ID: 1119153086

View in Genome Browser
Species Human (GRCh38)
Location 14:72383549-72383571
Sequence ATGCCTGTTAATAAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119153086_1119153087 0 Left 1119153086 14:72383549-72383571 CCATTCTGCTTATTAACAGGCAT 0: 1
1: 0
2: 2
3: 26
4: 173
Right 1119153087 14:72383572-72383594 AAACAGACAGTATTTCTGCATGG 0: 1
1: 0
2: 1
3: 20
4: 319
1119153086_1119153089 22 Left 1119153086 14:72383549-72383571 CCATTCTGCTTATTAACAGGCAT 0: 1
1: 0
2: 2
3: 26
4: 173
Right 1119153089 14:72383594-72383616 GAGCTGATACCCTCCATTATGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1119153086_1119153090 29 Left 1119153086 14:72383549-72383571 CCATTCTGCTTATTAACAGGCAT 0: 1
1: 0
2: 2
3: 26
4: 173
Right 1119153090 14:72383601-72383623 TACCCTCCATTATGGGTCACCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1119153086_1119153088 21 Left 1119153086 14:72383549-72383571 CCATTCTGCTTATTAACAGGCAT 0: 1
1: 0
2: 2
3: 26
4: 173
Right 1119153088 14:72383593-72383615 GGAGCTGATACCCTCCATTATGG 0: 1
1: 0
2: 1
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119153086 Original CRISPR ATGCCTGTTAATAAGCAGAA TGG (reversed) Intronic
902342508 1:15793279-15793301 CAGCCAGTTAAGAAGCAGAAAGG + Intergenic
909883704 1:80913416-80913438 ATGCCTACTAATAAGCATAAAGG + Intergenic
911614775 1:99997817-99997839 AAGCCTGTTTATCACCAGAATGG + Intronic
911774631 1:101792590-101792612 CTGACTGTTAATAACAAGAAAGG + Intergenic
912149474 1:106839872-106839894 ATGCCTGCTAATTAGAAGAGAGG + Intergenic
913547528 1:119884257-119884279 ATGACTGTTAATAGGCAGAGAGG - Intergenic
913659166 1:120991478-120991500 TTTCCTGTTAATAAGCCAAACGG - Intergenic
914010530 1:143774603-143774625 TTTCCTGTTAATAAGCCAAACGG - Intergenic
914167293 1:145186510-145186532 TTTCCTGTTAATAAGCCAAACGG + Intergenic
914649151 1:149683262-149683284 TTTCCTGTTAATAAGCCAAACGG - Intergenic
915855287 1:159377790-159377812 ATGGCTGTTACTGAGCAGAGTGG + Intergenic
916794287 1:168151398-168151420 AGGCCTGTAAGTAAGCAGAAGGG - Intergenic
919134858 1:193494844-193494866 ATCCCTGTGAGGAAGCAGAAAGG - Intergenic
920549864 1:206849454-206849476 AAGGATGTTAATAAGCAGTAAGG + Intergenic
920964700 1:210692162-210692184 ATGCCAGTTAATAAGATGATGGG - Intronic
922557625 1:226545061-226545083 ATTTCTGTAATTAAGCAGAAAGG - Intergenic
1064205240 10:13317807-13317829 ATTCCTGTCATTAAGCACAAGGG - Exonic
1064694717 10:17953775-17953797 ATGCCTCTAAATATGCAGAAGGG - Intronic
1066820977 10:39489154-39489176 ATTCCTTTTAATGAGCAGTATGG - Intergenic
1067404238 10:46006546-46006568 ATGTGTGATAATCAGCAGAAAGG + Exonic
1068003082 10:51359485-51359507 ATGACTGTTAATAATAATAATGG - Intronic
1068428488 10:56899792-56899814 ATCCTTGTTAAAATGCAGAAAGG - Intergenic
1070531330 10:77339804-77339826 ATGTCTGATAAAAAGCAGGAGGG + Intronic
1072773871 10:98169259-98169281 CTGCCTGATATTCAGCAGAATGG - Intronic
1075551181 10:123393843-123393865 ATATCTCTTAATAAGAAGAAAGG + Intergenic
1075646751 10:124101932-124101954 ATTCCTGTTAACAAGGAAAAAGG - Intergenic
1076827393 10:132975965-132975987 ATGACAGTTAAGGAGCAGAAGGG - Intergenic
1079234786 11:18680543-18680565 GTGTCTAGTAATAAGCAGAAAGG + Intergenic
1081603397 11:44511151-44511173 ATGCCTGTTGAATAACAGAATGG - Intergenic
1082663001 11:55937643-55937665 AAGCCTATTGATAATCAGAAGGG + Intergenic
1084702035 11:70793132-70793154 ATGTCTTTTAATGAGTAGAAGGG - Intronic
1087611469 11:100439003-100439025 ATAACTGTTAATAAACAGCATGG + Intergenic
1088164791 11:106921345-106921367 ATCCCTGGGAATATGCAGAAAGG - Intronic
1089225014 11:116911845-116911867 TTGCCAGTAAATAAGCAGTAAGG - Intronic
1093872461 12:24308099-24308121 ATGCCTATTAAGAGGCAAAATGG + Intergenic
1097188142 12:57206540-57206562 ATGCCTGCTCGTAAGCCGAATGG - Exonic
1097380609 12:58891429-58891451 ATACCATTTAATAAGGAGAAGGG - Intronic
1097728926 12:63105863-63105885 ATGCCTGATATTAAGAAGAATGG - Intergenic
1097826979 12:64184307-64184329 ATTCCTGTAATTAAGCAGAATGG - Intergenic
1097998215 12:65913610-65913632 CAGCCTTTTAATAAGCAGCAGGG + Intronic
1101275793 12:103199363-103199385 ATTCCTGAAAATAAGCATAAGGG + Intergenic
1103256535 12:119546305-119546327 ATGTCTGTTAAAAAGAAAAAAGG - Intergenic
1103658753 12:122496384-122496406 TTGCCAGTTTATAAGCACAAAGG - Intronic
1104357321 12:128099224-128099246 ATGCGTGCCAATAAGGAGAAGGG - Intergenic
1105489662 13:20875658-20875680 AGGCCTGTTTGTAAACAGAAGGG - Intronic
1107631664 13:42349275-42349297 ATGCCAGTTAACAAGCGGATGGG + Intergenic
1111760269 13:92454857-92454879 ATGCATTTTTTTAAGCAGAATGG - Intronic
1111768120 13:92560420-92560442 CTGCTTGTTAAAAAGCAGAAAGG - Intronic
1115271240 14:31555911-31555933 ATGCCAGTTAAGATGCTGAAAGG + Intronic
1119153086 14:72383549-72383571 ATGCCTGTTAATAAGCAGAATGG - Intronic
1119234574 14:73008775-73008797 AGGCCTGTCAGTAAGCAGAATGG + Intronic
1119510530 14:75207674-75207696 ATCCCTGTGCATAAGAAGAAAGG + Intergenic
1120180028 14:81333836-81333858 GTGCCATTTAAGAAGCAGAAGGG + Intronic
1127153071 15:56098373-56098395 ATTCCTGAAAATAAACAGAAAGG + Exonic
1128757534 15:70193758-70193780 ATTCCTGTTGATAAACAGTAAGG + Intergenic
1132266562 15:100477665-100477687 ATGCCAGTTTATAAGCAGTATGG + Intronic
1137827135 16:51508370-51508392 ATGCCAGATAATAAGAAAAATGG - Intergenic
1137993441 16:53183805-53183827 ATGGCTGTTAAGTAGCAGAAAGG - Intronic
1140036879 16:71377917-71377939 GTGCCTGTTAGAAAACAGAAAGG + Intronic
1141473360 16:84254416-84254438 ATGCCTGTGAATACTCAGGATGG + Intergenic
1141802049 16:86316544-86316566 AAGCCAGTGAAAAAGCAGAAAGG + Intergenic
1141855035 16:86674895-86674917 ATGGATGTTAATGAGCAGGAAGG - Intergenic
1144030358 17:11315179-11315201 ATGCCTTGTAATAAACACAAGGG - Intronic
1145119782 17:20247842-20247864 ATGACTGTAGTTAAGCAGAAAGG + Intronic
1145202458 17:20958934-20958956 ATCACTGTAATTAAGCAGAAAGG + Intergenic
1153327973 18:3841228-3841250 ATGCCTGTTTAAAAGGACAATGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1153877021 18:9383032-9383054 ATGTTTGTAAATAAGGAGAAGGG + Intronic
1154330098 18:13422394-13422416 ATGCTTGTTAAAAACCAGTAAGG + Intronic
1155045931 18:22103172-22103194 ATTCCTCTTAAAAAGGAGAAGGG - Intergenic
1156866509 18:41894652-41894674 ATGCTTCTTCATAAACAGAAAGG - Intergenic
1158890989 18:61871514-61871536 AGGGCTGATAATAAACAGAAGGG + Intronic
1160049278 18:75417062-75417084 ATCCCTGTTAATGGGCAGGAAGG + Intronic
1164515866 19:28934698-28934720 ATGCCTGTTCTTAATCAGTATGG + Intergenic
1164892720 19:31838968-31838990 AACCCTGTTAGAAAGCAGAAGGG - Intergenic
1168511101 19:56974247-56974269 ATGCCTCTTTGTAAGCAAAATGG - Intergenic
927345647 2:22035689-22035711 CTCCCTTTAAATAAGCAGAAAGG - Intergenic
928970663 2:37025129-37025151 ATGACTGTTCAGAATCAGAATGG + Intronic
929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG + Intergenic
929046249 2:37793418-37793440 ATGCCTCATAATAAGGAGAGGGG + Intergenic
930557071 2:52910728-52910750 ATGTCCATTAATAAGTAGAATGG + Intergenic
931097695 2:58960398-58960420 ATGTCTGTGAAAAAGCAGAGAGG - Intergenic
932170953 2:69555530-69555552 ATGCTTTTTAAAGAGCAGAAAGG - Intronic
933429115 2:82152164-82152186 AAGCCTGTGGAAAAGCAGAAAGG - Intergenic
935227513 2:101066351-101066373 AGGCCTGTTAAGAAGCCAAATGG + Intronic
936635984 2:114258721-114258743 ATTCCTGTCATTAAGCATAAGGG - Intergenic
937390872 2:121485260-121485282 ATGCCTTTGACTAAGCAGCAGGG + Intronic
937793117 2:125983585-125983607 ATGTCTGTTACTAGGCAGCAAGG + Intergenic
941604956 2:167585094-167585116 TTGCCTGTTAATAAGATGACTGG - Intergenic
941823881 2:169871062-169871084 ATGCCTAGAAATAAGTAGAAGGG - Intronic
942387241 2:175455381-175455403 GTTTCTGTTAATCAGCAGAAGGG - Intergenic
942514148 2:176734250-176734272 ATGACTGTTAGTGAGCACAAGGG + Intergenic
942664776 2:178305825-178305847 AGGACTGTTAACAAGCAAAATGG - Intronic
945650109 2:212547201-212547223 ATGCCAATTAATTAGAAGAAAGG - Intergenic
946516369 2:220415800-220415822 ATGACTCTTACTAATCAGAATGG - Intergenic
947113279 2:226743000-226743022 CTTCCTGTTAATAAAAAGAATGG - Intronic
1169553263 20:6723244-6723266 ATGCCTATTTATAAGCAGGAAGG - Intergenic
1177253659 21:18630539-18630561 ATGCCAGGTAATAAGAAGAAAGG - Intergenic
1178385124 21:32142837-32142859 ATGGCTGTTACTAAATAGAATGG - Intergenic
1181801817 22:25352585-25352607 ATGTCTGTGAATCAGAAGAAGGG - Intronic
1182996231 22:34815297-34815319 ATTCCTTTCAATAACCAGAAAGG + Intergenic
1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG + Intergenic
952258701 3:31717962-31717984 AGCACTGTTAATAATCAGAACGG + Intronic
952552373 3:34494124-34494146 CTGCCTGGAAATTAGCAGAATGG + Intergenic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
954350123 3:50036247-50036269 ATGCCTTTTAATAAACTGGATGG + Intronic
955284646 3:57627596-57627618 ATGTCTATTAATAAACACAATGG + Exonic
955991959 3:64637480-64637502 ATGCCTGTTAATACATAGAAAGG + Intronic
956592826 3:70933307-70933329 AAGCCTGATAATGAGCAGGAAGG - Intergenic
958070715 3:88607525-88607547 ATGCCTGTGAACATGCATAAGGG + Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
967017411 3:185494779-185494801 AAAGCTGTTAAGAAGCAGAAAGG + Intronic
971346618 4:25817398-25817420 ATGCCTGTTAGGAAGAGGAAAGG - Intronic
972577474 4:40365007-40365029 GTGCCACTTAAGAAGCAGAAAGG - Intergenic
974094719 4:57350904-57350926 CTGCCTGGTGATGAGCAGAAGGG + Intergenic
974583548 4:63838208-63838230 ATACTTATTCATAAGCAGAAAGG + Intergenic
974598209 4:64040405-64040427 ATGGATGTTAATAATGAGAATGG - Intergenic
974619692 4:64339787-64339809 ATTAGTGTAAATAAGCAGAAAGG - Intronic
975059349 4:69978372-69978394 CTGCCTGGTGATGAGCAGAAAGG + Intergenic
975689831 4:76951550-76951572 ATGCCTGCTAATAAGTATAATGG - Intronic
976562997 4:86523145-86523167 ATACCTATTAATAAACATAAAGG - Intronic
977175415 4:93814438-93814460 ATGCCTGTAAACTATCAGAAAGG - Intergenic
978122029 4:105091382-105091404 ATGACTGGTAATAAGCAGGATGG + Intergenic
979530959 4:121768845-121768867 AAGCATTTTAAAAAGCAGAAAGG + Intergenic
979722671 4:123920207-123920229 TTGCCTTATAAGAAGCAGAAAGG - Intergenic
979722855 4:123922500-123922522 TTGCCAGTTAAAAAGCACAAGGG - Intergenic
979784189 4:124694634-124694656 ATGGCTTTTAAGAAGCAGCAGGG + Intronic
979997745 4:127452646-127452668 ATGCATGTAAAGAAGTAGAAAGG + Intergenic
981517318 4:145624113-145624135 ATGTGTGATAATCAGCAGAAAGG + Intronic
983810761 4:172058688-172058710 ATGACTTTAAATAAACAGAATGG - Intronic
986061651 5:4197364-4197386 ATGTTTGTAAATTAGCAGAAAGG + Intergenic
987815130 5:22890620-22890642 AGGCCTGTTAATAATGTGAAGGG + Intergenic
988992131 5:36681709-36681731 ATAACTTTTAATAAGCAAAAAGG - Intronic
996353810 5:122575123-122575145 ATACCTGTAAATGTGCAGAAGGG - Intergenic
997367320 5:133334389-133334411 ATGACTGTGACAAAGCAGAAGGG - Intronic
998110275 5:139496145-139496167 ATGTGTGATAATAGGCAGAAAGG - Intergenic
999213547 5:149912389-149912411 ATGTCTGTAAACATGCAGAATGG - Intronic
1000967023 5:167669744-167669766 GTGCCTGTAATTAAGCAAAACGG + Intronic
1001605390 5:172956241-172956263 ATGCCTTTTGATAAGCAAAATGG + Intergenic
1005157923 6:22828736-22828758 ATGCTTTTTAAAAAGCAGACTGG - Intergenic
1006421519 6:33936981-33937003 TTTCCTGTAAATAAGCAGAAGGG - Intergenic
1008269139 6:49468746-49468768 ATGATTGTTAATGAGCAGTAAGG - Intronic
1010342169 6:74766422-74766444 AAGCCTTCTAATAAGTAGAATGG - Intergenic
1010703884 6:79084415-79084437 ATGCCTGTTAATAGGCTTTAGGG - Intergenic
1011913501 6:92472067-92472089 ATGACTGTTAATAAGTACAGGGG + Intergenic
1014843532 6:126247643-126247665 ATGCCTGAAAATAAGGAAAATGG + Intergenic
1016326053 6:142902814-142902836 ATGCCTGTCCACAAGCAGTAAGG - Intronic
1021216538 7:17922605-17922627 ATGCCAATTAATGATCAGAAAGG - Intronic
1022018099 7:26370448-26370470 TTGCCTTTTAAAAAGCACAAAGG + Intronic
1022068203 7:26883060-26883082 AAGCTTGTTTATAAGCAGATGGG + Intronic
1024275066 7:47670777-47670799 ATGCATGTTAACAAGCACACTGG - Intergenic
1024707464 7:51976132-51976154 ATGTCTATTAATAAGAAGAAAGG + Intergenic
1025008914 7:55379505-55379527 ATTTCTGTTAACAAGCAGGAAGG + Intronic
1026329117 7:69336793-69336815 ATGCCTGTTAATTATCATAAAGG + Intergenic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1026898276 7:74023014-74023036 ATGCCGGTTAACAAGCAGAAGGG - Intergenic
1027181355 7:75941886-75941908 AGGTTTGTTAATAAGAAGAATGG + Intronic
1027662098 7:80999316-80999338 GTACCTGTTAACAAGAAGAATGG - Intergenic
1029934949 7:104414271-104414293 ATGTTTGTTAAAAAGCCGAAGGG - Intronic
1030665921 7:112278462-112278484 AATCCTGGTAATAAGGAGAATGG - Intronic
1030784118 7:113639610-113639632 ATGCAAGTTAATAAGCATATTGG - Intergenic
1031039717 7:116826768-116826790 CTGCCTGGTAATAAGCAGCAGGG + Intronic
1031892070 7:127306328-127306350 AAGCTTGTGAAAAAGCAGAAGGG + Intergenic
1032064279 7:128753526-128753548 AAGAATGTTAATAAGCTGAAAGG - Intronic
1032543091 7:132720500-132720522 ATGCTTGTTAGAAAGCAAAAAGG - Intronic
1032830535 7:135620582-135620604 ATGCCTGTGAATAAGGAAAATGG - Intronic
1033777627 7:144629999-144630021 TTACATGTTCATAAGCAGAAGGG + Intronic
1034597733 7:152214717-152214739 ATCTCACTTAATAAGCAGAATGG + Intronic
1035126835 7:156614294-156614316 TTGTCTGTTAAAAATCAGAAAGG + Intergenic
1035182526 7:157099654-157099676 AGGCCTGCAAACAAGCAGAAGGG - Intergenic
1036982400 8:13484658-13484680 ATCCTTGTTAAAATGCAGAAGGG + Intronic
1037443636 8:18942914-18942936 TTCCCTTTTAATAAGCAAAAGGG + Intronic
1038113572 8:24527532-24527554 ATGCATTTTAATAAGCATAATGG - Intergenic
1038574069 8:28688706-28688728 GAACCTGTTTATAAGCAGAATGG + Intronic
1038774986 8:30521083-30521105 ATGCTTTAAAATAAGCAGAAGGG + Intronic
1040118602 8:43654509-43654531 ATCCCTTTTACTAAGCAGATTGG + Intergenic
1041660285 8:60394543-60394565 ATGCCTCTTAGAAAGCAGAGAGG - Intergenic
1042144097 8:65709834-65709856 ATGCCATTTAATAAACTGAAAGG - Exonic
1045760036 8:105594344-105594366 ATGCCTTTTAAAACACAGAATGG + Intronic
1046699713 8:117386388-117386410 ATGCTTATTAACAAGGAGAAGGG - Intergenic
1050029767 9:1373585-1373607 TTCCTTGTTTATAAGCAGAAGGG - Intergenic
1050112734 9:2233459-2233481 ATGCCTGTTCATCAGCATACTGG - Intergenic
1050779957 9:9320980-9321002 ATACCTGTTAATAAACAATATGG + Intronic
1050810681 9:9742957-9742979 ATGCCTATTAATTATTAGAAAGG - Intronic
1052443707 9:28532138-28532160 ATGTCTGTTAAAAATCATAATGG - Intronic
1055711701 9:79069855-79069877 ATGTCAGTTATTAAGAAGAAGGG - Intergenic
1061647406 9:132016300-132016322 GAGCCTGTTAAAAAGCAGTACGG - Intronic
1185745206 X:2567057-2567079 ATGACTGTCAATAAGGATAAAGG - Intergenic
1186454041 X:9697262-9697284 GTGCCGGTTTATAAGGAGAAGGG + Intronic
1186991725 X:15076828-15076850 TAGCCTGTTAACAAGCAGAAAGG - Intergenic
1187724595 X:22189411-22189433 ATGCCTATTAATGAGAATAACGG - Intronic
1187946068 X:24427335-24427357 ATGCCTTTTGATACCCAGAAGGG + Intergenic
1191184765 X:57597828-57597850 ATGCCTGAGGAGAAGCAGAAAGG - Intergenic
1193669206 X:84363602-84363624 ATGCCTGTTAAGAAGCATATAGG + Intronic
1194160106 X:90438637-90438659 ATGTTTGTTAATAAGCAGAAGGG + Intergenic
1195106232 X:101604030-101604052 ATGGCTTATAAGAAGCAGAAAGG - Intergenic
1195653140 X:107308209-107308231 ATGCCTTTTTATAAGCATAAAGG + Intergenic
1197150136 X:123211344-123211366 CTGCCTTTTAATTAGGAGAAGGG - Intronic
1200506401 Y:4015588-4015610 ATGTTTGTTAATAAGAAGAAGGG + Intergenic
1201671104 Y:16521256-16521278 AAGCCTGTGAAGAAGCAAAATGG - Intergenic