ID: 1119151336

View in Genome Browser
Species Human (GRCh38)
Location 14:72362483-72362505
Sequence ATGGCTCAACTGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119151330_1119151336 -2 Left 1119151330 14:72362462-72362484 CCATGAGGCCATAGTCATCTGAT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG 0: 1
1: 1
2: 3
3: 31
4: 286
1119151332_1119151336 -10 Left 1119151332 14:72362470-72362492 CCATAGTCATCTGATGGCTCAAC 0: 1
1: 0
2: 0
3: 16
4: 107
Right 1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG 0: 1
1: 1
2: 3
3: 31
4: 286
1119151327_1119151336 29 Left 1119151327 14:72362431-72362453 CCGGCAATCTGGGCAGTTCTGCT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG 0: 1
1: 1
2: 3
3: 31
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119151336 Original CRISPR ATGGCTCAACTGAGGCTGGA GGG Intronic
901137235 1:7005879-7005901 GTGGCTCAACAGGGTCTGGAGGG + Intronic
901343318 1:8515387-8515409 GTGGCTCACCTGAGGCAGGCAGG + Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
904055267 1:27665829-27665851 ATGTCTGAACTGAGTCTGGAAGG + Intergenic
904115086 1:28155776-28155798 AAGGATCAATTGAGCCTGGAAGG + Intronic
904315563 1:29658058-29658080 CTGGCTCAGCTGGGGCTGGATGG - Intergenic
904353759 1:29925324-29925346 CAGGCTCTACTGGGGCTGGATGG - Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
905010536 1:34743963-34743985 AAGGCTTGACCGAGGCTGGATGG - Intronic
905092013 1:35437268-35437290 ATGCCTCTTCTGAGGCAGGAGGG - Intronic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
905405851 1:37731903-37731925 CTGGCTCAGCTTAGCCTGGATGG - Intronic
906105106 1:43286819-43286841 ATGGTAGAACTGTGGCTGGAAGG + Intergenic
907217534 1:52878292-52878314 GTGGCTTGACTGGGGCTGGAGGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907326641 1:53642651-53642673 TTAGCTCATGTGAGGCTGGAAGG - Intronic
907451081 1:54546334-54546356 ATGGCTAAACTGAGGCCCGGAGG - Intronic
909289510 1:73864592-73864614 AGGGCTTACTTGAGGCTGGAGGG + Intergenic
910788415 1:91025240-91025262 AGGGCCCACCTGAGGGTGGATGG - Intergenic
912468652 1:109891681-109891703 ACATCTCAGCTGAGGCTGGAGGG + Intergenic
912895103 1:113578071-113578093 ACAGCTCAACTGGAGCTGGAGGG + Intronic
913249340 1:116899423-116899445 ATGGCTCAATAGAGGTTGGGTGG + Intergenic
913327316 1:117638234-117638256 GTGCCTCACCTGAGGCTAGAAGG - Intergenic
915249981 1:154581015-154581037 AAGGAACAACTGAGGCTAGAAGG - Intergenic
915662536 1:157416051-157416073 CTGGCTAAACTGAGGCTTGAGGG - Intergenic
915756142 1:158261797-158261819 ATGTGTCATCTGAGTCTGGATGG + Intergenic
917115700 1:171601041-171601063 ATGGCTTCACTCAGGCTGGCTGG - Intergenic
917218919 1:172706673-172706695 AGGCTTCCACTGAGGCTGGAGGG - Intergenic
921139295 1:212290841-212290863 ATGGCTAAACTGAAGTTGAAAGG - Intronic
921670767 1:217921515-217921537 ATGAATAAACTGAGGATGGAAGG + Intergenic
922444257 1:225683288-225683310 ATGACTTATCTGAGGCTGAAGGG + Intergenic
1063503389 10:6574877-6574899 ACGGCTCAACTGAGACCTGAAGG - Intronic
1064986452 10:21215748-21215770 AAGGATCAACTGAGCCTGGGAGG - Intergenic
1065535679 10:26712805-26712827 CTGGGGCCACTGAGGCTGGAGGG - Intronic
1067919453 10:50438491-50438513 CTGTCTTACCTGAGGCTGGATGG - Intronic
1068572904 10:58650608-58650630 ATGGCTCAAATGGGGCTGTCAGG + Intronic
1069678747 10:70268560-70268582 CTGGCTCAGCTGGGGCTGGGAGG + Intronic
1070100101 10:73377699-73377721 AAGGATCACCTGAGCCTGGAAGG - Intronic
1070231796 10:74575474-74575496 ATGGCTGAACTAACCCTGGAGGG + Intronic
1070362190 10:75701401-75701423 TTGGCTAAAATCAGGCTGGAGGG - Intronic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070399282 10:76038941-76038963 GAGGCTCAACTGGGGCTGGATGG + Intronic
1072192041 10:93083922-93083944 AAGTCTTGACTGAGGCTGGAGGG + Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1072975367 10:100052788-100052810 GAGGCTCACCTGAGCCTGGAAGG + Intronic
1073614923 10:104984055-104984077 GTGGCTCCACTGAGGGTGGAAGG - Intronic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075852609 10:125601666-125601688 ATGGCTCAACTGGGGATCCAGGG + Intronic
1075966332 10:126614997-126615019 CTGGCTTGACTGAGGCTAGATGG + Intronic
1077280610 11:1743449-1743471 ATGGCTGAATGGAGGATGGATGG + Intronic
1080499988 11:32861467-32861489 AAGGGTCAACCGAGCCTGGAAGG + Intergenic
1080872928 11:36252573-36252595 ATGGGGAAACTGAGGCTTGAGGG - Intergenic
1081802508 11:45869710-45869732 ATGACCCAACTGAGGCAGGAGGG + Exonic
1081935140 11:46899018-46899040 CTGGCACTGCTGAGGCTGGAGGG + Exonic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083491732 11:63019018-63019040 CTGCCTCCTCTGAGGCTGGAGGG - Intergenic
1083599701 11:63939200-63939222 AGGGGTCACGTGAGGCTGGAGGG - Intronic
1085270849 11:75269087-75269109 GTGGCAGAACTGGGGCTGGAGGG - Intronic
1085531493 11:77194722-77194744 ATGGCCCCACAGAGGCTGCAAGG - Intronic
1088225957 11:107620539-107620561 ATGGCTAAAGTCAGACTGGATGG - Intronic
1089000765 11:115050346-115050368 ATGGCTCCACTGCCGATGGAAGG + Intergenic
1089365992 11:117921487-117921509 ATGGGGCAGCTGGGGCTGGATGG - Intronic
1091402580 12:189727-189749 ATGCCTCTTCTGTGGCTGGAAGG - Intergenic
1091463474 12:663681-663703 ATGGCTCCGCTGGGACTGGAAGG - Exonic
1091563767 12:1633123-1633145 CTGCCCCAAGTGAGGCTGGAAGG - Intronic
1091888562 12:4034065-4034087 ATGGCAGAACTGGAGCTGGAAGG + Intergenic
1092824458 12:12385436-12385458 CTGCTTCAACTGAGGCAGGAAGG + Intronic
1093161524 12:15752500-15752522 AAGGCTCAACTTAGGCTAGAGGG - Intronic
1093224580 12:16466205-16466227 ATGGCTGTACTGAGCCTCGAAGG + Intronic
1093767345 12:22980237-22980259 ACGGCTCAACTGGAGCTGAATGG + Intergenic
1096311819 12:50528015-50528037 ATGGATCACCTGAGCCTGGGAGG - Intronic
1096594430 12:52685587-52685609 CGGGCTCACCTGAGGCTGGAGGG + Intergenic
1096666218 12:53167362-53167384 ATGGTTGAGCTGAGACTGGAAGG - Intronic
1097182439 12:57179046-57179068 AGTGAGCAACTGAGGCTGGAGGG + Intronic
1098197981 12:68022435-68022457 GCAGCTTAACTGAGGCTGGATGG - Intergenic
1101726235 12:107390659-107390681 ATGGTACTACTGAGGGTGGAGGG + Intronic
1103073046 12:117960566-117960588 ATGGCTCAACTGTGGCTGGAGGG - Intronic
1103960364 12:124605665-124605687 GGGGCTCAGCTGGGGCTGGATGG - Intergenic
1104034358 12:125088039-125088061 ATGGCTCACCTGAACCTGCAGGG + Intronic
1104074907 12:125380487-125380509 GTGATTCATCTGAGGCTGGAAGG - Intronic
1104840043 12:131819438-131819460 ATTGCTCAACTGTGGCTAAAAGG + Intergenic
1107430510 13:40336196-40336218 ATGGCTCAGCTGGAGCAGGATGG - Intergenic
1110812994 13:79830846-79830868 ATGACTCAACTGAGGCTACAGGG - Intergenic
1115621999 14:35149937-35149959 ATTGCTCAACTGAACCTGGGAGG - Intronic
1115720338 14:36153974-36153996 ATGGGTCACCTGAGCCTGGGAGG + Intergenic
1116818508 14:49604983-49605005 AAGGATCACCTGAGCCTGGAAGG - Intronic
1118408727 14:65453635-65453657 ATGTCTCTGCTGTGGCTGGATGG + Intronic
1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG + Intronic
1119339540 14:73865184-73865206 ATGGCTCAATCCAAGCTGGAAGG + Intronic
1119366420 14:74095688-74095710 ATGCCTCAACTGAACTTGGAAGG - Intronic
1121101418 14:91253066-91253088 ATGGCCCAACGGAGGCAGCAGGG - Intronic
1121258635 14:92550019-92550041 ATGGCTGATCTGATGCTGGTTGG + Intronic
1122299798 14:100725189-100725211 CTGGCTCCAAGGAGGCTGGAGGG - Intergenic
1122312226 14:100804486-100804508 AGGGCTCCACTGTGGGTGGATGG - Intergenic
1122412054 14:101530638-101530660 ATGAGTCAACTGTGGGTGGATGG - Intergenic
1122531995 14:102434768-102434790 GGGGCCCAGCTGAGGCTGGAAGG - Exonic
1122545456 14:102519376-102519398 ATGGATCACCTGAGCCTGGGAGG + Intergenic
1122985105 14:105208302-105208324 ACGGCCCGCCTGAGGCTGGAGGG - Intergenic
1123780522 15:23622460-23622482 ATGCCTCAACTGAGCTTTGAGGG - Intronic
1124435883 15:29648979-29649001 ATGGCTCAACTTTGGGTGAAAGG - Intergenic
1124951472 15:34325729-34325751 ATGCTTTAACTGAGGCTGAAAGG + Intronic
1126667549 15:51089027-51089049 TGGGCTCAACTGAGGCTGTTGGG + Intronic
1127457212 15:59165934-59165956 CTGGCTGAACTGTGGCAGGATGG + Intronic
1127566773 15:60196962-60196984 GTGGATCACTTGAGGCTGGAGGG + Intergenic
1127909094 15:63401235-63401257 GTGGCTCAACTGGGGTTGGCTGG - Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128866704 15:71119864-71119886 ATGGGGAAACTGAGGCTGGGTGG - Intronic
1129484937 15:75861800-75861822 ATGGCTTAACTGGGGCTAGTTGG + Intronic
1132311300 15:100859920-100859942 AAGGCTTGACTGGGGCTGGAGGG - Intergenic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1137554177 16:49460369-49460391 ATGGGGCAACTGAGGCTTAAAGG + Intergenic
1137667566 16:50260672-50260694 AAGGCTTGACTGGGGCTGGAGGG + Intronic
1137788802 16:51157108-51157130 ATAGCTCAGCTGAGACTTGAGGG - Intergenic
1139708843 16:68761118-68761140 AGGGCTCAACAGAGCCTGGCAGG + Intronic
1140318347 16:73921821-73921843 CTGGCTTGACTGGGGCTGGATGG - Intergenic
1141624790 16:85255360-85255382 ATGGGGAAACTGAGGCTGGGAGG - Intergenic
1141659381 16:85433739-85433761 ATGGATCAATGGATGCTGGATGG + Intergenic
1141722639 16:85765314-85765336 CTGCCTCAGCTGAGGATGGAGGG + Intergenic
1141891275 16:86928315-86928337 ATGCCCCAACTGAGGCTCAAAGG - Intergenic
1142043426 16:87909950-87909972 ATGGGGAAACTGAGGCTAGAAGG - Intronic
1143251359 17:5525539-5525561 ACAGCTCACCTGAGCCTGGAAGG - Intronic
1144996793 17:19275146-19275168 GTGGGTCAACTGTGGCTGGGGGG + Intronic
1145098564 17:20053726-20053748 AAGGCTCAACTGGGGCCGGAGGG - Intronic
1145714149 17:27003698-27003720 GGGGCTTACCTGAGGCTGGAGGG - Intergenic
1146683521 17:34825123-34825145 ATGGCTGAAGTGAAGTTGGAGGG - Intergenic
1146700610 17:34956429-34956451 ATGGAATCACTGAGGCTGGAGGG - Intronic
1147146668 17:38489520-38489542 ATGGCACAACTGAAGCCGGCTGG - Intronic
1150613651 17:66752690-66752712 ATGGCTCTGCTGGGGCTGGAGGG + Intronic
1151700904 17:75742148-75742170 ATGGCTGGGCTGAGGCTGCAGGG + Intronic
1151903708 17:77034466-77034488 ATGGATCCACTGAGGCTCCAGGG + Intergenic
1152134186 17:78494382-78494404 CTCTCTCAACTGAGGCTGGGGGG - Intronic
1152989073 18:346064-346086 AAGGCTTGACTGTGGCTGGAGGG - Intronic
1155959883 18:31985344-31985366 ATGGATCAACTGAGGTGGAAAGG - Intergenic
1156024083 18:32631587-32631609 TGGGTTCACCTGAGGCTGGATGG + Intergenic
1157534880 18:48450888-48450910 ATGACTCATGTGAGGATGGATGG + Intergenic
1160123392 18:76149576-76149598 TTGGCTCAGCAGAGGATGGAAGG - Intergenic
1161130636 19:2586500-2586522 AGAGCTCAGCTGAGGCTGAAAGG + Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163625383 19:18386555-18386577 ATGGGGCAACTGAGGCTCAAAGG - Intronic
1165700582 19:37933994-37934016 ATGGCTCAACTGTGCCTGGCTGG - Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1166816664 19:45550482-45550504 ATGGCTGAGCAGAGGCTGGGAGG - Intronic
1166933641 19:46317594-46317616 ATGTCTGAGCTGAGACTGGAAGG - Intronic
1167278506 19:48552944-48552966 ATGGGGAAACTGAGGCTGGGAGG + Intronic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167769915 19:51508659-51508681 CTGGAGCATCTGAGGCTGGAAGG - Intergenic
1168310802 19:55459640-55459662 GTGGCTGGGCTGAGGCTGGAGGG - Intronic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926850172 2:17187942-17187964 ATGAATAAACTGAGGATGGAAGG + Intergenic
926944316 2:18170487-18170509 AGGGCTGAACTGATGCTTGAAGG + Intronic
927151547 2:20199094-20199116 GTGGCTGAACTGGGTCTGGAAGG - Intergenic
927240690 2:20917451-20917473 TTGGCTTCACTGTGGCTGGAGGG + Intergenic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930187668 2:48426535-48426557 ATGGTGCAACTATGGCTGGAAGG - Intergenic
931387420 2:61809993-61810015 GTGGCTTGACTGGGGCTGGAAGG - Intergenic
931764168 2:65439942-65439964 CTGGCTCAGCTAGGGCTGGATGG + Intergenic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
933254433 2:80064560-80064582 GTGGCTCAGCTGGGGCTGGATGG + Intronic
934999493 2:98999836-98999858 GAGGATCAACTGAGCCTGGAAGG - Intronic
935852829 2:107241856-107241878 ATGGCTCCACTGAGCGGGGATGG + Intergenic
937857573 2:126683582-126683604 ATAGCTCAACTGAGGCAGATTGG + Intronic
937971284 2:127551324-127551346 AAGCCACAACTGGGGCTGGAGGG + Intronic
938916325 2:135944723-135944745 AAGGCTCTTCTGAGGCTTGAAGG + Intronic
939123741 2:138150034-138150056 ATGGCTCACCTCAGGGTGAAAGG - Intergenic
940517140 2:154697428-154697450 CAGGCTCAACTGAGGCTCGGAGG + Intergenic
940890007 2:159026355-159026377 AAGGATCAGCTGAGGCTGCAGGG - Intronic
942221764 2:173775837-173775859 CTGGCTGGTCTGAGGCTGGAAGG - Intergenic
942969316 2:181938661-181938683 ATGGATCATCTGAGTCTGGGAGG - Intergenic
943009962 2:182435346-182435368 ATGGCTGAACAGGGGTTGGAAGG + Intronic
943731366 2:191306602-191306624 AAGGCTCATCTGAGGATGGGAGG + Intronic
947740261 2:232481688-232481710 ATGGCCTAACTGGGGCTGGTGGG - Intronic
947952576 2:234160923-234160945 AGTGCTCTACTGAGGCAGGAGGG + Intergenic
948906732 2:240983213-240983235 ATGGGGAAACTGAGCCTGGAGGG + Intronic
949046324 2:241874138-241874160 GAGGCTACACTGAGGCTGGAGGG - Intergenic
1170533503 20:17317390-17317412 ATGGGTCAACTGGGTCTGGAAGG - Intronic
1171419810 20:25010526-25010548 GTGGCTGAACTGAGTCTTGAGGG - Intronic
1172315224 20:33948791-33948813 ATGTCTCTACTAAGGCTGGAGGG - Intergenic
1173088534 20:39948293-39948315 ATGGCTTGGCTGAGGCTGGGTGG + Intergenic
1173396715 20:42687120-42687142 ATGGCTCATCGGTGGCTGGTTGG - Intronic
1174514202 20:51078742-51078764 ATGGGGCAACTGAGGCTTAAAGG - Intergenic
1174546605 20:51330606-51330628 AGGGCTCAACTGGGCCTGGAGGG - Intergenic
1175183719 20:57165997-57166019 GAGGACCAACTGAGGCTGGACGG + Intergenic
1179193677 21:39144725-39144747 CTGGCTGAGCTGAGGCTGGCTGG - Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179919345 21:44499188-44499210 ACGGGTAAACTGAGGCTGGGAGG + Exonic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1181090824 22:20471341-20471363 ATGCCTCACCTGAAGCTGGCAGG + Exonic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1182277478 22:29199955-29199977 ATGTCTGAGCTGAGACTGGATGG + Intergenic
1182388633 22:29970421-29970443 GAGGATCAACTGAGCCTGGAAGG - Intronic
1182746578 22:32610435-32610457 ATTGGTCATCAGAGGCTGGAAGG - Intronic
1183281147 22:36933387-36933409 ATGGGGCAACTGAGGCTAGGAGG + Intronic
1183362217 22:37388656-37388678 ATTGCCCAACTGAGGCTGGAGGG - Intronic
1184381740 22:44149084-44149106 ATGGGGAAACTGAGGCTGGGGGG - Intronic
1184702795 22:46188077-46188099 GTGGCTCAGCTATGGCTGGATGG - Intronic
1184717239 22:46289157-46289179 ATGAGCAAACTGAGGCTGGAAGG + Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
951952255 3:28213270-28213292 ATGACTCAGCTGTGGCTGGAGGG + Intergenic
952845623 3:37685703-37685725 ATAGCTTAAATGAGGCTGGAAGG - Intronic
953006256 3:38982090-38982112 CTGGAACACCTGAGGCTGGATGG - Intergenic
953458566 3:43063172-43063194 AGGGCTCTACCCAGGCTGGAGGG + Intergenic
953520584 3:43638952-43638974 AAGGCTTGACTCAGGCTGGAGGG + Intronic
954674249 3:52306980-52307002 AAGGCCCAACTGGGGGTGGAAGG + Intergenic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955744853 3:62130142-62130164 ATGGTTCCACTGAGGCTGGATGG + Intronic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
959659149 3:108845937-108845959 ATTACTCACGTGAGGCTGGAAGG + Intronic
960255897 3:115511311-115511333 ATGTGACAACAGAGGCTGGAGGG + Intergenic
960266689 3:115628189-115628211 AAGGCTCAACTAAGACTAGAAGG - Intronic
962841416 3:139236089-139236111 TTGGCTCATCTCAGGCTGGGTGG + Intronic
967053592 3:185807839-185807861 ATGGCTCAGCTGGGGCTGGAAGG - Intronic
968602495 4:1516969-1516991 AGGACTCACCTGAGGCTTGAGGG + Intergenic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969348756 4:6585747-6585769 AAGGCTGGACTGGGGCTGGAGGG + Intronic
970056623 4:11980682-11980704 GAGGCTCAACTGAGGCTAGAGGG + Intergenic
970583606 4:17494891-17494913 AAGGCTCTGCTGAGGATGGAAGG + Intronic
971949963 4:33332283-33332305 ATTGCAGAACCGAGGCTGGAGGG + Intergenic
973337750 4:48973450-48973472 ATGTCTCCAATGAGGCTGAAGGG + Intergenic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
977809830 4:101346521-101346543 ATGCCCCAAGTGAGGCTGGGTGG + Intronic
979566312 4:122157686-122157708 GGGGCTCAACTGGGGCTGGAAGG + Intronic
979963622 4:127050940-127050962 ATGGTTCACCTGAGACTTGAAGG - Intergenic
982116658 4:152103955-152103977 ATTGCTCCAGTGAGCCTGGATGG + Intergenic
982235357 4:153247034-153247056 AGGGCAAAACTGACGCTGGAAGG + Intronic
983867917 4:172790174-172790196 AGGGCCCAGCTGAGGCTGAAGGG + Intronic
983933922 4:173485427-173485449 ATGGCTTACATGAGGCTGAATGG - Intergenic
984293263 4:177822237-177822259 AAGCCCCATCTGAGGCTGGAGGG - Intronic
985543610 5:498382-498404 GTGGCTGGACTGATGCTGGAAGG - Intronic
985872944 5:2572207-2572229 AAGGCTCAAAGGAAGCTGGAAGG + Intergenic
986649111 5:9946492-9946514 CAGACTCAACTGAGTCTGGAAGG - Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
987900690 5:24007623-24007645 AGGGCTTACTTGAGGCTGGAGGG - Intronic
988785959 5:34565525-34565547 ATGTCTCAACTGAGGCAAGGGGG - Intergenic
988789982 5:34598820-34598842 ATTTCTCAAGTGAGGCAGGAAGG + Intergenic
989778294 5:45234663-45234685 AGGGCTTAGTTGAGGCTGGAAGG - Intergenic
990128652 5:52551448-52551470 GCCACTCAACTGAGGCTGGAGGG + Intergenic
993470426 5:88301134-88301156 AAGGCTTAACTGGGACTGGATGG - Intergenic
998014459 5:138721211-138721233 AAGGCTTGACTGGGGCTGGAGGG + Intronic
998261704 5:140636645-140636667 ATGGCTCTCCAGGGGCTGGATGG + Intergenic
998900967 5:146853866-146853888 ATGGCTAAACTGAGACCTGAAGG - Intronic
999829247 5:155303428-155303450 ATGGAGGAACTGAGACTGGAGGG - Intergenic
999976777 5:156919684-156919706 ATGGGAAAACTGAGGCTGCAGGG + Intronic
1000840511 5:166212208-166212230 ATGGTACAGCTGAGGATGGATGG - Intergenic
1002530364 5:179840920-179840942 ACGGCTGCACGGAGGCTGGACGG + Exonic
1005148814 6:22723780-22723802 GTGGTTCAACTCAGGCTGGAGGG - Intergenic
1005228849 6:23675472-23675494 CTAGCTCATCTGAGGCGGGAAGG - Intergenic
1006121470 6:31809129-31809151 AGGACTCAACTGGGGGTGGAGGG - Intergenic
1007767642 6:44170384-44170406 AAGGCTCGCCTGGGGCTGGAGGG + Intronic
1007817124 6:44532426-44532448 GTGGCAGAGCTGAGGCTGGATGG + Intergenic
1007817831 6:44537227-44537249 ATGGCTGAGCTGAGAATGGAGGG - Intergenic
1007848767 6:44783146-44783168 AAGGCTTGACTGAAGCTGGATGG - Intergenic
1008103996 6:47423519-47423541 TTGGATCAACTGAGGCTGTTTGG + Intergenic
1008617500 6:53240693-53240715 AAGGTTCAACTGGGGCTGGTGGG + Intergenic
1008784617 6:55152032-55152054 ATGGAACAACAGAGCCTGGATGG - Intronic
1010724518 6:79318104-79318126 ATGGAGCAACAGAGCCTGGATGG - Intergenic
1012408916 6:98933489-98933511 AATCTTCAACTGAGGCTGGATGG + Intronic
1012549926 6:100456808-100456830 ATGGCTCAACTAAGCACGGAGGG - Intronic
1014951824 6:127564974-127564996 ATGACTAGACTGAAGCTGGATGG + Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1016931627 6:149416563-149416585 ATGGAACAACAGAGCCTGGATGG + Intergenic
1018910385 6:168098230-168098252 AAGGCACCACTGAGGCTGGAAGG - Intergenic
1021280503 7:18711167-18711189 ATGGGGCAACTGAGGCTTTAAGG + Intronic
1023017690 7:35983456-35983478 ATGGCTTACCTGGGGCTGGAGGG + Intergenic
1024056156 7:45660909-45660931 AGGGCTCAATTGAGGGTGTAGGG + Intronic
1024112564 7:46162019-46162041 ATGTAACAAATGAGGCTGGAAGG + Intergenic
1025050984 7:55734502-55734524 ATGGCTCTGATGTGGCTGGAAGG - Intergenic
1028240386 7:88413123-88413145 ATGACTCATCTGAGACTGGAAGG + Intergenic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1030610187 7:111680518-111680540 ATAGCTCAACTTAGTCTAGAAGG - Intergenic
1030950719 7:115788125-115788147 ATGACTGAACTGAAGATGGAAGG + Intergenic
1034214681 7:149396168-149396190 AAGGCTTGACTGGGGCTGGAGGG - Intergenic
1035185277 7:157121406-157121428 AAGGCTCAACGGAGGCAGGTGGG + Intergenic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1035867950 8:3104928-3104950 GTGGATCACCTGAGGCTGGGAGG - Intronic
1037683431 8:21117646-21117668 ATGTTTGAACTGAGCCTGGAAGG - Intergenic
1038981128 8:32760851-32760873 TTGACTTAACTGAGGCTGGAAGG - Intronic
1039008358 8:33066111-33066133 AAGGCTTAATTGGGGCTGGAGGG - Intergenic
1039086101 8:33781618-33781640 ATCGCTCTGCTGAGGCTGGCTGG - Intergenic
1040644195 8:49379265-49379287 CTGGCTCAACTCAGGCTGGTTGG + Intergenic
1041405711 8:57497018-57497040 ATGTCCCAGCTGAGTCTGGAAGG - Intergenic
1043316116 8:78924543-78924565 AAGGATCACCTGAGCCTGGAAGG - Intergenic
1043489759 8:80737316-80737338 AAGGCCTGACTGAGGCTGGATGG + Intronic
1043678789 8:82996094-82996116 ATGTCACAAATGAAGCTGGAAGG + Intergenic
1044860416 8:96517933-96517955 TTAGCTCAGCTGAGGCAGGAGGG - Intronic
1047274553 8:123395990-123396012 ATCGCTGAGCTGAGGCTGGCCGG - Intronic
1047288009 8:123505007-123505029 TTTACTCAACTGTGGCTGGATGG + Intronic
1047382462 8:124375889-124375911 GGGGCTCAATTGAGCCTGGATGG - Intergenic
1047465006 8:125104489-125104511 ATAGCTCTACTCTGGCTGGATGG + Intronic
1047617927 8:126578655-126578677 GTGGCTTAACTGAGGCTGAATGG + Intergenic
1047745174 8:127839706-127839728 ATGGCTCAGCTGAGGAAGGGAGG + Intergenic
1048827323 8:138441050-138441072 CTTCCTCCACTGAGGCTGGAGGG - Intronic
1049302938 8:141881297-141881319 AAGGCTTGACTGGGGCTGGAGGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049399567 8:142418881-142418903 ATGGGGAGACTGAGGCTGGAAGG + Intergenic
1049907167 9:228851-228873 GTGGCTCAAGTGAAGCTGTAGGG + Intronic
1052114025 9:24626800-24626822 ATGTCTGAACTGAAGCTGGGAGG - Intergenic
1052860650 9:33435886-33435908 CTGACTCCACTGAAGCTGGAGGG + Intergenic
1055633376 9:78247743-78247765 ATGGCTTCACTTAGGGTGGAAGG + Intronic
1056078531 9:83065331-83065353 TTGACTCAACTGGGGCTGGATGG + Intergenic
1056431468 9:86532533-86532555 ATGAATTAACTGAGGCTGAAAGG - Intergenic
1058673919 9:107384361-107384383 AAGGCTAAAGTGTGGCTGGAGGG + Intergenic
1059449596 9:114362158-114362180 ATGGGGAAACTGAGGCTAGATGG - Intronic
1061257197 9:129459946-129459968 ATGGAAAAACTGAGGCTGGGAGG - Intergenic
1061430508 9:130527571-130527593 ATGGGGAAACTGAGGCTGGGGGG + Intergenic
1061464004 9:130763559-130763581 AAGGCTTAACTGGGGCTGGCAGG + Intronic
1062600656 9:137317376-137317398 CTGGCTCCACTCAGCCTGGATGG - Intronic
1187416775 X:19100097-19100119 GTGACTCAACTGAGGCTTGAAGG - Intronic
1188522848 X:31057984-31058006 ATGACTCAAGTGGGGCTGGCTGG - Intergenic
1189889341 X:45582776-45582798 GTGGCTTGACTGGGGCTGGATGG - Intergenic
1190413595 X:50160595-50160617 AAGGATCAATTGAGCCTGGAAGG + Intergenic
1193799477 X:85917289-85917311 ATGGGTCAAGGGAGGCTGGGAGG + Intronic
1197168028 X:123400377-123400399 ATTGCTCCAGAGAGGCTGGAAGG + Intronic
1197625577 X:128798561-128798583 AGGGCCCACCTGAGGGTGGAGGG + Intergenic
1198547411 X:137707308-137707330 CTGGCTCAACTGGGACCGGATGG - Intergenic
1201739691 Y:17310670-17310692 AAGGATCACCTGAGGCTGGGAGG + Intergenic