ID: 1119153667

View in Genome Browser
Species Human (GRCh38)
Location 14:72388742-72388764
Sequence GAGCCCATAGTGAGTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119153667 Original CRISPR GAGCCCATAGTGAGTAGAGC TGG (reversed) Intronic
901289838 1:8115532-8115554 GACCTGATAGTGAATAGAGCCGG + Intergenic
902761449 1:18583527-18583549 CAGCCCATGGTGAGCTGAGCTGG + Intergenic
905334963 1:37238882-37238904 GAGCCCACAGTGTGCTGAGCAGG - Intergenic
908366909 1:63434029-63434051 GAGGTCATAGTGATTGGAGCTGG + Intronic
908388019 1:63661145-63661167 GAGTCCATACTGAGTAGGGGAGG - Intergenic
910594272 1:88962090-88962112 GAGCCCATGGTGAGAATGGCTGG - Exonic
920650133 1:207831502-207831524 CAGCCCATAGTCAGGATAGCAGG - Intergenic
922762409 1:228141081-228141103 GAGCCCAAAGACAGCAGAGCAGG - Intronic
1066395891 10:35021664-35021686 GAGCCCAGAGTGAGAAGACCAGG - Intronic
1070791900 10:79194652-79194674 GAGGGCATCGTGAGCAGAGCTGG - Intronic
1070796516 10:79220048-79220070 GAGGCCATGGGGAGCAGAGCTGG + Intronic
1071334089 10:84587561-84587583 GAGCCCCGGGAGAGTAGAGCTGG - Intergenic
1076477418 10:130762330-130762352 GAGCCCTTACTGAGTACACCTGG + Intergenic
1078756864 11:14219403-14219425 GCCCCCATAATGAGGAGAGCAGG + Intronic
1078933686 11:15934062-15934084 GAAACCATAGAGAGTAGAGCGGG + Intergenic
1079016097 11:16870213-16870235 GAGTCCAAAGAGAGGAGAGCTGG - Intronic
1080988356 11:37499483-37499505 TAGTCAATAATGAGTAGAGCTGG - Intergenic
1084065320 11:66700730-66700752 GGGCCCAGAGCGAGTATAGCCGG - Exonic
1093322650 12:17732994-17733016 CAGACCATGGTGAGTGGAGCTGG + Intergenic
1095803848 12:46296763-46296785 GAGCCCACAGCAAGTGGAGCAGG + Intergenic
1098896981 12:76074724-76074746 GAGGGCATAGTGAGTACAGTAGG - Intronic
1099286985 12:80725386-80725408 GAGCCCATAGCTACTAAAGCTGG - Intergenic
1104542180 12:129676049-129676071 GAGGCCACAGTGTGTAGTGCTGG - Intronic
1108259984 13:48646637-48646659 CACCCTATAGAGAGTAGAGCAGG + Intergenic
1113740942 13:112712009-112712031 GAACCCAGAGTGAGAACAGCTGG + Intronic
1115492477 14:33971274-33971296 GAACTCATAGAGAGTAGAGTGGG + Intronic
1118767384 14:68918976-68918998 GAGCCCATCATGAGTGTAGCAGG + Intronic
1119153667 14:72388742-72388764 GAGCCCATAGTGAGTAGAGCTGG - Intronic
1121363646 14:93286667-93286689 GAGCCTAGAGTCAGAAGAGCTGG + Intronic
1121423729 14:93833541-93833563 GTGCCCTTAGAGAGGAGAGCTGG + Intergenic
1133466390 16:6031218-6031240 GAGACCATGGTGAGCAGAGGTGG + Intronic
1134174254 16:11993098-11993120 GAGGCCTTAGTGAGAAGAGATGG + Intronic
1135016424 16:18927676-18927698 GAGCTCACAGTGAGCAGAGATGG + Intergenic
1135770782 16:25216930-25216952 GAGCCCATAGTGTGATCAGCAGG + Exonic
1148135683 17:45290262-45290284 GTGCCCATCGTGACTGGAGCAGG - Intronic
1150489460 17:65564296-65564318 GAGCCTACAGTGATTAGGGCTGG - Intronic
1151712232 17:75813353-75813375 GAGGGCATAGTGAGGATAGCTGG + Intronic
1153160516 18:2199804-2199826 GAGCCCAAGGTGAGTACAGAGGG + Intergenic
1155788791 18:29936496-29936518 GGGCACATAGTGATTAGATCAGG + Intergenic
1156490619 18:37493734-37493756 GAGCCCCTAAAGAGGAGAGCAGG - Intronic
1158734852 18:60068042-60068064 CAGCGCATAATGAGCAGAGCAGG - Intergenic
1162113505 19:8414016-8414038 CAGCACATAAGGAGTAGAGCTGG + Intronic
1163152477 19:15423400-15423422 GACCCCATGGTGAGTGGAGGTGG - Intronic
1163295200 19:16407255-16407277 GAGCCAAGAGTGAGTAGGGCAGG - Intronic
1163320080 19:16569549-16569571 GAGCCGAGAGTCAGAAGAGCTGG - Intronic
1165951222 19:39474805-39474827 CAGCCCAGAGTGGGCAGAGCTGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
925942802 2:8836813-8836835 GCGCCCATAGGGAGCAGAGATGG + Intronic
928416654 2:31098246-31098268 GAGCCCACAGTGAGTTTTGCAGG - Intronic
934044396 2:88160422-88160444 AAGCCCATAGTCTGGAGAGCAGG - Intergenic
935639164 2:105274456-105274478 GAGGCTATAGTTGGTAGAGCTGG - Intronic
936275315 2:111091055-111091077 GACCCCATAGTGAGGCAAGCAGG - Intronic
937836290 2:126473264-126473286 GAGCCAACAGGAAGTAGAGCAGG + Intergenic
938539950 2:132277543-132277565 GGGCCCAGAGTGAGAAGACCAGG + Intergenic
939184166 2:138841001-138841023 GAGCCCAGATAGAGGAGAGCAGG - Intergenic
940881376 2:158950219-158950241 GAGGCTATAGTGAGTCGAGGTGG + Intergenic
942928214 2:181457843-181457865 GAACCGATGGTGAGTAGAGTTGG + Exonic
944698914 2:202228174-202228196 GAGCCTGCAGTGAGTAGAGATGG + Intronic
946193754 2:218021455-218021477 TAGCCTAGAGCGAGTAGAGCAGG + Intergenic
946224227 2:218254378-218254400 GAGTCCAAAGTGAGAAGAGAAGG + Intergenic
947762938 2:232616979-232617001 GCGACCCTAGTGAGTAGGGCTGG + Intronic
1171868879 20:30510568-30510590 GAGCCCAGAGTGAGAAGACTAGG + Intergenic
1172808466 20:37630433-37630455 GAGCAGAGAGAGAGTAGAGCTGG - Intergenic
1174181224 20:48676282-48676304 GAGCGCACAGTGAGCAGGGCAGG + Intronic
1176059297 20:63165315-63165337 GAGCCCACAGTCAGTGGATCAGG - Intergenic
1178080469 21:29058654-29058676 GAGCCTGCAGTGAGTAGAGATGG - Intronic
1182880004 22:33725069-33725091 GTGCGCACAGTGAGGAGAGCAGG + Intronic
1185039472 22:48497097-48497119 GAGCCCGTGGGGAGTGGAGCTGG - Intronic
951390974 3:22103278-22103300 GAGCCCACAGTGATTAGATATGG - Intronic
952581928 3:34844376-34844398 GAGTCCACAGTTAGTGGAGCTGG + Intergenic
956777789 3:72580086-72580108 AAGCCCAGAGTGAGTATAGAAGG - Intergenic
966247443 3:177824918-177824940 GAGCACAGAGTGAGGAGAGGAGG + Intergenic
974639158 4:64607124-64607146 GGGCCCAGAGTGAGGAGAGTAGG + Intergenic
979325375 4:119372930-119372952 GAGCCCATGGTGAGAACACCAGG + Intergenic
983243276 4:165257951-165257973 GAGCCCATGGTGAGAACACCAGG + Intronic
987474176 5:18370404-18370426 GAGACCATAGTGAGTGGGGTGGG + Intergenic
988348315 5:30069415-30069437 GAGCCCAGAGTGTTTAGTGCAGG + Intergenic
989108094 5:37882078-37882100 AAGCCCAAAGTCAGTAGAACAGG - Intergenic
994537839 5:101054151-101054173 GATGCCACAGTGAGTGGAGCTGG - Intergenic
997511239 5:134456011-134456033 GAGCCTGGAGTGAGGAGAGCAGG - Intergenic
998400218 5:141844851-141844873 GACACCATAGTGAGTAGCCCTGG + Intergenic
1000603558 5:163303230-163303252 GATGGAATAGTGAGTAGAGCTGG + Intergenic
1001263948 5:170258121-170258143 GAGCTCATAGGAAGTAGTGCTGG + Exonic
1002655724 5:180745144-180745166 GAGCTCACAGAGAGTAGAGCTGG + Intergenic
1006132722 6:31878714-31878736 GAGCCCATGGGGAGTGAAGCTGG - Intronic
1006666609 6:35699181-35699203 GAGCCCATGTGGAGAAGAGCTGG - Intronic
1007257616 6:40539829-40539851 GGCCCCACAGTGAGTAGGGCAGG - Intronic
1008052286 6:46912574-46912596 GAGGCAATAGAGAGTAGAGAAGG + Intronic
1014598736 6:123380886-123380908 GAGCTCATAGTGAGTGTAGGGGG + Intronic
1019198104 6:170293975-170293997 GAGCCCTTAGGGATTCGAGCTGG + Intergenic
1020257091 7:6508439-6508461 GGGCCCAGAGAGACTAGAGCAGG + Intronic
1021763934 7:23928217-23928239 GAGCAGATTGTGAGCAGAGCAGG - Intergenic
1024186440 7:46952816-46952838 TTGCCCATGGGGAGTAGAGCTGG - Intergenic
1024526770 7:50355839-50355861 GAGGCCACAGTGAGCAGAGCAGG + Intronic
1026435560 7:70393974-70393996 GAAGCCAAAGTGAATAGAGCAGG - Intronic
1034423722 7:151002130-151002152 GAGGCCAGAGTGAGGAGGGCAGG + Intronic
1036704067 8:11033595-11033617 GTGCCCATAATGAGTGGGGCAGG - Intronic
1037665299 8:20963878-20963900 GAAACCAGAGTGAGAAGAGCTGG + Intergenic
1043227038 8:77745995-77746017 AGGCCCATAGTGAGTACTGCTGG - Intergenic
1049534306 8:143171078-143171100 GAGCCCAGTGTGGGGAGAGCCGG - Intergenic
1058574147 9:106382026-106382048 GAGGCCATAGTGAGTTGTGATGG + Intergenic
1062287078 9:135778081-135778103 GGGCTCAGAGTGAGTGGAGCAGG - Intronic
1186345141 X:8684391-8684413 GAGCCCCTAGAGAATAGAGAAGG + Intronic
1189249138 X:39586521-39586543 GAGCCCAAAGGGAGCTGAGCTGG + Intergenic
1196537393 X:116863275-116863297 GAGCCCAGAGAGAGTGGACCGGG - Intergenic
1200075372 X:153548069-153548091 GAGCCCAGGCTGTGTAGAGCAGG + Intronic