ID: 1119157296

View in Genome Browser
Species Human (GRCh38)
Location 14:72422842-72422864
Sequence CTTGACTTGCAGATGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119157296_1119157302 9 Left 1119157296 14:72422842-72422864 CCAGGGCCCATCTGCAAGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119157302 14:72422874-72422896 GGATGCTCAGCAGCAGAGCCAGG 0: 1
1: 0
2: 5
3: 44
4: 402
1119157296_1119157305 20 Left 1119157296 14:72422842-72422864 CCAGGGCCCATCTGCAAGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119157305 14:72422885-72422907 AGCAGAGCCAGGAGAGGGCATGG 0: 1
1: 0
2: 15
3: 113
4: 1040
1119157296_1119157304 15 Left 1119157296 14:72422842-72422864 CCAGGGCCCATCTGCAAGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119157304 14:72422880-72422902 TCAGCAGCAGAGCCAGGAGAGGG 0: 1
1: 0
2: 13
3: 90
4: 593
1119157296_1119157303 14 Left 1119157296 14:72422842-72422864 CCAGGGCCCATCTGCAAGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119157303 14:72422879-72422901 CTCAGCAGCAGAGCCAGGAGAGG 0: 1
1: 2
2: 5
3: 72
4: 567
1119157296_1119157306 25 Left 1119157296 14:72422842-72422864 CCAGGGCCCATCTGCAAGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119157306 14:72422890-72422912 AGCCAGGAGAGGGCATGGAGCGG 0: 1
1: 0
2: 6
3: 121
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119157296 Original CRISPR CTTGACTTGCAGATGGGCCC TGG (reversed) Intronic
901413238 1:9099657-9099679 CGTGACTTGCAGATCTGCACTGG - Intergenic
901792462 1:11661556-11661578 CTCGACTTTCTGAGGGGCCCAGG - Exonic
902576555 1:17381591-17381613 CCTGACTTGCGGTTGGGACCAGG + Intronic
902581172 1:17408544-17408566 TTTTTCTTGCAGATGGGCCTAGG - Exonic
903492810 1:23742865-23742887 ATTAACTTGCAGATGGCCGCAGG - Intergenic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
910559943 1:88579359-88579381 CTTGACATGCTACTGGGCCCTGG + Intergenic
913495333 1:119423310-119423332 ATTCACTTGAAGATGTGCCCAGG + Intergenic
915131384 1:153697817-153697839 CTGAACTTCCTGATGGGCCCCGG + Intergenic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
921942473 1:220856430-220856452 CAGGAGTTGCAGATGAGCCCTGG + Intergenic
1062916467 10:1244105-1244127 GTTGACGAGCAGATGGGACCAGG + Intronic
1063167236 10:3474411-3474433 CCAGACCTGCAGGTGGGCCCTGG + Intergenic
1069943966 10:71973418-71973440 CGTTACTTGCAGATGGGAACTGG - Intronic
1074108800 10:110408331-110408353 CTTGATTTGCATCTGTGCCCTGG + Intergenic
1076571861 10:131438422-131438444 CTTGCCCAGCAGCTGGGCCCAGG - Intergenic
1078087488 11:8243015-8243037 CGTGGCTAGCAGATGGGCTCTGG - Intronic
1078438978 11:11348442-11348464 CCTGACTTGCTGATGGCCTCTGG - Intronic
1078891309 11:15560972-15560994 CTAGAGTTCCAGATGGGCCTGGG + Intergenic
1083759411 11:64807488-64807510 CTTGACTTGCTGTGGGACCCTGG - Intronic
1084389737 11:68867262-68867284 CCTGACTTGCAGCTGTGTCCAGG + Intergenic
1086404917 11:86491421-86491443 CTTGACTTGCAGACCGGGCTGGG + Intronic
1087173316 11:95073265-95073287 CTTCACTTGCTCTTGGGCCCTGG - Intergenic
1090707709 11:129354319-129354341 CTTGACTTGCTACTGGGCCCTGG + Intergenic
1092122569 12:6054876-6054898 CTTGACTTGGAGAAGAGCTCAGG - Intronic
1100294319 12:93246621-93246643 CCTGGCTTGCAAATGGGCTCAGG + Intergenic
1103937137 12:124482724-124482746 CTGGCATTGCAGGTGGGCCCAGG - Intronic
1104881163 12:132071532-132071554 CTTGACTTCCAGAAGAGACCTGG + Intronic
1107196763 13:37661764-37661786 CTTGACTTGCAACTTGGCCAGGG - Intronic
1107451308 13:40512644-40512666 GTAGACCTTCAGATGGGCCCAGG + Intergenic
1110542362 13:76720644-76720666 CTTGACTAGCTGCTGGGCGCAGG + Intergenic
1113601145 13:111568997-111569019 CATGAGATGCAGGTGGGCCCAGG + Intergenic
1114529390 14:23386336-23386358 CTTGACTTGCTTCTGGGCCTCGG + Exonic
1114534790 14:23416025-23416047 CTTGACTTGCTTCTGGGCCTCGG + Exonic
1118184513 14:63524686-63524708 CATGAGTTGCACAGGGGCCCAGG + Intronic
1119157296 14:72422842-72422864 CTTGACTTGCAGATGGGCCCTGG - Intronic
1122656194 14:103260990-103261012 TTTGACTTCCAGACTGGCCCTGG + Intergenic
1122778417 14:104133335-104133357 CTTGCTCTGCAGCTGGGCCCTGG + Intergenic
1127803270 15:62495655-62495677 CTGGTATTTCAGATGGGCCCAGG + Intronic
1132738505 16:1399114-1399136 CTTGCCTGGCAGAGGGGCCCCGG + Intronic
1135613137 16:23886221-23886243 TTTGACTTGCAGATGGATCAAGG + Intronic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1136577372 16:31132619-31132641 CCTGACTTGGGGAGGGGCCCAGG - Intronic
1138589901 16:57994005-57994027 CCTGAGTTGCAGCTGGGCCACGG + Intergenic
1138941678 16:61799153-61799175 CTTCACTTGTAGATTGCCCCTGG - Intronic
1139223114 16:65204790-65204812 CTTGACTTGGAGATGGGGGAAGG + Intergenic
1140820356 16:78657403-78657425 CTTGACATGCTGCAGGGCCCTGG - Intronic
1143019202 17:3907900-3907922 CCTGTCCTGCAGAGGGGCCCAGG - Intronic
1145886970 17:28388655-28388677 CCTGACTTCCAGCTGGGCCAAGG - Intronic
1150262984 17:63811793-63811815 CTTGACTTGCTGAAGGCCCAAGG + Intronic
1152800620 17:82329126-82329148 CCTGGCTTGCAGACGGGCTCCGG + Intronic
1152830094 17:82491759-82491781 CTTGGCCTCCAGATGGGGCCCGG + Intergenic
1153375217 18:4369635-4369657 TTTGACAGACAGATGGGCCCAGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160130342 18:76219611-76219633 TTTGACTTGTATATGGGCCCTGG + Intergenic
1161007826 19:1945193-1945215 CTGCACCTGCAGAGGGGCCCTGG - Intronic
1161087798 19:2343199-2343221 TTTGTCTTGCAGGTGGGCCTGGG + Exonic
1161358312 19:3831929-3831951 CCTCACCTGCAGATGGGCCCTGG + Intronic
1161456032 19:4370149-4370171 CTTGCCTGGCAGATGGCACCAGG - Intronic
1162723550 19:12676366-12676388 CCTGCCTTGCAGATGGGGCAGGG - Intronic
1163782500 19:19257817-19257839 CTAGACGTGCAGAGGGGTCCAGG + Exonic
924978880 2:202251-202273 CTTGGCATCCAGAGGGGCCCAGG - Intergenic
926572583 2:14545556-14545578 CTTGAATTTCAGAAGGGCCTAGG - Intergenic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
937258432 2:120570535-120570557 CTCGCCTTGCATCTGGGCCCAGG + Intergenic
937431044 2:121838486-121838508 CTTGACTTCCTGATGGCACCAGG + Intergenic
937986495 2:127640439-127640461 CCAGCCTTGCAGCTGGGCCCTGG - Intronic
938582211 2:132656775-132656797 TTTGAGTTGCAGATGGCCACAGG + Intronic
939457465 2:142455837-142455859 CTTGACATGAAGATGTGCCTTGG - Intergenic
942062560 2:172241191-172241213 CTTGGTTTGGAGTTGGGCCCGGG - Intergenic
942184224 2:173408844-173408866 CTTGAGTTTCCAATGGGCCCTGG + Intergenic
942312008 2:174664668-174664690 TTTGACTTGTAAGTGGGCCCTGG - Intronic
946013523 2:216585499-216585521 CTTGGCTTGTAGATGGTCCTTGG - Intergenic
946944285 2:224803566-224803588 TTTGACTAGCAGATAGGACCTGG - Intronic
947342332 2:229152945-229152967 CTGGCCCTGCAGCTGGGCCCGGG + Intronic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
1168953681 20:1819635-1819657 CTGGACTTGGAGATGGGTCTCGG - Intergenic
1169216881 20:3799329-3799351 ATTGGCTTGCACATGGGCCTTGG - Intronic
1175568497 20:60000156-60000178 CCTTCCTTGCAGAGGGGCCCCGG - Intronic
1175949803 20:62577304-62577326 GTTGACTTGCTAATGGTCCCGGG + Intergenic
1176032071 20:63017488-63017510 CAGGACTTGCAGAGGGGGCCTGG + Intergenic
1176411143 21:6450241-6450263 CCTGACCTCCAGGTGGGCCCAGG + Intergenic
1177101378 21:16900866-16900888 CATGATTTGCAGATGAGCCATGG - Intergenic
1179461476 21:41538336-41538358 CTGGAGTTGCAGAGAGGCCCGGG + Intergenic
1179686636 21:43058563-43058585 CCTGACCTCCAGGTGGGCCCAGG + Intronic
1181422633 22:22812204-22812226 CTTGACTATCAGTGGGGCCCAGG + Intronic
1181888353 22:26039533-26039555 CTTGACTTCCAGGTGGGGCTGGG + Intergenic
1183291053 22:37002266-37002288 CTTGTCATTCAGATGGGCCCTGG + Exonic
1185004959 22:48270372-48270394 CGAGGCTTGCAGGTGGGCCCTGG + Intergenic
949241056 3:1872188-1872210 CTTGTCTTACAAATGAGCCCAGG + Intergenic
950635490 3:14311497-14311519 TTTAATTTGCAGATGTGCCCGGG - Intergenic
950924300 3:16724966-16724988 CTTTACTTGGAGATGGTTCCTGG - Intergenic
953751373 3:45611147-45611169 CTTGGCTTTCAGATGGGACAAGG - Intronic
954343536 3:49975401-49975423 CTTGACTTGCATATGGCCTTGGG + Intronic
957038546 3:75317536-75317558 CTTGCCTTTCAGAAGTGCCCTGG - Intergenic
959117699 3:102197199-102197221 CTTGACTTACATATGTGCGCAGG + Intronic
961086575 3:124072834-124072856 CTTGCCTTTCAGAAGTGCCCTGG - Intergenic
962242887 3:133766323-133766345 CTTGCCTTTCAGATTGTCCCAGG - Exonic
963003012 3:140700812-140700834 TCTGACATGCAGAAGGGCCCAGG + Intronic
963427998 3:145156796-145156818 CTTGAGTTGGAGATGAGCCTTGG + Intergenic
969464194 4:7344976-7344998 TTTGACTCGCAGATGACCCCTGG + Intronic
971264757 4:25087934-25087956 CTTGACTTGTAACTTGGCCCTGG + Intergenic
972907488 4:43768588-43768610 ATTGTTTTGGAGATGGGCCCAGG - Intergenic
976130807 4:81882051-81882073 CTCCACTTGCATATGTGCCCTGG + Intronic
983523568 4:168736636-168736658 CTGGACTTGCAGAAGGCCCTAGG + Intronic
986128041 5:4901795-4901817 CTTCACTTGGGGATGGACCCAGG - Intergenic
988401318 5:30763945-30763967 CTTTACTTGGAGACGGTCCCTGG - Intergenic
989214350 5:38888455-38888477 CCTGTCTTGCAGAAAGGCCCTGG - Intronic
990299966 5:54440385-54440407 CTTGAACAGCAGATGGGGCCGGG + Intergenic
994758066 5:103818862-103818884 CTTGGCTTGCAGATGGCTGCTGG - Intergenic
995090004 5:108163203-108163225 GTTGACTCTCTGATGGGCCCTGG - Intronic
1003057087 6:2831683-2831705 CTGGACTGGCAGATGGCCCTGGG + Intergenic
1012497141 6:99845891-99845913 CTTTACTTTAAGATGGGCTCTGG + Intergenic
1018837461 6:167496084-167496106 CTTGCCTTGGAGATGTCCCCAGG - Intergenic
1018975216 6:168559652-168559674 CTTGGCTGGCAGATGAGCACAGG - Intronic
1019134486 6:169899673-169899695 CTCAACTTGCAGATGGACCCTGG + Intergenic
1023353778 7:39347000-39347022 CTTGAGAAGCAGATGGGCCTGGG + Intronic
1024920590 7:54549961-54549983 ATTGACTTTCAGATAGGCCTGGG - Exonic
1025974960 7:66362379-66362401 CTTGGCATGTAGCTGGGCCCAGG + Intronic
1027363636 7:77434404-77434426 TTTGAAATGCAGATGGGCCGAGG - Intergenic
1028869275 7:95749612-95749634 ATTGACTTGCACCTGGGTCCTGG + Intergenic
1043118787 8:76294757-76294779 CTTGAGTTGGAGATGGGCAGAGG - Intergenic
1045641250 8:104253922-104253944 CTTGACATTCTGATGGACCCAGG + Intronic
1049514992 8:143049590-143049612 CTGGACTTGGAGTTGGGCCATGG - Intronic
1050298061 9:4227096-4227118 TTTGCTTTGCAGATGGGCACGGG + Intronic
1053572850 9:39327826-39327848 CATGCCTTGCAGATGATCCCAGG - Intergenic
1053624197 9:39852028-39852050 CATGCCTTGCAGATGATCCCAGG - Intergenic
1053880669 9:42591200-42591222 CATGCCTTGCAGATGATCCCAGG + Intergenic
1054094413 9:60886535-60886557 CATGCCTTGCAGATGATCCCAGG - Intergenic
1054115883 9:61162447-61162469 CATGCCTTGCAGATGATCCCAGG - Intergenic
1054124294 9:61291185-61291207 CATGCCTTGCAGATGATCCCAGG + Intergenic
1054219700 9:62398670-62398692 CATGCCTTGCAGATGATCCCAGG + Intergenic
1054231015 9:62510503-62510525 CATGCCTTGCAGATGATCCCAGG - Intergenic
1054591872 9:67020097-67020119 CATGCCTTGCAGATGATCCCAGG + Intergenic
1060191679 9:121598093-121598115 TTTGGCGTGCAGTTGGGCCCAGG + Intronic
1060440649 9:123636117-123636139 CATGAATTCCAGCTGGGCCCTGG - Intronic
1062408464 9:136409537-136409559 CCTGACTTGCAGACTGGCCCTGG + Intronic
1062571478 9:137187787-137187809 CTGGGCTTGCTGATGGGCACTGG - Exonic
1187047087 X:15657300-15657322 TTTGACTTACAGTTGGGCACTGG - Intronic
1188865951 X:35313096-35313118 CTTGGCTTGCAGAGGGGCAGAGG - Intergenic
1189357106 X:40318383-40318405 CTGATCTTGCAGATGGGCTCTGG - Intergenic
1189750753 X:44219204-44219226 CTTGAATGGCAGATGTGCACAGG + Intronic
1192761965 X:74103685-74103707 CAAGACTTGCAGCTAGGCCCAGG + Intergenic