184496736 22:44846534-44846556 GCTGGCAGGTGAGCAGGTACGGG + Intronic
1185389064 22:50549115-50549137 ACATGCAGGTGCGCAGGTAGAGG - Exonic
949617474 3:5770015-5770037 GCCTGCAGATGAGCAGGTCGTGG + Intergenic
949631271 3:5929296-5929318 GCATGCAGGTGTGCAGGTGCAGG - Intergenic
949675365 3:6447441-6447463 GCATGCGGGTGAACAAGTGCAGG + Intergenic
949956604 3:9274410-9274432 GCATGCAGGTGAGTGGGTGCAGG + Intronic
950176959 3:10881709-10881731 ACGTGCAGGTCAGCAGGTAGAGG + Intronic
950827868 3:15844504-15844526 ACAAGAAGGTGAGCAGGTAAAGG + Intronic
950930452 3:16783833-16783855 GTAGTCAGGTGAGCAGGTGCAGG - Intergenic
950997526 3:17518887-17518909 GCGCGCAGGTGAGCAGGTGCGGG - Intronic
951134205 3:19084153-19084175 GCATGCAGGTGAGTAGGTGCAGG - Intergenic
951541146 3:23783258-23783280 GCAAGCAGGGGAGCAGGCACTGG + Intergenic
951651331 3:24954872-24954894 GCATGCAGGTGAGTGGTTGCAGG + Intergenic
951931602 3:27973636-27973658 GTGTGCAGGTGAGCAGGTGCAGG + Intergenic
952039165 3:29241050-29241072 GCATGCAGGTCAGCAGGTGCTGG + Intergenic
952080430 3:29751822-29751844 GCACGCAGGTGAGCTGGTGCAGG + Intronic
952107688 3:30088499-30088521 GCACACAGGTGAGCAGGTTCAGG + Intergenic
952561826 3:34603955-34603977 GCATATAGGTAAGCAGGTGCAGG - Intergenic
952904719 3:38132160-38132182 GAATGGGGGTGAGCAGCTACTGG + Intronic
953181174 3:40596700-40596722 GGATGAATGTGAGCAGGTGCTGG - Intergenic
953956512 3:47235885-47235907 CCAGGCAGGTGGGCAGGTACAGG - Intronic
954284450 3:49608911-49608933 GCATGCAGGTGAGGAGAGAGAGG + Intronic
955036930 3:55277124-55277146 GCAGGCAAGAGAGCATGTACAGG + Intergenic
955038760 3:55294009-55294031 GCATGCAGATGGGCAGGTGAAGG - Intergenic
956735227 3:72232955-72232977 GCATGCAGATGGGCAGGTCGTGG + Intergenic
956982496 3:74654870-74654892 GCATGCAGATGGGCAGGTAGTGG - Intergenic
957029234 3:75221091-75221113 GCATGCAGATGGGCAGGTTGTGG + Intergenic
957244755 3:77702670-77702692 GCACGCAGGTGAGTGGGTGCCGG - Intergenic
957717081 3:83942248-83942270 GCATACATGTGAGCTGGTGCAGG + Intergenic
957824449 3:85422790-85422812 ACACACAGGTGAGCAGGTACAGG + Intronic
958024001 3:88028745-88028767 GCACACAGATGAGCAGGTGCAGG - Intergenic
958466732 3:94469366-94469388 GCATGCAGGTGAGTGGGTGCAGG + Intergenic
958467292 3:94473399-94473421 GCATGCAGGTGAGGAGATGCAGG + Intergenic
958524649 3:95240523-95240545 GCATGCAGACCAGCAGGTGCAGG + Intergenic
958529604 3:95309600-95309622 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
959065163 3:101648695-101648717 GCATGCAGATGGGCAAGTGCAGG + Intergenic
959155757 3:102664353-102664375 GCATGCCGGTGAGCAGGTGGAGG - Intergenic
959297406 3:104554591-104554613 GCAGGCAGGAGAGCGTGTACAGG + Intergenic
959486681 3:106934745-106934767 GCATGCAAATGGGCAGGTGCAGG - Intergenic
959773360 3:110126188-110126210 GCATGCAAGTGACCAGGTGCTGG - Intergenic
959774036 3:110135107-110135129 TCATGCAGATGGGCAGGTGCAGG - Intergenic
960040854 3:113148614-113148636 GCACGCAGGTGAGATGGTTCTGG - Intergenic
960352246 3:116607618-116607640 GCATGCAGGTGAGTGGGTGCAGG - Intronic
960359746 3:116697330-116697352 GCATGCAGGCAGGCAGGTGCAGG + Intronic
961343076 3:126243360-126243382 GCATGCAGATGGGCAGGTGCAGG + Intergenic
962005174 3:131342157-131342179 GCAGGCAGGTGAACTGGTAGAGG - Intronic
962687738 3:137863525-137863547 GCACTTAGGTGAGCAGGTGCAGG - Intergenic
963234659 3:142945226-142945248 GCATGCAGACGGGCAGGTGCAGG + Intergenic
963761107 3:149288037-149288059 GCATGCAGATGGACAGGTGCAGG - Intergenic
964663838 3:159151020-159151042 GAATGCAGGTGGGAAGGTAGTGG + Intronic
964669527 3:159209689-159209711 GCATGCAGGTGAGTGGGTGCAGG - Intronic
964678015 3:159305143-159305165 GCATGCAGGTGAACTGGCCCAGG - Intronic
964712037 3:159681465-159681487 AAATGCATGTGAGCAGGAACTGG - Intronic
964872187 3:161325412-161325434 GGATGAATGTGAGCAGGCACCGG - Intergenic
965085371 3:164089037-164089059 GAATGCAGATGGGCAGGTGCAGG - Intergenic
965689738 3:171342942-171342964 GCAGGCAAGAGAGCAGGTGCAGG - Intronic
968004038 3:195227084-195227106 GCATGCAGGCATGCATGTACGGG + Intronic
968598515 4:1497798-1497820 ACATGCAGCTGAGCAGCTGCAGG + Intergenic
968657614 4:1785467-1785489 GCTTGCAGCTGAGCAAGGACCGG - Intergenic
969197502 4:5574670-5574692 GCAGCCAGGTGAGAAGGTACTGG - Exonic
969452666 4:7283777-7283799 GCATCCAGGTGAGGGGGTCCTGG + Intronic
970131452 4:12876100-12876122 GCACACAGGTAAGCAGGTGCAGG + Intergenic
970673206 4:18418714-18418736 GCATGCAGGTGTGGAGGGAGAGG - Intergenic
970943364 4:21661462-21661484 GCACACAAGTGAGCAGGTGCAGG - Intronic
971887554 4:32473102-32473124 GCATGCAGATGGGCAGGTCTTGG + Intergenic
972053074 4:34764800-34764822 GCACGCAGGTGAGTGGGTGCAGG - Intergenic
972300944 4:37785100-37785122 GCAGACAGGTGAGAAGGTGCAGG - Intergenic
972339786 4:38142149-38142171 CCATGCAGGTGAACAGGTAGCGG - Intergenic
972406545 4:38751821-38751843 GCATGCAGATGGGCAGGTGCAGG - Intergenic
973253271 4:48083228-48083250 GCATGCAGATGGGCAGGTGCAGG - Intronic
974303327 4:60098448-60098470 GCATGCAGATGGGCAGGTCTTGG - Intergenic
974440339 4:61907898-61907920 GAATGCAGGTCAGCAAGTCCCGG + Intronic
974505968 4:62772341-62772363 GCTTGCAGGCGAGCAGGTGCGGG - Intergenic
974752354 4:66156868-66156890 GCACGTAGGTGAGCAAGTGCTGG - Intergenic
975246942 4:72130664-72130686 GCATGCAGGTGAGAGGGTGCAGG + Intronic
976041979 4:80897946-80897968 GCATGCAGGTGAGTCGGTGCAGG + Intronic
976802296 4:89006503-89006525 GCATGCAGGCAAGCAGGTGCTGG + Intronic
977019409 4:91741048-91741070 GTGTGCAGGTGAGCGGGTGCAGG - Intergenic
977306429 4:95328918-95328940 GCATGCAGGTGAGGGGGTGCAGG - Intronic
977357910 4:95969663-95969685 ACACACAGGTGAGCAGGTACAGG - Intergenic
977672943 4:99716661-99716683 GCATGCAGGTGAGCAAGTGCAGG - Intergenic
977721446 4:100244356-100244378 GCATACAGGTGAGTGGGTGCAGG + Intergenic
978262683 4:106780297-106780319 GCAGGCAAGAGAGCACGTACAGG + Intergenic
978593938 4:110356430-110356452 GCATGCAGGTGAGCGGGTGCAGG - Intergenic
979184416 4:117770814-117770836 GCATGCAGGTGAGAGAGTGCAGG - Intergenic
979307642 4:119165840-119165862 GCAAGCTGCTCAGCAGGTACAGG - Intronic
979596679 4:122542167-122542189 GCATGCAGGTGAGTGGGTTCAGG - Intergenic
979771108 4:124525703-124525725 ACATGCAGATGAGCAGGTGCGGG - Intergenic
979919367 4:126478841-126478863 ACACACGGGTGAGCAGGTACAGG - Intergenic
980097271 4:128504381-128504403 GCATGCAGGTGAGTGGGTACAGG + Intergenic
980337868 4:131499717-131499739 GCATGCAGATGGGCAGGTCATGG + Intergenic
980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG + Intergenic
980438348 4:132809831-132809853 GCATGCAGAGGAGCAGGTCATGG - Intergenic
980492868 4:133552422-133552444 GCACTCAGGTGAGTGGGTACAGG + Intergenic
980495502 4:133584742-133584764 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
980496611 4:133592753-133592775 GCATGCAGGTAAGCGAGTACAGG - Intergenic
980603595 4:135059353-135059375 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
980734530 4:136867703-136867725 GCATGCAGACGGGCAGGTATGGG - Intergenic
980871510 4:138616033-138616055 GCATGCAGATGGGCAGGTGCAGG - Intergenic
981288413 4:143046306-143046328 GCTTGCTGGGGAGCAGGGACTGG + Intergenic
981815806 4:148829578-148829600 GCATGCAGATGGGCAGGTGCAGG + Intergenic
981994041 4:150957324-150957346 GCAGGCAAGTGAGCATGTGCAGG + Intronic
982786571 4:159543757-159543779 GCATGTAGGTGAGGGGGTGCAGG + Intergenic
983141412 4:164154597-164154619 GCACGCAGATGGGCAGGTGCAGG + Intronic
983679450 4:170335440-170335462 TCATGAAGGTGAGCAGCTTCTGG - Intergenic
983863156 4:172733659-172733681 GCAGGCAAGAGAGCATGTACAGG - Intronic
983972428 4:173891097-173891119 GCATTCAGGTGAGTAGGAAAGGG + Intergenic
984245991 4:177275728-177275750 GCATGGAGGTGAGCAGGTGCGGG - Intergenic
984543868 4:181074816-181074838 GTATGCAGGTGAGCAGGTGCAGG - Intergenic
985305363 4:188533614-188533636 GCACCCAGAAGAGCAGGTACTGG - Intergenic
986406695 5:7432506-7432528 GCACGAAGGTGAGCGGGTCCAGG - Intronic
986542759 5:8864187-8864209 GCATGCAGATGGGCAAGTTCAGG - Intergenic
986588757 5:9346603-9346625 GCATACAGGTGAGCAGATGCAGG - Intronic
987090917 5:14507218-14507240 TCCTGCAGTTGTGCAGGTACCGG - Exonic
987251175 5:16102848-16102870 GCATGCAGGTGAGTGGCTCCAGG - Intronic
987268404 5:16279782-16279804 GCACACGGGTGAGCAGGTACAGG + Intergenic
987271618 5:16314997-16315019 GCATGCAGATGGGCAGGTGCAGG - Intergenic
987932082 5:24414800-24414822 GCATGCGAGTGGGCAGGTGCAGG + Intergenic
988066209 5:26230589-26230611 GCATGCAGGTGAGGAGGTTGGGG - Intergenic
988350971 5:30106728-30106750 GAGCACAGGTGAGCAGGTACAGG - Intergenic
989088772 5:37706539-37706561 GCAGGCAAGAGAGCAGGTGCAGG - Intronic
989505019 5:42217202-42217224 GCATGCAGACGGGCAGGTGCAGG + Intergenic
989687855 5:44110401-44110423 GCATGCAGGTGAGTGGGTACCGG - Intergenic
990079794 5:51899163-51899185 ACATACAGGTGAGCAGGTACAGG + Intergenic
990128461 5:52548702-52548724 GAGTGCAGGTGAGTAGGTGCAGG - Intergenic
990146031 5:52761201-52761223 GCATGCAAGAGAGCATGTACAGG - Intergenic
990176489 5:53114102-53114124 GCATGCAGGTGAGAGGATGCAGG + Intergenic
991425672 5:66489415-66489437 GCACGCAGGTAAGCAGGTGCAGG + Intergenic
992105146 5:73444257-73444279 CCGTGCAGGCGAGCAGGTGCTGG - Intergenic
992992441 5:82298148-82298170 GCATGCAGATGGGCAGGTGCAGG + Intronic
993036293 5:82761093-82761115 GCATGCAGGTGAACGGGCGCAGG - Intergenic
993188150 5:84646246-84646268 GCACGCAGATGGGCAGGTCCTGG - Intergenic
994209659 5:97073608-97073630 GCATGCAGACGGGCAGGTGCAGG - Intergenic
994819339 5:104628434-104628456 GCATGCAGAAGGGCAGGTGCAGG - Intergenic
995120818 5:108533689-108533711 GCACACAGGTGAGCAGGTGCAGG + Intergenic
996576779 5:124984272-124984294 GCTTGCAGGTTGGCAGGTGCAGG - Intergenic
996650608 5:125871988-125872010 GAGTGCAGGTGAGGAGGTGCAGG + Intergenic
996669493 5:126100668-126100690 GCATGCAGATGGACAGGTGCAGG + Intergenic
996890287 5:128411124-128411146 GCACACAGGTGAGCAGGTGCAGG + Intronic
998643911 5:144041775-144041797 ACATGCAGGTGAGTGGGTGCAGG + Intergenic
998750699 5:145318637-145318659 GCATGCAGATGGGCAGCTGCAGG + Intergenic
998856433 5:146399227-146399249 ACACACAGGTGAGCAGGTGCAGG - Intergenic
999564118 5:152838424-152838446 ACATGCAGGTGAGTGGGTGCAGG + Intergenic
1000140961 5:158403044-158403066 GCAGGCAGGAGAGCATGTGCAGG - Intergenic
1000537183 5:162493538-162493560 GCACACAGGTGAGTGGGTACAGG + Intergenic
1000866219 5:166518306-166518328 GCATGCAGGTGGGTGGGTACAGG + Intergenic
1000868010 5:166538735-166538757 GCATGCAGATAGGCAGGCACAGG - Intergenic
1001330156 5:170756270-170756292 GCATGCTGGAGGGCAGGTCCTGG - Intergenic
1001616588 5:173047895-173047917 GCACACAGGTGAGCGGGTGCTGG - Intergenic
1001969521 5:175943437-175943459 GCACGCAGGTGATGAGGTACAGG + Intronic
1002247914 5:177900316-177900338 GCACGCAGGTGATGAGGTACAGG - Intergenic
1002792450 6:446296-446318 GCAGGTAGGTGGGCAGGTCCTGG - Intergenic
1002962267 6:1926364-1926386 GCATGCAGATGGGCAGGTTGTGG - Intronic
1002979473 6:2121837-2121859 GCATGCAGGAGAGCAGGGCCAGG - Intronic
1003159902 6:3625856-3625878 GCAGGCAGGTGTGAAGGAACTGG + Intergenic
1003330130 6:5122812-5122834 GCGTGAAGGAGAGCATGTACTGG - Intronic
1003385490 6:5663812-5663834 ACATGGAGGTGAGCAGGACCAGG + Intronic
1003499741 6:6694569-6694591 GCATGCAGATGGGCAGGTGGTGG + Intergenic
1003687819 6:8322362-8322384 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1003783146 6:9451791-9451813 GCATGCAGGTGAGTGGGTGAGGG - Intergenic
1004469494 6:15916688-15916710 GCATACAGATGGGCAGGTGCAGG + Intergenic
1004647145 6:17573586-17573608 GCATGCAGGCGAGTGGGTACAGG + Intergenic
1004977460 6:20984322-20984344 GAGTGCAGGTGAGCGGGTGCAGG + Intronic
1005200936 6:23343093-23343115 GCATGCAGGTAAGTGGGTATGGG - Intergenic
1005363327 6:25053347-25053369 GCACACAGGTGAGCAGGTGCAGG + Intergenic
1005835925 6:29709585-29709607 CCATGCAGATGAGCAGGTGGGGG - Intergenic
1005977458 6:30810984-30811006 GCAGGCAGGTAAGCAAGTTCAGG - Intergenic
1006397449 6:33796582-33796604 GGAGGCAGGGGAGCAGGTGCTGG - Intronic
1006745026 6:36335635-36335657 GCATGAAGGTGAGCTGGTTTGGG - Intronic
1006831317 6:36970024-36970046 GTGTGCAGGTGAGCAAGCACTGG - Exonic
1007719351 6:43876147-43876169 GAATGCAGGGGGGCAGGCACTGG - Intergenic
1007932090 6:45700601-45700623 GCATGCAGACGGGCAGGTGCAGG - Intergenic
1009349857 6:62661091-62661113 GCATCCAGACGGGCAGGTACAGG + Intergenic
1009524562 6:64728099-64728121 GAGTGCAGGTGAACAGGTGCAGG + Intronic
1009610053 6:65930329-65930351 GCAGGCTGGTGGGCAGCTACAGG + Intergenic
1009698532 6:67142906-67142928 ACATGCAGATGAGCAGGTGCAGG - Intergenic
1009866641 6:69406287-69406309 GCCTGAAGGTGAGAAGGTAAAGG + Intergenic
1009948143 6:70364080-70364102 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1010634440 6:78240161-78240183 GCATGCAAGTGAGCAGGTGCAGG - Intergenic
1012843222 6:104356366-104356388 CCATGCAGGTGAGCAGGTGCAGG - Intergenic
1012945509 6:105461456-105461478 GCATGCAGACGGGCAGGTGCAGG - Intergenic
1013492286 6:110660270-110660292 GCATGCAGGCGAGTGGGTACAGG + Intronic
1014625495 6:123719751-123719773 GTGTGCAGGTGAGCAGGTGCAGG - Intergenic
1014812346 6:125901516-125901538 GCACGCAGGTGAGTGGGTACAGG + Intronic
1014992868 6:128103520-128103542 ACATGCAGATGGGCAGGTGCAGG - Intronic
1016117335 6:140303412-140303434 GCATGCAAATGAGCGGGTGCAGG + Intergenic
1016395643 6:143620946-143620968 GCAACCAGGTGATCAGGGACTGG + Intronic
1016533942 6:145090345-145090367 GCATGCAGATGAGCAGGTGTAGG + Intergenic
1016568906 6:145491321-145491343 GCATGCAGGTGAGCGGGCGCAGG + Intergenic
1016569038 6:145492270-145492292 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1016902193 6:149113773-149113795 GCATGCCGGTGAGCAGGTGCCGG - Intergenic
1017633563 6:156422562-156422584 GCATGCAGACAAGCAGGTGCTGG + Intergenic
1018201490 6:161399500-161399522 GCATGCAGATGAGCAGGTGCAGG - Intronic
1018338841 6:162827803-162827825 GCAAGCAGATGAGCAGTTAGAGG - Intronic
1019051510 6:169187051-169187073 GCATCCTGGAGAGCAGGTCCGGG + Intergenic
1019193787 6:170269334-170269356 CCATACATATGAGCAGGTACAGG - Intergenic
1019604091 7:1899835-1899857 TCCTGGAGGTGAGCAGGGACAGG + Intronic
1020389781 7:7646009-7646031 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1021167551 7:17359758-17359780 GCACGCAGGTCAGCAGGTGCAGG + Intergenic
1021809936 7:24393225-24393247 GCCTTCAGCTGAGCAGGGACAGG - Intergenic
1023754384 7:43402349-43402371 GCATGCAGACGGGCAGGTGCAGG - Intronic
1024615915 7:51111669-51111691 GCATGCAGGGGCCCAGGCACGGG - Intronic
1025849382 7:65233555-65233577 GCATGCAGGTGACTGGGTGCAGG - Intergenic
1026248456 7:68645218-68645240 GCATGCAGATGGGCAGGTGGTGG - Intergenic
1026767994 7:73172555-73172577 GCATGCAGGGGAGTGGGCACGGG - Intergenic
1027044460 7:74982265-74982287 GCATGCAGGGGAGTGGGCACGGG - Intronic
1027079179 7:75220095-75220117 GCATGCAGGGGAGTGGGCACGGG + Intergenic
1027137209 7:75633185-75633207 GCATGCACATGAGTAAGTACTGG - Intronic
1027585180 7:80048919-80048941 GCATGCAGACGGGCAGGTGCAGG + Intergenic
1027618341 7:80451602-80451624 GCAGGCAGGAGAGCATGTGCAGG - Intronic
1027706194 7:81536187-81536209 GCACACAGGTGAGCAGGTGCTGG - Intergenic
1027708574 7:81567495-81567517 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
1028652128 7:93161687-93161709 GAGAGCAGGTGAGCAGGTGCTGG + Intergenic
1028761064 7:94497067-94497089 GCATGCAGGCAAGCGGGTGCCGG + Intergenic
1029016174 7:97317060-97317082 GCACACAGATGAGCAGGTGCAGG - Intergenic
1029388411 7:100258674-100258696 GCATGCAGGGGAGTGGGCACGGG + Intronic
1030176019 7:106654648-106654670 GCAAGAAGGTGAGTAGGTAATGG + Intergenic
1030279583 7:107758639-107758661 GGATGATGGTGAGCAGGTGCTGG - Exonic
1030386100 7:108870249-108870271 GCATGCAGGTGAGCGGGTGCAGG + Intergenic
1030546818 7:110906954-110906976 GAGCACAGGTGAGCAGGTACAGG + Intronic
1031063357 7:117076644-117076666 GCACCCAGGTGAGTGGGTACAGG + Intronic
1031124917 7:117762782-117762804 GAGTGCAGGAGAGCAGTTACAGG - Intronic
1031258116 7:119482384-119482406 GAATGCAGTTGAGCGGGTGCAGG - Intergenic
1031696224 7:124858006-124858028 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1031716072 7:125110060-125110082 GCAGGCAAGAGAGCATGTACAGG + Intergenic
1032440224 7:131937106-131937128 GCAGGCAAGAGAGCATGTACAGG - Intergenic
1032625910 7:133591022-133591044 GCACACAGGTCAGCAGGTGCAGG - Intronic
1032709835 7:134451827-134451849 GCAGGCTGGTCAGCAGGTATCGG - Intronic
1033071699 7:138209095-138209117 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1033514278 7:142090682-142090704 GAATGCTGGTGAGGAGGTTCGGG - Intronic
1033633778 7:143189166-143189188 GCATGCAGGTGAGTGGGTGCAGG + Intergenic
1033767144 7:144506131-144506153 GCATGCAGATGGGCCGGTGCAGG - Intronic
1034377782 7:150661514-150661536 GCATGCACATGAGCAGGTCAGGG + Intergenic
1035299528 7:157887874-157887896 GTATGGTGGAGAGCAGGTACTGG - Intronic
1037258610 8:16982295-16982317 TCATGCAGGTGAGCAGGCGCAGG - Intergenic
1037363474 8:18097953-18097975 ACACACAGGTGAGTAGGTACAGG - Intergenic
1038002056 8:23400357-23400379 GCAGGCAAGAGAGCATGTACAGG + Intronic
1039039753 8:33395832-33395854 GCACGCAGGTGAGTGGGTGCAGG - Intronic
1039075909 8:33690146-33690168 GCATGCAGACGGGCAGGTGCAGG - Intergenic
1039103929 8:33970331-33970353 GCACATAGGTGAGCAGGTGCAGG + Intergenic
1039290401 8:36088544-36088566 GCGTGCAGGTGAGTGGGTGCAGG + Intergenic
1039429439 8:37514395-37514417 GGCTGCCGGAGAGCAGGTACCGG - Intergenic
1039604229 8:38867529-38867551 GGATGCAGGTGAGAGGGAACAGG + Intergenic
1039645456 8:39277709-39277731 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1039661423 8:39471196-39471218 GCGTGCAGGTGAGCGGGTAAAGG - Intergenic
1039769981 8:40675799-40675821 GCATCAACGTGAGCAGGTAGAGG - Intronic
1041252641 8:55949015-55949037 GCAAGCAGGTAAGCTGGTAATGG - Intronic
1041367652 8:57125744-57125766 GCAAGCAGATGGGCAGGTGCAGG - Intergenic
1042077826 8:65015612-65015634 GCACGCAGGAGAACAGGTGCAGG + Intergenic
1042081635 8:65060299-65060321 GCAGGCAGGTGAGCAGGTGCAGG - Intergenic
1042159173 8:65874803-65874825 GCATGCAGATGGGCAGGTTGTGG + Intergenic
1042238768 8:66641117-66641139 GCACACAGGTCAGCAGATACAGG - Intronic
1042445852 8:68884498-68884520 GAATGCAGGTGAGCAGGTGCAGG + Intergenic
1042511765 8:69619785-69619807 GCACGCAGATAGGCAGGTACAGG + Intronic
1042984423 8:74566994-74567016 GCATGCAGATGGGCAGATGCAGG - Intergenic
1043220504 8:77656144-77656166 GCATACAGTTGAGCAGGTGGAGG - Intergenic
1043599857 8:81923888-81923910 GCATGCAGATGAGCAGGTCGTGG - Intergenic
1043702050 8:83301092-83301114 GCATGCAGATGGGCAGGTACCGG - Intergenic
1044022860 8:87128376-87128398 GCATGCAGGAGGGCAGGTGCCGG - Intronic
1044274611 8:90285357-90285379 GCATGCAGGTGAGTGGGTGCAGG + Intergenic
1044325487 8:90853144-90853166 GCATGCAGGTGAGCGGTTACAGG - Intronic
1045442578 8:102228701-102228723 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1045717548 8:105066584-105066606 GCATGCAGGCGGGCAGGTCGTGG + Intronic
1046266678 8:111839397-111839419 GTAGGCAGGTGAGCAGGAGCAGG + Intergenic
1046398812 8:113676613-113676635 GCATGCAGGTGAGTGGGTGCAGG - Intergenic
1047798529 8:128284255-128284277 CAATGCAGGGGAGAAGGTACCGG + Intergenic
1048680061 8:136831586-136831608 GCATGCAGATGGGCAGGTGCAGG + Intergenic
1050330486 9:4540623-4540645 GTCCACAGGTGAGCAGGTACAGG - Intronic
1050803543 9:9645135-9645157 GCACGCAGGTGAGCAGGTGCAGG - Intronic
1050829168 9:9989856-9989878 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1050981136 9:12017701-12017723 GCACACAGGTGGGCAGGTGCAGG + Intergenic
1052216494 9:25972484-25972506 GCAGGTAGGTGAGCAAGTGCAGG - Intergenic
1052438665 9:28464966-28464988 GCACACAGGTGAGAAGGTGCAGG + Intronic
1052459790 9:28747604-28747626 GCATGCAGACGGGCAGGTGCAGG - Intergenic
1053632440 9:39958102-39958124 GCATGCAGGTGAGCAGGTACAGG + Intergenic
1053773320 9:41505429-41505451 GCATGCAGGTGAGCAGGTACAGG - Intergenic
1054211448 9:62292595-62292617 GCATGCAGGTGAGCAGGTACAGG - Intergenic
1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG + Intergenic
1054912293 9:70465628-70465650 GCAGGCAGATGAGCAGGTTGTGG + Intergenic
1055068190 9:72140062-72140084 GCAGGTAGGTGAGGAAGTACAGG - Intronic
1055375410 9:75644781-75644803 GCATGGAGGTGAGCAGGTGCAGG + Intergenic
1055413278 9:76054055-76054077 GCAGGCAGGAGAGCATGTGCAGG + Intronic
1055486335 9:76759892-76759914 GCACGCAGATGGGCAGGTGCAGG - Intronic
1056374255 9:85991360-85991382 GCATGTGGGTGACCAAGTACAGG + Intronic
1056427182 9:86488914-86488936 GCACACAGGTGAACAGGTGCAGG - Intergenic
1057006778 9:91567874-91567896 GACTTCAGGTGAGCAGGTGCTGG + Intronic
1057139944 9:92720285-92720307 TGATGCAGGTGAGCAGGCAGTGG - Exonic
1057702459 9:97373889-97373911 ACAGGCAGGTGAGCTGGTAGTGG + Intronic
1058173045 9:101705593-101705615 GCACGCAGATGAACAGGTGCCGG - Intronic
1058318510 9:103599531-103599553 GCATGCAGGTGAATGGGTTCAGG - Intergenic
1058321487 9:103636679-103636701 GCATGTAGGCGAGCAGGTGCAGG - Intergenic
1060221750 9:121767797-121767819 GCAGGGAGGGGAGCGGGTACAGG + Intronic
1061287846 9:129634322-129634344 ACATACAGGTGAGCAGGGAAGGG - Intronic
1062018362 9:134303796-134303818 GGACGGAGGTGAGCAGGGACAGG - Intergenic
1062280839 9:135750970-135750992 GCAGGCAGGTGAGCAGCTTCAGG - Exonic
1062536043 9:137021565-137021587 GCGTGCAGGTGAGCTGCTCCAGG + Exonic
1185623257 X:1466162-1466184 GCTTGGAGCTGAGCGGGTACAGG + Exonic
1185982295 X:4793171-4793193 GTATGCAGATGAGCAGGTCGTGG - Intergenic
1186056422 X:5654428-5654450 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1186313991 X:8349331-8349353 GCAGGCAAGAGAGCATGTACAGG + Intergenic
1187138566 X:16571435-16571457 GCATGCAGATGGGCAGGTTGTGG - Intergenic
1187324536 X:18274274-18274296 ACATACAGGTGGGCAGGTGCAGG - Intronic
1187707813 X:22025126-22025148 GCATGCAGATGAGCAGGTGCAGG + Intergenic
1188116841 X:26254783-26254805 GCATGCAGGTGCGCAGGTACCGG - Intergenic
1188352751 X:29152121-29152143 GCAGGCAGGAGAGCATGTGCAGG + Intronic
1188438171 X:30186100-30186122 GCCTGCAGGTGAGCTGGTGCAGG - Intergenic
1188526518 X:31093772-31093794 GCACGCAGGTGAACTGGTGCAGG + Intergenic
1189450255 X:41122530-41122552 GCACACAGGTGAGCAGGTACAGG + Intronic
1189675073 X:43453107-43453129 GCACACAGGTAAGCAGGTGCAGG + Intergenic
1190766714 X:53481250-53481272 GCATGCAGATGGGCAGGTTGTGG - Intergenic
1190973362 X:55374851-55374873 GCAGGCAAGAGAGCATGTACAGG + Intergenic
1192052802 X:67742579-67742601 GAATCAAGGTGAGCAGGTCCTGG - Intergenic
1192098471 X:68238770-68238792 GCATGCAGATGGGCAGGTTGTGG + Intronic
1192113949 X:68393100-68393122 GCATGCAGGTGAACAGGTGGAGG - Intronic
1193144626 X:78064260-78064282 GCACGCAGGTGAGTGGGTGCAGG - Intergenic
1193938989 X:87657493-87657515 CAAGGCAGGTGAGCAGGTTCAGG + Intronic
1194620347 X:96163125-96163147 GGATTCAGGTGAGCAGGTGCAGG - Intergenic
1194752206 X:97697498-97697520 GCACACAGATGGGCAGGTACAGG - Intergenic
1194802656 X:98291623-98291645 GCATACAGGCGAGCGGGTGCTGG + Intergenic
1194879012 X:99226342-99226364 GCATGCAGGTGAATGGGTGCAGG - Intergenic
1194979140 X:100422794-100422816 GCATGTAGGTGAGCAGGTGCAGG + Intergenic
1195722397 X:107879016-107879038 GAGTGCAGGTGAGCAGGTGCAGG + Intronic
1196037534 X:111162741-111162763 GTATTCAGGTGAGCAAGTCCTGG + Intronic
1196395850 X:115261161-115261183 GAATGCAGGTGAGTGGGTGCAGG + Intergenic
1197462045 X:126755013-126755035 GCACGCAGGTGAGCAGGTGCAGG + Intergenic
1198084579 X:133270115-133270137 GCATGCAGGTGCTCAGGGACTGG - Intergenic
1198314194 X:135450338-135450360 GCTTGCACGTGCACAGGTACAGG - Intergenic
1198386564 X:136134700-136134722 GCATGCAGATGGGCAGGTTGTGG + Intergenic
1198883457 X:141306845-141306867 GCATGCAGATGAGCAGGTTGTGG - Intergenic
1199337100 X:146630828-146630850 GTGTGCAGGTGAGCAGGTGCAGG - Intergenic
1199380704 X:147168760-147168782 GCATGCAGACAAGCAGGTGCAGG - Intergenic
1199580021 X:149351550-149351572 GCATGCAGATGGGCAGGTCATGG + Intergenic
1199868073 X:151872208-151872230 GCATGGAGGTGGGTAGGGACAGG + Intergenic
1201637962 Y:16146266-16146288 GCACACAGGTGAGCAGGTGCAGG - Intergenic
1201701155 Y:16883668-16883690 GCACACAGGTGAGCAAGCACAGG + Intergenic
1201969072 Y:19771621-19771643 GCATACAGGTGAGCAGGTACAGG - Intergenic