ID: 1119148536

View in Genome Browser
Species Human (GRCh38)
Location 14:72337538-72337560
Sequence CCATCCAAACATGAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119148526_1119148536 25 Left 1119148526 14:72337490-72337512 CCCTCTCTCATTTCTCCTGATGA 0: 1
1: 0
2: 2
3: 35
4: 464
Right 1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 171
1119148527_1119148536 24 Left 1119148527 14:72337491-72337513 CCTCTCTCATTTCTCCTGATGAC 0: 1
1: 1
2: 1
3: 28
4: 268
Right 1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 171
1119148525_1119148536 30 Left 1119148525 14:72337485-72337507 CCTTGCCCTCTCTCATTTCTCCT 0: 1
1: 0
2: 13
3: 152
4: 1158
Right 1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 171
1119148531_1119148536 10 Left 1119148531 14:72337505-72337527 CCTGATGACCAGGTAGGGTAGAC 0: 1
1: 0
2: 1
3: 7
4: 55
Right 1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 171
1119148532_1119148536 2 Left 1119148532 14:72337513-72337535 CCAGGTAGGGTAGACAGCAACAT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119148536 Original CRISPR CCATCCAAACATGAGCAGTG AGG Intronic
900414060 1:2527092-2527114 CCATGCAAACCAGAGGAGTGGGG + Intergenic
900754698 1:4425594-4425616 GCACCCAGACATCAGCAGTGGGG + Intergenic
902065638 1:13683578-13683600 CCATCTAAACCTGAACAGTGGGG + Intergenic
905501191 1:38439030-38439052 CAATCCAAAGAAAAGCAGTGAGG - Intergenic
913344437 1:117793918-117793940 GCATTAAAACTTGAGCAGTGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917608513 1:176661590-176661612 GCATCCAGCCATGAGCAATGTGG - Intronic
917738842 1:177944308-177944330 ACGTTCAAACATCAGCAGTGAGG + Intronic
918937554 1:190943493-190943515 CCATCCAAACAGGAGTATGGTGG + Intergenic
920291912 1:204929331-204929353 CCATCCAACCCTGAGGAGGGAGG + Intronic
920823794 1:209405342-209405364 CCATCAAACCAAGAGCAGAGCGG + Intergenic
924019004 1:239760684-239760706 CAAACCACACATGAGCAGAGCGG - Intronic
1066628188 10:37431171-37431193 CCATGGAAACATGAAGAGTGAGG + Intergenic
1070011593 10:72480497-72480519 CCATGCAAAACTGAGGAGTGAGG + Intronic
1070523363 10:77274334-77274356 CCTTCCAAAGAAGGGCAGTGAGG + Intronic
1071596943 10:86934850-86934872 CAGGTCAAACATGAGCAGTGTGG + Intergenic
1074339498 10:112613378-112613400 CCATACCAACATAAGAAGTGGGG - Intronic
1075400397 10:122157244-122157266 CCATGGAAACTTGAGCGGTGGGG + Intronic
1077482804 11:2824441-2824463 TCATCCAGACAGGAGCAGGGAGG + Intronic
1080896449 11:36452423-36452445 CCAGAAAAACATGAGCAGGGTGG - Intronic
1093507072 12:19880083-19880105 CCAACTAAAAATGACCAGTGTGG - Intergenic
1097924165 12:65109415-65109437 GTATCCAAACTTGAGAAGTGAGG + Intronic
1100741586 12:97599048-97599070 CCAACTAAACATTAGCAGTATGG + Intergenic
1101238876 12:102818200-102818222 CCATCCCCACATGTGCAGTGAGG + Intergenic
1102589012 12:113943259-113943281 CCCCCAAAACAGGAGCAGTGAGG - Intronic
1102590374 12:113952032-113952054 TCATCCTGAGATGAGCAGTGTGG - Intronic
1104367021 12:128187290-128187312 CCTGCCAAACATGATCACTGAGG + Intergenic
1105698797 13:22917719-22917741 CTATCCAAGAATCAGCAGTGAGG - Intergenic
1108129324 13:47280345-47280367 CCATCCACACATCAGCACTGAGG + Intergenic
1110544834 13:76744615-76744637 CCATCTACACATGAATAGTGGGG + Intergenic
1116124036 14:40758504-40758526 CCATAAAAGCATGAGCAGTGTGG + Intergenic
1118688013 14:68310956-68310978 CCATGCAAAGATGAGGTGTGTGG - Intronic
1118746022 14:68773827-68773849 CCATCTGAACATGAGCTGTGGGG + Intergenic
1119023175 14:71132237-71132259 AAAGCCAAACATGAGAAGTGAGG + Intergenic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1125142770 15:36428978-36429000 CCATCCATACATTATCAATGAGG - Intergenic
1129163476 15:73761173-73761195 GCATCCAAAGTTGGGCAGTGTGG - Intergenic
1134255873 16:12610939-12610961 CCACCCAAACAGGAGAATTGAGG - Intergenic
1134869994 16:17643808-17643830 CCATCAAAATGTGAGCACTGGGG + Intergenic
1136712809 16:32253813-32253835 CCTTTCAGACATGCGCAGTGCGG + Intronic
1136755107 16:32675616-32675638 CCTTTCAGACATGCGCAGTGCGG - Intronic
1136813006 16:33194753-33194775 CCTTTCAGACATGCGCAGTGCGG + Intronic
1136819482 16:33304833-33304855 CCTTTCAGACATGCGCAGTGCGG + Intronic
1136826045 16:33361368-33361390 CCTTTCAGACATGCGCAGTGCGG + Intronic
1136831111 16:33460139-33460161 CCTTTCAGACATGCGCAGTGCGG + Intronic
1137029198 16:35506471-35506493 CCTTTCAGACATGCGCAGTGCGG - Intergenic
1140297000 16:73718457-73718479 CCTGCCAAACAGGAGCAGGGAGG - Intergenic
1142256091 16:89014554-89014576 CCAATTAAAAATGAGCAGTGGGG + Intergenic
1202991583 16_KI270728v1_random:17723-17745 CCTTTCAGACATGCGCAGTGCGG + Intergenic
1203057249 16_KI270728v1_random:935955-935977 CCTTTCAGACATGCGCAGTGCGG - Intergenic
1143162175 17:4878952-4878974 CCATCCAAGTGTGAGCAGTGTGG - Intronic
1144182196 17:12762765-12762787 CCATCCCAACACCATCAGTGAGG - Intronic
1148509436 17:48156079-48156101 CATTCCAAACATCAACAGTGGGG - Intronic
1148914363 17:50962022-50962044 CCAGCTAAAGGTGAGCAGTGGGG - Intergenic
1155160930 18:23195183-23195205 CCATCCAATCATGAGCATGCTGG - Intronic
1157056412 18:44234297-44234319 CTAGCCTATCATGAGCAGTGAGG + Intergenic
1157081565 18:44531064-44531086 CCATTCAAACATGTTCATTGTGG + Intergenic
1158015174 18:52775216-52775238 CCCTAGAAGCATGAGCAGTGAGG - Intronic
1159335331 18:67057134-67057156 TCCTTCAAACATGAGGAGTGTGG - Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1161115336 19:2493670-2493692 CCTTCAAAACATGCTCAGTGAGG - Intergenic
1163642666 19:18470346-18470368 CTACCCCAACCTGAGCAGTGGGG - Intronic
1165173661 19:33911303-33911325 GCATCAAAACATGGACAGTGGGG - Intergenic
1165669354 19:37662406-37662428 ATATCCAAACATGAGAAGAGTGG - Intronic
1166582347 19:43913499-43913521 CCATACAAATGTGAGGAGTGTGG - Exonic
1166582452 19:43914255-43914277 CCATACAAATGTGAGGAGTGTGG - Exonic
1166582497 19:43914675-43914697 CCATACAAATATGAAGAGTGTGG - Exonic
1166587799 19:43966595-43966617 CCATACAAATGTGAGCAATGTGG + Exonic
1166587895 19:43967432-43967454 CCATTCAAATATGAGAACTGTGG + Exonic
1166590776 19:43996548-43996570 CCATTCAAATGTGAGCAATGTGG + Exonic
1166590869 19:43997388-43997410 CCATCCAAATGTGAGGATTGTGG + Exonic
1166592321 19:44010706-44010728 CCATTCAAATGTGAGCAATGTGG + Exonic
1166594359 19:44032272-44032294 CCATTCAAATGTGAGCAGTGTGG + Exonic
1166594392 19:44032692-44032714 CCATACAAATGTGAGGAGTGTGG + Exonic
1166594418 19:44032944-44032966 CCATCCAAATGTGAGGACTGTGG + Exonic
1166600107 19:44086166-44086188 CCATTCAAATGTGAGCAGTGTGG + Exonic
1166602250 19:44107187-44107209 CCATACAAATGTGAGGAGTGTGG + Exonic
1166602305 19:44107691-44107713 CCATACAAATGTGAGAAGTGTGG + Exonic
1166604782 19:44131305-44131327 CCATTCAAATGTGAGCAGTGTGG + Exonic
1166604899 19:44132481-44132503 CCATACAAATGTGAGAAGTGTGG + Exonic
1166609381 19:44176514-44176536 CCATACAAATGTGAGGAGTGTGG + Exonic
1166749906 19:45159711-45159733 TCATCCAGACATGTTCAGTGGGG + Intronic
1166963137 19:46511804-46511826 ACATACAAAAATCAGCAGTGAGG - Intronic
1168251039 19:55142091-55142113 CCAAAAAAACATGAGTAGTGAGG - Intronic
927363705 2:22268758-22268780 CCATCTACACATAAGGAGTGGGG + Intergenic
928166426 2:28975879-28975901 CCATCCCATCATCAGCAATGAGG - Intronic
929371049 2:41223991-41224013 CCATGGAAAGAAGAGCAGTGTGG - Intergenic
930477875 2:51907145-51907167 CCATCCAAACCAGGGCAGTTTGG + Intergenic
935553080 2:104479023-104479045 TCTCCCCAACATGAGCAGTGTGG + Intergenic
935671480 2:105560330-105560352 CCATCCAAACAGTAGCAGTGAGG - Intergenic
944169846 2:196762493-196762515 CCATCCTCACCTTAGCAGTGGGG - Intronic
944503845 2:200389808-200389830 CCAACAAATCATGAGAAGTGGGG - Intronic
944828547 2:203509664-203509686 CCATCCAAACTATATCAGTGGGG - Intronic
945135774 2:206626141-206626163 GCACCAAAACATGAGCAGTAGGG + Intergenic
947982853 2:234425315-234425337 CCCTCCAACCATTACCAGTGAGG - Intergenic
948123874 2:235550656-235550678 CCATCCACACCTGAGGCGTGGGG + Intronic
948616016 2:239199552-239199574 GCCTCCAAACTCGAGCAGTGAGG + Intronic
1169228957 20:3874388-3874410 CCACCTAAACAAGAGCAGAGAGG + Exonic
1170556047 20:17515583-17515605 CTATCCAAACAAGATCAATGAGG - Intronic
1171334993 20:24376269-24376291 CCATCCAGACATGAACTGGGAGG + Intergenic
1173228577 20:41176682-41176704 CAATCAAAACATTTGCAGTGAGG - Intronic
1174094354 20:48076230-48076252 ACAGCCAAACATCAGCAGGGTGG - Intergenic
1174901424 20:54505079-54505101 CAATTCAAACCTGAGCAGTGGGG - Intronic
1175361957 20:58419087-58419109 CCATCCAAGAAGGAGCTGTGGGG + Intronic
1179725426 21:43339015-43339037 CCAGCCACACCTGTGCAGTGAGG - Intergenic
1180200899 21:46223487-46223509 CCATCCAGACATGCCCTGTGTGG + Intronic
1180614147 22:17117022-17117044 CCATCCAAACAATAGAAGGGGGG + Exonic
1182661289 22:31927093-31927115 CCATGGAAACCTAAGCAGTGAGG - Intergenic
1184280002 22:43431995-43432017 CCAGCCAGCCAAGAGCAGTGCGG - Intronic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
953874757 3:46660358-46660380 GCATCTGTACATGAGCAGTGCGG - Intergenic
954223442 3:49168103-49168125 CCTTCCAGACATGAGAACTGGGG + Intergenic
956327678 3:68071386-68071408 CCTCCCAAACATGAGAATTGTGG + Intronic
956729823 3:72186441-72186463 CCAGCCAGACATTTGCAGTGGGG - Intergenic
957142215 3:76375248-76375270 CTACCCAAACATTATCAGTGAGG - Intronic
959314262 3:104782311-104782333 CCATAAAAACAAGAGCAGAGAGG + Intergenic
959934442 3:112014720-112014742 CCATCCAAACATTTAGAGTGTGG - Intergenic
960368124 3:116799233-116799255 TCAACCAAGCATGAGCAGAGTGG - Intronic
961753020 3:129108303-129108325 CCAGCCAAACATGGACAGTCAGG - Intronic
962443746 3:135447267-135447289 CAATCCACAGATAAGCAGTGAGG - Intergenic
963465776 3:145679941-145679963 CCATTCAAACATTAACAATGAGG - Intergenic
963861312 3:150313398-150313420 CAATCCCCACAGGAGCAGTGTGG + Intergenic
964559913 3:157982897-157982919 CCATCCAATCATGAGAAGGCTGG + Intergenic
966086330 3:176071440-176071462 CCATCCAAACTTCTACAGTGGGG + Intergenic
967390928 3:188953440-188953462 CCCTCCAGTCATGAGCAGTGGGG - Intronic
967955523 3:194874789-194874811 AGATCCCAAGATGAGCAGTGGGG + Intergenic
968116140 3:196091390-196091412 ACTTCCAAAAATGACCAGTGGGG - Intergenic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
968897436 4:3412960-3412982 CCCTCCTGACGTGAGCAGTGTGG - Intronic
968897469 4:3413065-3413087 CCCTCCTGACGTGAGCAGTGTGG - Intronic
968932463 4:3588494-3588516 ACCTCCAAACAGGGGCAGTGGGG - Intronic
970730765 4:19100962-19100984 TCATCCAAACATGGTCAGTGTGG - Intergenic
975060229 4:69988117-69988139 CCATCCAAAAATGAGAAGGTGGG - Intergenic
978136716 4:105271170-105271192 CCATACAAACACAAGCTGTGAGG + Intronic
978848409 4:113303472-113303494 CTTTCCAAAAAGGAGCAGTGGGG + Intronic
979201407 4:117983776-117983798 CCATTCAAACACAAGCAATGGGG + Intergenic
981727583 4:147863495-147863517 CCATCCATCCATGGGCATTGGGG + Intronic
982253184 4:153427789-153427811 ACATCCAAACATGAACATTTGGG - Intergenic
982636326 4:157901360-157901382 CCATCAAAAAATGAGCAAAGGGG - Intergenic
984510576 4:180673704-180673726 ACAGCCAAATAGGAGCAGTGAGG + Intergenic
984716081 4:182926534-182926556 CCATGCAAACATGGGCAGGGAGG + Intergenic
988558062 5:32255328-32255350 CCATACAAAGATTAACAGTGTGG + Intronic
990132644 5:52606276-52606298 CCATCCAATAATGAGCTCTGCGG + Intergenic
992746909 5:79829365-79829387 CCTTCCAATCCTGAACAGTGGGG - Intergenic
994125025 5:96159283-96159305 CCATCCCAGCATGAGGAGGGAGG - Intergenic
994658922 5:102629904-102629926 CCATCCAAACATTAACACTCTGG - Intergenic
996675564 5:126171344-126171366 GCATTCAAACATTAGTAGTGGGG - Intergenic
997605535 5:135173342-135173364 CCATCCAAATATGAGCCATGGGG - Intronic
1001971914 5:175963089-175963111 ACCTCCAAAGATGAGCAGTTAGG - Intronic
1002245528 5:177880689-177880711 ACCTCCAAAGATGAGCAGTTAGG + Intergenic
1005656315 6:27941899-27941921 CCATCCAATAATAAGCAGTCAGG + Intergenic
1010011765 6:71055903-71055925 CATTCCAAACTTGAGCAATGAGG + Intergenic
1012947817 6:105486762-105486784 CCATGCAAACATAGGCAGTGAGG + Intergenic
1013893870 6:115061266-115061288 CTATTCAAATATGAGCAGTTTGG + Intergenic
1019027807 6:168985828-168985850 CCATCCATACTTAAGCAATGAGG - Intergenic
1019494236 7:1330210-1330232 ACATCCACACATGTGCAGCGTGG + Intergenic
1021784456 7:24138132-24138154 CCAGTCAGACATGAGCAGAGCGG + Intergenic
1022815531 7:33910424-33910446 CCAAGCACACATGAGAAGTGTGG + Intronic
1023150795 7:37199747-37199769 ACATCCAAACTGGTGCAGTGGGG - Intronic
1024785678 7:52904330-52904352 CCATCTAAAGATGAGAAGTCTGG + Intergenic
1024997235 7:55281173-55281195 ACATACAAAAATCAGCAGTGAGG + Intergenic
1026622620 7:71963460-71963482 AAATACAAACATGAGCTGTGTGG - Intronic
1028947881 7:96601449-96601471 CTCTATAAACATGAGCAGTGAGG + Intronic
1030945058 7:115708153-115708175 CCTTCGGATCATGAGCAGTGTGG - Intergenic
1035227835 7:157443329-157443351 CCATCCGCACATGGGCTGTGGGG + Intergenic
1035520346 8:271180-271202 CCAACCAAAGATCTGCAGTGGGG + Intergenic
1035983950 8:4404489-4404511 TGATACAAAGATGAGCAGTGGGG + Intronic
1037270711 8:17126805-17126827 CCATCCAAACCTAAACTGTGTGG - Intergenic
1038478096 8:27883043-27883065 CCATGGAAACATCAGCAATGTGG + Intronic
1038546140 8:28427008-28427030 CCACCAGAACATGTGCAGTGTGG - Intronic
1041519948 8:58744819-58744841 CCATCCTACCATGTGCAATGTGG - Intergenic
1046045277 8:108956537-108956559 CCATCCATCCATGAGGAGCGTGG - Intergenic
1047404001 8:124569779-124569801 CCATTGAAACATGAGCAGATTGG - Intronic
1047606723 8:126481965-126481987 CCCTGCAAACATAAGGAGTGCGG - Intergenic
1048279618 8:133095388-133095410 CAGTCCAAACATGGGCACTGAGG + Intronic
1049408880 8:142463710-142463732 CCACCCAAGCCTGAGCAGGGAGG - Intronic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1053165860 9:35843053-35843075 CTATCCAAACATGAACTGTGTGG - Intronic
1053182057 9:35981029-35981051 CTATCCCAAAGTGAGCAGTGTGG - Intergenic
1054457663 9:65443402-65443424 ACCTCCAAACAGGGGCAGTGGGG + Intergenic
1055700991 9:78945782-78945804 GCATCAAAACATGAAAAGTGTGG - Intergenic
1057395628 9:94677331-94677353 CATCCCAAACACGAGCAGTGAGG + Intergenic
1058807093 9:108603245-108603267 CAAAGCAAACAAGAGCAGTGGGG + Intergenic
1062480393 9:136748281-136748303 CCAGACCAGCATGAGCAGTGGGG - Intronic
1186616885 X:11198138-11198160 CCTTCCAAAAATGAGGAGTGGGG - Intronic
1189377727 X:40478737-40478759 CCACCCAAATCAGAGCAGTGGGG + Intergenic
1189972884 X:46435724-46435746 CCATTCAATCATGAGCATTATGG + Intergenic
1192569106 X:72188081-72188103 GCATCCAATCATGTGAAGTGGGG + Intronic
1195460100 X:105114849-105114871 CTATGGAAACTTGAGCAGTGAGG + Intronic