ID: 1119157147

View in Genome Browser
Species Human (GRCh38)
Location 14:72421749-72421771
Sequence GATAAGGGGTGCAACTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119157147_1119157154 18 Left 1119157147 14:72421749-72421771 CCTGGGCAGTTGCACCCCTTATC 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1119157154 14:72421790-72421812 GCTCCCCATTCCTCCTCCCTTGG 0: 1
1: 0
2: 6
3: 54
4: 524
1119157147_1119157156 21 Left 1119157147 14:72421749-72421771 CCTGGGCAGTTGCACCCCTTATC 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1119157156 14:72421793-72421815 CCCCATTCCTCCTCCCTTGGAGG 0: 1
1: 0
2: 4
3: 56
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119157147 Original CRISPR GATAAGGGGTGCAACTGCCC AGG (reversed) Intronic
908256569 1:62308437-62308459 GGTAGGGGGTGCAGCTGCTCAGG - Intronic
908666129 1:66493338-66493360 GAAAAGGGATGCATCTGCCCAGG + Intergenic
908741041 1:67327887-67327909 GATAATGTTTGGAACTGCCCTGG + Intronic
910161892 1:84281701-84281723 GATAAGAGGTTTAACTCCCCAGG - Intergenic
913189653 1:116402794-116402816 GAGAAGAGGTGCAAGTGCACAGG - Intronic
920849538 1:209619203-209619225 GATAAGGTGTGCTACAGTCCAGG - Intronic
923415695 1:233757630-233757652 ACTAAGGAGTGCACCTGCCCTGG - Intergenic
1063452301 10:6158513-6158535 GATAAGTGGTACAAATGCCTTGG + Intronic
1065637717 10:27746934-27746956 GCTAAGGTGGGCCACTGCCCCGG - Intergenic
1066228131 10:33404527-33404549 GCTGAGGGGTTCAACAGCCCAGG - Intergenic
1067038860 10:42937929-42937951 GTAAAGGGGTGGAGCTGCCCTGG + Intergenic
1067742754 10:48908264-48908286 GAACAGGTGTGCAAATGCCCAGG + Intronic
1069532328 10:69228568-69228590 GAAAAGGGCTGCTACTGGCCTGG + Intronic
1069793241 10:71036624-71036646 GATAAGGGTTCCACCTGGCCAGG - Intergenic
1076669422 10:132111463-132111485 CATGAGGGCTGCACCTGCCCTGG - Intronic
1078437714 11:11339198-11339220 GGTAAGAGGTGGAATTGCCCAGG - Intronic
1079478756 11:20858926-20858948 GATAAGGTGTACCATTGCCCAGG + Intronic
1091217760 11:133913737-133913759 GACAAAGGGTGCAGGTGCCCGGG + Intronic
1092940933 12:13406230-13406252 GACCAGGGGTGCATCTGCCATGG + Intergenic
1106073392 13:26435634-26435656 GCTAAAGGGTGGAACTGTCCTGG - Intergenic
1113819582 13:113203751-113203773 GATGAGGGTGGCAACTGCCTTGG + Intronic
1119157147 14:72421749-72421771 GATAAGGGGTGCAACTGCCCAGG - Intronic
1119406363 14:74402062-74402084 GATGAGTGGTGCATGTGCCCAGG + Intergenic
1121243014 14:92443333-92443355 GGGAGGGGGTGCAGCTGCCCAGG - Intronic
1121399937 14:93666531-93666553 GATAAGAGGAGCAACTCACCAGG + Intronic
1123012935 14:105357965-105357987 GATGTGGGGGGCACCTGCCCAGG + Intronic
1123108303 14:105853116-105853138 GCTAAGAGGAGCAGCTGCCCAGG + Intergenic
1127583801 15:60362564-60362586 GATACGGGCTGCAGCTGCCCAGG - Intronic
1128635427 15:69299367-69299389 GATAAGCGGCGCAAACGCCCTGG - Intronic
1133828641 16:9301650-9301672 GATAAGTGCTGCCACTGACCTGG + Intergenic
1134812332 16:17178298-17178320 AATAAGGGGTTCAGCTACCCAGG + Intronic
1135022168 16:18971979-18972001 GGTGAGGGGTGGAACTGCACAGG - Intergenic
1139073418 16:63413316-63413338 TATAAGGGGTGCAGGAGCCCTGG + Intergenic
1142612249 17:1115493-1115515 GTTAGTGGCTGCAACTGCCCTGG - Intronic
1147613803 17:41816805-41816827 GACAAGGGCTGCTATTGCCCTGG - Intronic
1150602161 17:66660471-66660493 GTTAGGGGGTGCTCCTGCCCGGG + Intronic
1154355742 18:13622181-13622203 GGTATGGGGTGCAGCTGTCCAGG + Intronic
1156652533 18:39241287-39241309 GACAAGTGGTGCAACTGCTGTGG + Intergenic
1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG + Intergenic
1161485616 19:4534112-4534134 AGTAAGGGGAGCACCTGCCCAGG + Intronic
1168681484 19:58319097-58319119 GATCAGGGGTGCTCCTGCCAAGG + Intergenic
930028620 2:47044921-47044943 GATCAGAGGGGCAACTGCCAGGG + Intronic
930070251 2:47360502-47360524 TATAGGGTGTGCAACAGCCCCGG - Intronic
938105723 2:128528609-128528631 GAGAAGGGAAGCAACTTCCCAGG + Intergenic
938236676 2:129711296-129711318 GATAAGGAGTGGGACTGCCGGGG - Intergenic
941158171 2:162003602-162003624 CATTAGAGGTGCAACTGCCTAGG - Intronic
944304639 2:198165491-198165513 GATAAGGGGAGAAAATGCACAGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
947791781 2:232872881-232872903 GAAAAGGGGTGCCGCTGCCAGGG - Intronic
1175124013 20:56738340-56738362 GAGAAGGGTAGCATCTGCCCTGG - Intergenic
1179505422 21:41836636-41836658 GATGATGGGTGAACCTGCCCAGG + Exonic
1182483381 22:30624673-30624695 GATAGAGGCTACAACTGCCCAGG - Intronic
1183493630 22:38129582-38129604 GATAAGACGTGCAACTGCCGGGG + Intronic
962755027 3:138460149-138460171 GATAAGGAGTGTGACTGCCCAGG - Intronic
964028699 3:152110510-152110532 ATTAAGGGGAGCATCTGCCCAGG + Intergenic
965635487 3:170776187-170776209 GATAAGGTGTGCAACTGTTCTGG + Intronic
981837749 4:149075483-149075505 GATGAGGTGTACAATTGCCCTGG - Intergenic
988641944 5:33049913-33049935 GCTAAGGGGCGCAACTGCTGTGG - Intergenic
992192674 5:74309235-74309257 GGTGAGGGGTGGAACTGCACAGG + Intergenic
992231736 5:74670713-74670735 GGTCATGGGTGCACCTGCCCGGG + Intronic
998556467 5:143129574-143129596 GATAAGGAGTGCAGCTGGACTGG - Intronic
1004700338 6:18073296-18073318 GCTAAGTGGTGCAGCTGCCGTGG - Intergenic
1012332946 6:98016773-98016795 GATAAGGGGAGCAAGTGACCAGG + Intergenic
1018591362 6:165427021-165427043 GAAAAGTGGTGCAACTGCCATGG + Intronic
1024252368 7:47516275-47516297 GAAATAGGGTGCAACTGTCCAGG + Intronic
1024960273 7:54967506-54967528 GCTCAGGTGTGCAATTGCCCGGG - Intergenic
1025798913 7:64765849-64765871 GATAATAAGTGGAACTGCCCTGG - Intergenic
1030252504 7:107463241-107463263 GAAAAGGGATGCAGCTGACCTGG - Intronic
1030882986 7:114904197-114904219 GAAAAGGGGTGGACTTGCCCAGG - Intergenic
1032698061 7:134354957-134354979 GGCAGGGAGTGCAACTGCCCAGG + Intergenic
1047206477 8:122806412-122806434 GAAAAGGGATGCATCTGCCCGGG + Intronic
1056217650 9:84420093-84420115 CATCAGGGGTGCATCTGCACTGG + Intergenic
1186448375 X:9651888-9651910 GATAATGAATGCAGCTGCCCTGG - Intronic
1188515028 X:30976021-30976043 GATAACTGGGGCAGCTGCCCTGG + Intergenic
1190160110 X:48026140-48026162 GATCAGGTGTGGAACTGCCTGGG + Intronic