ID: 1119140316

View in Genome Browser
Species Human (GRCh38)
Location 14:72261377-72261399
Sequence CAGGTCATACAAAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119140308_1119140316 -10 Left 1119140308 14:72261364-72261386 CCCTTCCCCACTACAGGTCATAC 0: 1
1: 0
2: 2
3: 11
4: 117
Right 1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119140316 Original CRISPR CAGGTCATACAAAAGGAGGA GGG Intronic
901817003 1:11800037-11800059 TGGGTGATACAAAAGGAGCAAGG + Intronic
902747157 1:18481798-18481820 CATTTCATACAGAAGGCGGAGGG + Exonic
903473629 1:23604796-23604818 GAGGTCATACTGAAGCAGGATGG + Intronic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
909372308 1:74898084-74898106 CAGGTGAGACACAATGAGGAAGG - Intergenic
909666823 1:78143386-78143408 CTGGCCATGCAAAAAGAGGAAGG - Intergenic
916448022 1:164891783-164891805 CAGGTCATTTAAAAAGAGAAAGG - Intronic
918105438 1:181412225-181412247 CAGGCATTAAAAAAGGAGGAAGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
921279473 1:213551332-213551354 CAGCCCAGACAAAAGGGGGAAGG + Intergenic
924421463 1:243913943-243913965 GAGGTCATACTAGAGTAGGATGG + Intergenic
1064713055 10:18146037-18146059 CAGTTCACACAAAAGCAGAAAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1066203465 10:33163939-33163961 TTCCTCATACAAAAGGAGGATGG - Intergenic
1069572313 10:69501760-69501782 CAGGTCGCACAACAGGAGGTGGG + Intronic
1071206874 10:83290223-83290245 GTGGCCATACAAAAGGAGCAGGG - Intergenic
1073959076 10:108905082-108905104 GAGGCCAGAGAAAAGGAGGAGGG + Intergenic
1074138082 10:110644632-110644654 CAGATCATCCAAAAGTAAGAAGG + Exonic
1074792145 10:116900490-116900512 AAAGGCAGACAAAAGGAGGAAGG + Intronic
1080173789 11:29338156-29338178 CAGGTAGTACTAAAGGAGAAAGG + Intergenic
1081804338 11:45882186-45882208 GATGTCATGCAAAAGGACGACGG + Exonic
1082105398 11:48215926-48215948 CAGGACATAGGAAAGGAGAATGG - Intergenic
1082798045 11:57392666-57392688 GAGGTCAAACAAAAGGAGAAGGG + Intronic
1087315217 11:96594419-96594441 CAAGTCATGCAAAAGGATAATGG - Intergenic
1088360713 11:108986077-108986099 CTGGTAATACAAAAGCAGGCAGG - Intergenic
1088897117 11:114086971-114086993 CAGGAAATACCAGAGGAGGAGGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090236526 11:125152331-125152353 CAGCTCATACAAAAGGTGCAAGG - Intergenic
1091853280 12:3718289-3718311 GAGCTCATGCAAAAAGAGGAAGG - Intronic
1093628717 12:21383035-21383057 CAGGTCAGGCAAAAGAAGAATGG + Intronic
1094395497 12:30001042-30001064 CAGGTGATACAAATGAAGCAAGG - Intergenic
1095076248 12:37930294-37930316 CAGGTCACACAACAGGAGTATGG - Intergenic
1095746102 12:45660696-45660718 CATGTTATAGAAAAGGGGGAGGG - Intergenic
1095875093 12:47071409-47071431 CAAGCCAGACAAAAGGAGGCAGG + Intergenic
1098661672 12:73102080-73102102 CAGGTGAGACAAAAGAAGTATGG - Intergenic
1100292042 12:93225037-93225059 CAGGTCATATAAGAGGAAGAAGG - Intergenic
1105432826 13:20352533-20352555 GAGGTCAAATAAAATGAGGATGG - Intergenic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1112574998 13:100627618-100627640 GAGGTCATACAAGAGGATGGTGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1118866798 14:69710778-69710800 AAAGTCATAAAAAAGGAGGTAGG + Intronic
1119113153 14:71994623-71994645 GAGGTCATACAAAAGTAGGGTGG + Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1121542222 14:94736972-94736994 GAGGTCATACTAGAGTAGGATGG + Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1126545633 15:49871122-49871144 CAAGTCATACAAAAAGTGGTAGG - Intronic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130731265 15:86494469-86494491 CAGATCATACAAAACCAGCATGG - Intronic
1131011746 15:89023483-89023505 CAGCTCATACTCAAGGAGGAGGG - Intergenic
1131858403 15:96624866-96624888 CAGGGCATGCAAAAGGAACATGG + Intergenic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133295708 16:4751262-4751284 CAGGCCAGACAAAAGCTGGAAGG + Exonic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1136585737 16:31183472-31183494 CATGTGATACATAAGGAGGTGGG + Intronic
1138479965 16:57296100-57296122 AAGGTCATCCAAAACAAGGAAGG - Intergenic
1140749347 16:78009128-78009150 CAGTTCATACAAAAGAATGCAGG - Intergenic
1141260156 16:82445571-82445593 GAGGTCACACAATAGGAGGCAGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144852940 17:18253193-18253215 CAAGTCAGACAAAATGAAGATGG - Intronic
1145177781 17:20716511-20716533 CAGCTCATACAAAAGCAGAATGG + Intergenic
1145284421 17:21494821-21494843 CAGGTCATAGAAAGAGAGGTGGG - Intergenic
1145393035 17:22470670-22470692 CAGGTCATAGAAAGAGAGGTGGG + Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147689115 17:42304686-42304708 CAGGTCACCCAAGAGGTGGAGGG + Intronic
1149837485 17:59926463-59926485 CAGCTCATACAAAAGCAGAACGG + Exonic
1150081862 17:62247103-62247125 CAGCTCATACAAAAGCAGAATGG - Intergenic
1152041563 17:77906898-77906920 CATGTCTTACAGAGGGAGGATGG + Intergenic
1152093228 17:78258274-78258296 CAGGACACACCAAAGGAGGAGGG - Intergenic
1153178238 18:2403760-2403782 CATGTCCTACTAAAGGTGGAGGG - Intergenic
1154075837 18:11200780-11200802 CAGGTCATAAAAAAGGGACACGG - Intergenic
1155734681 18:29205873-29205895 CAGGTGATACACATGCAGGATGG - Intergenic
1156404384 18:36770491-36770513 CAGATCATAGGAAAGGAGCAGGG - Intronic
1157712783 18:49861429-49861451 CAGGTGATACTAAAGTAGAAGGG - Intronic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1158488145 18:57886760-57886782 CATGTCATACAAAAGCAGTCAGG - Intergenic
1159484272 18:69033884-69033906 CACTTCACACCAAAGGAGGATGG - Intronic
1160786331 19:901623-901645 GAGATGATAAAAAAGGAGGAAGG - Intronic
1161426133 19:4204261-4204283 TAGGTAATAAAAAAGGAGAAGGG - Intronic
1161982111 19:7635390-7635412 AAGCTGTTACAAAAGGAGGAAGG + Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1167495060 19:49812819-49812841 CAGGTCATATGGAAAGAGGATGG - Intronic
1168372130 19:55844623-55844645 GAGGTCATACTAAAGCAGGGTGG - Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
929350818 2:40952223-40952245 CAGCTCAGAAAATAGGAGGAGGG + Intergenic
930616297 2:53598224-53598246 CAGACAGTACAAAAGGAGGAAGG + Intronic
931311476 2:61085204-61085226 CAGGACATACAAAAAAAGTATGG - Intronic
932316538 2:70787956-70787978 CAGTTCATAGTAAAGGAAGAGGG + Intronic
933346491 2:81092659-81092681 AAGGTCATACTAAAGTAGGGTGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937312165 2:120909151-120909173 CACGTCAGCCAAAAGGCGGAGGG - Intronic
937923239 2:127146921-127146943 CAGGTTGTCCAAAAAGAGGATGG + Intergenic
938871092 2:135477411-135477433 GAGGTTATACAACAGGAAGAAGG + Intronic
940901887 2:159133227-159133249 CAGGTCCTTCAAATGGATGAGGG + Intronic
942046444 2:172101938-172101960 CAGGTCCTACCAAAGGAGAGAGG + Intronic
942627948 2:177923474-177923496 CAGCTGAGATAAAAGGAGGATGG - Intronic
945491497 2:210461126-210461148 CAGATCAGAAAAAAGTAGGAAGG - Intronic
945507134 2:210655718-210655740 CAGGTCACAGAACAGAAGGATGG + Intronic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945955580 2:216082908-216082930 TAGGTCCAACAAAAGGATGATGG - Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948810115 2:240470520-240470542 CAGGCCATATGAAAGAAGGAGGG - Intergenic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1173481176 20:43400671-43400693 CAGGTCATACTGGAGTAGGATGG - Intergenic
1175010954 20:55735519-55735541 CAGGTCTTAAAGATGGAGGAAGG - Intergenic
1175398980 20:58689104-58689126 CAGGTCATTCTGAAGCAGGAAGG + Intronic
1175417356 20:58810753-58810775 CATGTCATAGAAATGGAGGCAGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1177607332 21:23398492-23398514 CAAGTCATACAAAAGGACAAAGG - Intergenic
1178846244 21:36176390-36176412 CAGCTCATACACAAGGAGGCTGG - Intronic
1181286465 22:21755963-21755985 GAGGTCATACAAATAGGGGAGGG - Exonic
1182669915 22:31987231-31987253 CAGGTCCTGCCAAAGGAGGGAGG - Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
954886314 3:53877382-53877404 CAAGGCCTAGAAAAGGAGGAGGG + Exonic
956264079 3:67378234-67378256 CAGATCATACTCAAGGGGGACGG - Intronic
958834692 3:99131032-99131054 CAGGTAATACAAAAGAATTAAGG - Intergenic
960954332 3:123021134-123021156 CAGGCTCTACCAAAGGAGGAAGG + Intronic
962902002 3:139769548-139769570 CAGGTCAGAAAACAGGAGGCAGG + Intergenic
964646144 3:158960181-158960203 GAGGTCATACCAGAGTAGGATGG - Intergenic
964990587 3:162806488-162806510 CAGATAATACAAATGGAGGCAGG - Intergenic
965609485 3:170529756-170529778 GAGGTCATACCAAAGTAGAATGG + Intronic
966542286 3:181105625-181105647 CAGGAGATACAAAAGGCGGATGG + Intergenic
968541231 4:1169408-1169430 CAGTTCATCCCAAATGAGGAGGG + Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969336852 4:6516028-6516050 CAGGTCATACTGGAGCAGGATGG - Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
972665242 4:41158935-41158957 CAGGTCATAGACTAGGAGGCAGG - Intronic
972962550 4:44471919-44471941 CAGGTCATCAAAAAGAAGGAAGG + Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
976567206 4:86564680-86564702 AAGGTGGTAGAAAAGGAGGAAGG - Intronic
977179094 4:93851849-93851871 CAGGTAATAGAAAACGAGAAAGG + Intergenic
977200490 4:94109089-94109111 AAGGTCATACTAGAGTAGGATGG + Intergenic
978831854 4:113096204-113096226 CAGCTCATTCAAACGGAAGATGG - Intronic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
984611844 4:181849685-181849707 AATGTCATACAAAAGGACGTGGG - Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987907312 5:24093336-24093358 CAGGTCATATGACAGGAGAAGGG - Intronic
988000576 5:25342746-25342768 CATCTTATACAACAGGAGGAGGG + Intergenic
988827284 5:34950878-34950900 AAAGTCAGACAAGAGGAGGAAGG - Intronic
990333540 5:54750360-54750382 AAGGTCACACTAAAGTAGGATGG + Intergenic
990439390 5:55829555-55829577 AGGGTCACACAAAAGAAGGAAGG - Intergenic
991395927 5:66205398-66205420 CAGGTCATACTAGAGTAGGATGG - Intergenic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
994415429 5:99464010-99464032 CAGGTCATAATTAAGGATGATGG - Intergenic
995353861 5:111214778-111214800 CTGGGCATACAAAAAAAGGATGG - Intergenic
997437726 5:133887122-133887144 CATGTCATACAAAAGAATGGTGG + Intergenic
998174123 5:139890963-139890985 CAGTTCATAAGAAAGGAGAAGGG - Intronic
999668476 5:153937251-153937273 CAGGTCGCACAAATGAAGGATGG + Intergenic
1001182321 5:169531961-169531983 ACGGTCACACAAAAGGAAGATGG - Intergenic
1002864581 6:1109725-1109747 CAGGCCATACAAAAACAGGCTGG + Intergenic
1003014304 6:2455714-2455736 CAGGTCTAGCAAAAGAAGGAGGG - Intergenic
1003565640 6:7219921-7219943 CAGTTGATACTAAGGGAGGAAGG + Intronic
1004475570 6:15968098-15968120 GAGGTCATACTAGAGTAGGATGG - Intergenic
1005386608 6:25291453-25291475 CTGGTCATGCAAAATGAGTATGG - Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008056420 6:46950476-46950498 CAGGTCTTAAAAGAGGAGGTTGG - Intronic
1008378758 6:50820179-50820201 TAGGTCAGACGAAAGGTGGAGGG + Intronic
1009838342 6:69034165-69034187 CAGATTCTTCAAAAGGAGGAAGG - Intronic
1012511345 6:100005458-100005480 CAGCCCATACTCAAGGAGGAGGG - Intergenic
1013000637 6:106018887-106018909 CACCTCACACACAAGGAGGAGGG + Intergenic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1016403381 6:143704797-143704819 AAGGTCATTCAAAACAAGGAAGG - Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1017074441 6:150604484-150604506 CAGGCCATACAAAAACAGGCTGG + Intronic
1017636259 6:156446027-156446049 CAGGTCTTTCACAATGAGGAAGG - Intergenic
1018212603 6:161496719-161496741 AAGGTCATACCAAAGTAGGTTGG + Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019412649 7:913138-913160 CAGTTAATACAAAAGAAGGCCGG - Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019751567 7:2734010-2734032 CAGGTCATAAAAATGTGGGAAGG - Intronic
1019882111 7:3870889-3870911 AAGGTCATAAAAAACAAGGAAGG - Intronic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1023311754 7:38894711-38894733 CAGGTCATACAAAAAGCACAAGG + Intronic
1026322592 7:69280549-69280571 CAGGTTATGGAAAAGGAGCAGGG - Intergenic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031235327 7:119168570-119168592 AGGGCCATACAAAAGGAGGGAGG + Intergenic
1032429757 7:131850925-131850947 CAGGTCATACTAGAGTAGGGTGG - Intergenic
1032481186 7:132248497-132248519 GAGGTCAGTCAAATGGAGGAGGG + Intronic
1033175320 7:139118480-139118502 ATGGTCAGACAAATGGAGGAAGG + Intergenic
1033787759 7:144754437-144754459 CAGCTCATAGACAAGGAGGGAGG - Intronic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1041214456 8:55585928-55585950 GAGGTCATACTAGAGGAGGGTGG - Intergenic
1041933338 8:63310631-63310653 CAGGCCATACAAAAACAGGCAGG - Intergenic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042161375 8:65899304-65899326 CAAGTCACATAAAAGGAGAATGG - Intergenic
1042992613 8:74657402-74657424 CAGGTCATAAAAAAGAATGCTGG - Intronic
1045344640 8:101283086-101283108 CAGGCCAGAAAAAATGAGGAAGG - Intergenic
1047421250 8:124710059-124710081 CAGCTGACACAAAAGGAGGCAGG + Intronic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1053016803 9:34666382-34666404 AGGGTCATACAAGGGGAGGAAGG - Intergenic
1055888680 9:81098471-81098493 CAGACCAGACAAAAGGAAGAGGG + Intergenic
1057131588 9:92657838-92657860 GAGGTCATAGAAAGGGAGGCCGG - Intronic
1058324252 9:103675625-103675647 CAAGTCATTAAAAAGGATGAGGG - Intergenic
1058744487 9:107976626-107976648 GAGGTCACATAAAAGGCGGATGG + Intergenic
1059446389 9:114340835-114340857 CAGGTCATCAAAAACAAGGAAGG + Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1186946462 X:14573887-14573909 AATGTCATACAAAAGGAGGTGGG + Intronic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1188300217 X:28498442-28498464 CAGGTCAGGAAAAAGGAAGAAGG + Intergenic
1188402540 X:29764597-29764619 GAGGACATAAAAAAGGAGGTTGG + Intronic
1188733953 X:33688689-33688711 AAGGCCATCCAAAAGGATGAGGG + Intergenic
1189108911 X:38266678-38266700 CCGGTCATTCAAAAGGAGAAAGG - Intronic
1189826044 X:44918996-44919018 CAGATCATAAAAAGGGAGGGAGG + Intronic
1190346550 X:49342487-49342509 CTGCTCATAAAAAATGAGGATGG + Intronic
1190347796 X:49533515-49533537 CTGCTCATAAAAAATGAGGATGG + Intronic
1190348897 X:49543071-49543093 CTGCTCATAAAAAATGAGGATGG + Intronic
1190349999 X:49552627-49552649 CTGCTCATAAAAAATGAGGATGG + Intronic
1190351102 X:49562180-49562202 CTGCTCATAAAAAATGAGGATGG + Intronic
1190352203 X:49571738-49571760 CTGCTCATAAAAAATGAGGATGG + Intronic
1190353304 X:49581287-49581309 CTGCTCATAAAAAATGAGGATGG + Intronic
1190354410 X:49590831-49590853 CTGCTCATAAAAAATGAGGATGG + Intronic
1190355509 X:49600358-49600380 CTGCTCATAAAAAATGAGGATGG + Intronic
1190636160 X:52435989-52436011 GAGGTCATTCAAATGGAGGAGGG + Intergenic
1190643571 X:52503895-52503917 TAGGTCATTCAAATGGAGGAGGG + Intergenic
1191259162 X:58294333-58294355 CAGGTTATACAAAAAGAGTGTGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1193049174 X:77082976-77082998 CAGGGCATACATAAGTAGCAGGG + Intergenic
1194898933 X:99482843-99482865 CTGGTAATACCAAGGGAGGATGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196704536 X:118705616-118705638 CAGGTTGTACAAAAGTAGGTGGG + Intergenic
1197265613 X:124367136-124367158 CAGATCAGACAACAGGATGAGGG - Intronic
1197314021 X:124941725-124941747 CAAGTCATTAAAGAGGAGGATGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199840235 X:151639002-151639024 CAGACCATACAAAAGGAGTCTGG - Intronic
1199854512 X:151749739-151749761 CAGGTCACACCAAAAGAAGAAGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201396538 Y:13554764-13554786 TGGGTCACACAAAAAGAGGAAGG + Intergenic
1202596606 Y:26547410-26547432 CAGGGCATACGAGAGGTGGAAGG + Intergenic