ID: 1119157361

View in Genome Browser
Species Human (GRCh38)
Location 14:72423313-72423335
Sequence GGCCCTCAGGCTCACGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119157347_1119157361 15 Left 1119157347 14:72423275-72423297 CCACCCATATGTCCCCCCACCCC 0: 1
1: 0
2: 5
3: 49
4: 646
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157356_1119157361 -4 Left 1119157356 14:72423294-72423316 CCCCATGTCATGTTTACCTGGCC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157358_1119157361 -6 Left 1119157358 14:72423296-72423318 CCATGTCATGTTTACCTGGCCCT 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157351_1119157361 2 Left 1119157351 14:72423288-72423310 CCCCCACCCCATGTCATGTTTAC 0: 1
1: 0
2: 1
3: 24
4: 211
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157348_1119157361 12 Left 1119157348 14:72423278-72423300 CCCATATGTCCCCCCACCCCATG 0: 1
1: 0
2: 1
3: 19
4: 215
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157350_1119157361 3 Left 1119157350 14:72423287-72423309 CCCCCCACCCCATGTCATGTTTA 0: 1
1: 0
2: 1
3: 17
4: 263
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157353_1119157361 0 Left 1119157353 14:72423290-72423312 CCCACCCCATGTCATGTTTACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157354_1119157361 -1 Left 1119157354 14:72423291-72423313 CCACCCCATGTCATGTTTACCTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157357_1119157361 -5 Left 1119157357 14:72423295-72423317 CCCATGTCATGTTTACCTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157349_1119157361 11 Left 1119157349 14:72423279-72423301 CCATATGTCCCCCCACCCCATGT 0: 1
1: 1
2: 0
3: 35
4: 262
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171
1119157352_1119157361 1 Left 1119157352 14:72423289-72423311 CCCCACCCCATGTCATGTTTACC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119157361 Original CRISPR GGCCCTCAGGCTCACGCTGA TGG Intronic
901511518 1:9720255-9720277 GCCCCTCAGCCTCACGCGGCGGG - Intronic
905263927 1:36738362-36738384 GGCCCCCAGACTCCAGCTGAGGG + Intergenic
906056881 1:42924606-42924628 GGCACTCTGGACCACGCTGAGGG + Intergenic
907394362 1:54178924-54178946 TGCCCACCGGCTCACGCTGCTGG - Intronic
910741112 1:90517485-90517507 GGCCCTCGGTCTGAGGCTGAAGG - Intergenic
911842710 1:102704616-102704638 AGCCCTCAGTCTGAAGCTGAAGG + Intergenic
915179671 1:154047452-154047474 GGCCATGATGCCCACGCTGAAGG + Intronic
915180332 1:154053511-154053533 GGCCATGATGCCCACGCTGAAGG + Intronic
915557948 1:156670466-156670488 GGGCCTCAGCCTCAGGCTGAAGG - Exonic
915958053 1:160239846-160239868 GGCCCTCAAGCCCATGCTGCAGG + Exonic
923033418 1:230267571-230267593 GTCCCTCAGGCTATAGCTGAAGG - Intronic
923825393 1:237494262-237494284 GGCCTTCAGCCACAGGCTGAAGG - Intronic
1069438486 10:68407133-68407155 GGCCCTCAGTCCCGGGCTGAGGG - Exonic
1071032727 10:81204338-81204360 GGCCTTCAGCCTCAGACTGAAGG + Intergenic
1071072023 10:81705323-81705345 GGCCTTCAGCCTCAGACTGAGGG + Intergenic
1071072024 10:81705325-81705347 AGCCCTCAGTCTGAGGCTGAAGG - Intergenic
1071119573 10:82261852-82261874 GGCCATGATGCCCACGCTGAAGG - Intronic
1072825258 10:98599402-98599424 GGGCTTCAGGCCCACCCTGAAGG - Intronic
1077065093 11:637516-637538 GGCCGCCAGGCTCACGATGAAGG - Exonic
1077309303 11:1881425-1881447 GGGCTTCAGGCTGAGGCTGAGGG - Exonic
1077491815 11:2864443-2864465 GGCCCTGAGCTTCACCCTGAGGG - Intergenic
1078206514 11:9234597-9234619 GGCCCTGACGCCCACGCTAAAGG + Intronic
1081745707 11:45471047-45471069 GGTCCTCAGGCTCACTTTGGAGG - Intergenic
1085472940 11:76769559-76769581 GGGCCTCAGGTTCTCTCTGAGGG + Intergenic
1087874242 11:103336998-103337020 GGCCATGACGCCCACGCTGAAGG + Intronic
1087881886 11:103425987-103426009 GGCCATGATGCCCACGCTGAAGG + Intronic
1090255105 11:125278482-125278504 GACCCTCAGACTCCCGATGATGG + Intronic
1091098050 11:132842311-132842333 GTCGCTGAGGGTCACGCTGATGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1096513691 12:52145283-52145305 GGACTTCAGGCTGAGGCTGAGGG + Intergenic
1097137753 12:56873184-56873206 GGCCATAATGCCCACGCTGAAGG - Intergenic
1097548197 12:61031411-61031433 GGCCATGATGCCCACGCTGAAGG - Intergenic
1098831568 12:75371183-75371205 GGCCTTCAGCCACACACTGAAGG - Intronic
1102322256 12:111946601-111946623 GGCCATGACGCCCACGCTGAAGG - Intronic
1102737480 12:115175553-115175575 GGCCCTCAGCCACAGACTGAAGG - Intergenic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1104636010 12:130438204-130438226 GGTCCTGGGGTTCACGCTGATGG + Intronic
1107085265 13:36420754-36420776 GTCCCTCAGCCTCACGATGTGGG + Intergenic
1107823294 13:44305434-44305456 GGCACTCAAGCTCAGTCTGAGGG - Intergenic
1110434508 13:75464269-75464291 GGCCATGACGCCCACGCTGAAGG + Intronic
1112384119 13:98922048-98922070 CACCCTCATGGTCACGCTGATGG + Exonic
1112810667 13:103215149-103215171 GGCCCTGAATCTCACACTGAAGG - Intergenic
1114454636 14:22846864-22846886 GGCCTTCAGGCTCACCCCCAGGG - Exonic
1115544455 14:34453191-34453213 GGCCCTCATCCTCACCCTGCAGG - Intronic
1118479107 14:66145519-66145541 GGCCATGATGCCCACGCTGAAGG + Intergenic
1119025603 14:71149842-71149864 GGCCATGATGCCCACGCTGAAGG + Intergenic
1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG + Intronic
1120461719 14:84805602-84805624 GGCCTTCAGTCGCAGGCTGAAGG + Intergenic
1120705251 14:87739112-87739134 GGCCTTCAGCCTCAGACTGAGGG + Intergenic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122425834 14:101604795-101604817 GCCCCTCATCCTCATGCTGAGGG - Intergenic
1122923155 14:104888235-104888257 GGCCCTGAGGCACACCCTGGGGG - Intronic
1123789146 15:23701854-23701876 GGCCATGATGCCCACGCTGAAGG - Intergenic
1123891383 15:24783500-24783522 GGCCATGATGCCCACGCTGAAGG - Intergenic
1126101859 15:45122810-45122832 AGACCTCAGCCTCAGGCTGAGGG - Intronic
1128680463 15:69647805-69647827 GGCCCGCTGGCTCATGCTGAGGG + Intergenic
1128740814 15:70082679-70082701 GATCCTCAGGGTCACGCTGAGGG - Intronic
1129072553 15:72963265-72963287 GGCCATGATGCCCACGCTGAAGG - Intergenic
1131037634 15:89234111-89234133 GGCCATGATGCCCACGCTGAAGG - Intergenic
1132674218 16:1114998-1115020 GGGCCTCAGGTGCACCCTGAAGG + Intergenic
1135504719 16:23026521-23026543 TGCCCCAAGGCTAACGCTGATGG - Intergenic
1142067586 16:88071635-88071657 GGGTCTCAGCCTCACGCTCACGG + Intronic
1143101649 17:4507817-4507839 AGACCTCAGGATCACGCTGTTGG + Intronic
1144506778 17:15838348-15838370 GGCCATGACGCCCACGCTGAAGG + Intergenic
1145170960 17:20656283-20656305 GGCCATGACGCCCACGCTGAAGG + Intergenic
1145819210 17:27818422-27818444 GGCCCTCAGGTTGATGCTGGAGG - Intronic
1146101986 17:29991644-29991666 GGCCATGATGCTCATGCTGAAGG - Intronic
1147560779 17:41507581-41507603 GGCCCTCCTGCCCAAGCTGATGG + Intergenic
1149434883 17:56625140-56625162 GGCCCTCATTCTCAGGCTTATGG + Intergenic
1152001020 17:77645258-77645280 CGCCCTGCGGCTCAGGCTGAAGG + Intergenic
1155156796 18:23164352-23164374 GGCCCGCAGCCTGACCCTGATGG + Intronic
1156025274 18:32646257-32646279 AACCCTCAGGCACAAGCTGAAGG + Intergenic
1160792536 19:929343-929365 GGCCGCCGGGCTCAAGCTGAAGG - Exonic
1163734704 19:18972550-18972572 GGCCCCAAGACCCACGCTGAAGG - Intergenic
1165908180 19:39206500-39206522 AGGCCTCAGGGACACGCTGATGG + Intergenic
1167793359 19:51693802-51693824 GGCCCAGAGGGTCAGGCTGAGGG + Intergenic
925329534 2:3047768-3047790 GGCCTTCAGCCACAGGCTGAAGG + Intergenic
932428943 2:71661969-71661991 GGACCTCAGGCTAATGCTGATGG + Intronic
932901198 2:75702265-75702287 GGTCATCAGGCTCACTCTCAGGG + Exonic
937244934 2:120486568-120486590 GTCACTGAGGCTCAAGCTGAAGG - Intergenic
937354250 2:121188052-121188074 GGCCCTCTGGCTGAAGCTGCAGG + Intergenic
938259415 2:129884474-129884496 GGCCCTCAGTCTCAGGATGGTGG + Intergenic
941110456 2:161414943-161414965 GGCCCTCTGGCTCAGGCCGAGGG + Intergenic
943255182 2:185585445-185585467 GGCCATGACGCCCACGCTGAAGG - Intergenic
947147484 2:227081456-227081478 GGCCCTCAGTCTGTGGCTGAAGG - Intronic
948353047 2:237356551-237356573 GGCCCTCAGCCACGCCCTGAGGG - Intronic
948887762 2:240892588-240892610 GGCCAGCAGGCTCACAGTGACGG + Intronic
948887775 2:240892642-240892664 GGCCAGCAGGCTCACAGTGACGG + Intronic
949031695 2:241800142-241800164 GGCCCTGAGGCTGGGGCTGAGGG + Intronic
1170031576 20:11949509-11949531 GGCCCAGAGGGTCACACTGATGG + Intergenic
1170819220 20:19742044-19742066 TACCCTCAGGCTCCAGCTGAGGG + Intergenic
1172037387 20:32019402-32019424 TGCCCTCGGGCTCACCCTGTTGG - Exonic
1175117002 20:56689695-56689717 GACCCTCAGGCCCAGGCTCAGGG + Intergenic
1175756793 20:61535342-61535364 GGCCCTCAGGCTCAGCCTCGTGG + Intronic
1176075107 20:63244799-63244821 GGCCCTCTCGCTCATGCTGTTGG - Intronic
1178425235 21:32473847-32473869 GGCCCTCAGCCTCACATGGAAGG - Intronic
1178438225 21:32578104-32578126 GGCCATGATGCCCACGCTGAAGG - Intronic
1180230106 21:46422014-46422036 GGCCCTGAGGCTCAAACTGCTGG + Exonic
1180979217 22:19870943-19870965 GGCCCTGTGGCTGACGCTCAGGG + Intergenic
1181002163 22:19992897-19992919 GGCCCACTGGCTCTGGCTGAGGG + Intronic
1181116472 22:20635178-20635200 GGGCCTCAGGGTCACTGTGAGGG - Intergenic
1183371883 22:37437392-37437414 GGCCCCCAGGCCCATTCTGATGG - Intergenic
1183599687 22:38832759-38832781 ATTCCTCAGGCTCACACTGATGG + Intronic
1184944808 22:47795650-47795672 GGCCCTCAGACTCTAGCTAAGGG - Intergenic
950304532 3:11907859-11907881 AGGCCACAGGGTCACGCTGAAGG - Intergenic
950740248 3:15045208-15045230 GGCCCTCATGGTCACTCTCAAGG - Exonic
952847685 3:37702004-37702026 GGCCCTGAGCCACACTCTGATGG - Intronic
954231210 3:49219230-49219252 GGCCTTGACGCCCACGCTGAAGG + Intronic
954301285 3:49702038-49702060 GGCCCTCAGGCTCCAGGAGATGG - Intronic
954389771 3:50262587-50262609 AGCCCTCAGTCACACGGTGATGG + Intergenic
959276345 3:104281820-104281842 GGCCATGATGCCCACGCTGAAGG - Intergenic
959847065 3:111045660-111045682 GGCCCTCTGACTCACGATTAGGG - Intergenic
961039374 3:123666458-123666480 GCCCCTCAGTCTTACCCTGAAGG - Intronic
961181655 3:124882685-124882707 GGATCTCAGGATCACTCTGAGGG + Intronic
961263211 3:125619104-125619126 GGCCTTCAGCCACAGGCTGAAGG + Intergenic
961336983 3:126186511-126186533 AGCCCTCAGGCTCAGGGTCAGGG - Intronic
962108381 3:132417174-132417196 GGCCCTAAGGCACACGCCGGAGG + Intergenic
962821858 3:139055886-139055908 GACCCTGAGGCTCAGGCTGAGGG + Intronic
962877784 3:139549053-139549075 GGCCTTGAGGCTAACCCTGAAGG - Intergenic
963597493 3:147346696-147346718 GTCCTTCAGGCTCACGATCAAGG - Intergenic
965486464 3:169284398-169284420 GACCCTCAGGATTAAGCTGAGGG - Intronic
967403149 3:189086091-189086113 GGCCTTCAGACACAGGCTGAAGG - Intronic
968704649 4:2072273-2072295 GGCACTCAGGCTCACCTTGAGGG + Exonic
969123368 4:4926331-4926353 GGCCATCATGCCCATGCTGAAGG + Intergenic
971333717 4:25703619-25703641 GGCCTTGAAGCTCATGCTGAGGG - Intergenic
974002575 4:56526391-56526413 TGCTCTCAGGCTAACGATGAGGG + Intergenic
974235160 4:59171828-59171850 GGCCATGATGCCCACGCTGAAGG + Intergenic
980701490 4:136437793-136437815 GGCCTTCAGGCTCAAACTAAGGG + Intergenic
980762666 4:137255986-137256008 GGCCATGATGCCCACGCTGAAGG - Intergenic
982097196 4:151933898-151933920 GGCCCTCAGGCTTAAGCCCAGGG - Intergenic
986716868 5:10531143-10531165 GGCCCTGAGGATCAGGCTGTGGG - Intergenic
993318352 5:86440358-86440380 GGCCTTCAGGCACAGACTGAAGG - Intergenic
998343698 5:141441695-141441717 AGCCTTCAAGCTCACGCTGCAGG + Intronic
1000611716 5:163382320-163382342 AGCCCCCAGGCTCACGCTTGTGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1008826105 6:55696278-55696300 GGCCCTCAGGCTCATTCAAATGG + Intergenic
1009980730 6:70722869-70722891 GGCCATGACGCCCACGCTGAAGG - Intronic
1011101466 6:83727539-83727561 GCTCCTCAGGCTCACCCTGCAGG - Intergenic
1013255886 6:108385282-108385304 GGCCATGATGCCCACGCTGAAGG + Intronic
1018435503 6:163754991-163755013 GGCCATCAAGCGCATGCTGAAGG - Intergenic
1019277087 7:181501-181523 GGCCCTCGGGTCCACTCTGAAGG + Intergenic
1020054850 7:5110505-5110527 GGCCATGAGGCCCACGCTGAAGG - Intergenic
1022481296 7:30744848-30744870 GGCTCACAGGCTCATGCTGAGGG - Intronic
1022550762 7:31237058-31237080 GGCCCTCAGTCTCACGCACTTGG - Intergenic
1023283165 7:38592228-38592250 GGCCATGACGCCCACGCTGAAGG - Intronic
1024419156 7:49141877-49141899 GGCCATGATGCCCACGCTGAAGG - Intergenic
1024866437 7:53909073-53909095 GGCCTTCAGCCACAGGCTGAAGG + Intergenic
1026165306 7:67904054-67904076 GGCCTTCAGCCTCACACTGGGGG - Intergenic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1029726297 7:102407798-102407820 TGTCCTCAGGCTCACACTCATGG + Intronic
1031712291 7:125064006-125064028 AGCTCTCAGGCTGAAGCTGAAGG + Intergenic
1032121832 7:129162355-129162377 GGGCACCAGGCTCAGGCTGAGGG + Intronic
1034897546 7:154887145-154887167 CGCCCTCAGGCTTACCCTGCAGG + Intronic
1034992532 7:155557271-155557293 GGCCCTCAAGCAAGCGCTGATGG + Intergenic
1035395043 7:158529216-158529238 GGTCCTGGGGCTAACGCTGATGG + Intronic
1035589733 8:803185-803207 GGCACTCAAGCTGACCCTGACGG - Intergenic
1036752646 8:11453037-11453059 AGTCCCCAGGCTCAGGCTGAGGG - Intronic
1037655945 8:20884371-20884393 GACTCTCAGGCTCATGCTAAAGG + Intergenic
1040318686 8:46278134-46278156 GGCCATGATGCCCACGCTGAAGG + Intergenic
1040319343 8:46284645-46284667 GGCCATGATGCCCACGCTGAAGG + Intergenic
1040480238 8:47818996-47819018 GCCCCTGAGGTGCACGCTGAGGG - Intronic
1040660847 8:49573378-49573400 AGCCCTCAGTCTCAGGCTGAAGG - Intergenic
1040967729 8:53101120-53101142 TGCCCTCAGGCTCATGCTATAGG - Intergenic
1041018740 8:53617162-53617184 GGCCATGATGCCCACGCTGAAGG + Intergenic
1041356234 8:57003589-57003611 GGCCATGATGCCCACGCTGAAGG + Intergenic
1044540005 8:93398258-93398280 AACCCTCAGGCTCAGGCTGGGGG - Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1049812518 8:144581832-144581854 GGCCCTCAGACCCCCGCTGGGGG + Intronic
1050187506 9:2990388-2990410 GGCCCTCAGGAACACGATGTTGG + Intergenic
1050498306 9:6267278-6267300 GGCCTTCAGCCTCAGACTGAAGG + Intergenic
1050498307 9:6267280-6267302 GGCCTTCAGTCTGAGGCTGAAGG - Intergenic
1052606460 9:30708442-30708464 GGCCATGATGCCCACGCTGAAGG - Intergenic
1055625428 9:78172681-78172703 GGCCATGACGCCCACGCTGAAGG + Intergenic
1058226222 9:102367970-102367992 GGCCATGACGCCCACGCTGAAGG + Intergenic
1060503467 9:124180682-124180704 GGACCAGAGCCTCACGCTGATGG - Intergenic
1061780037 9:132989980-132990002 CGCCCCCAGCCTCACGCTGGGGG - Intronic
1185631314 X:1517649-1517671 GCCCCACAGGCTCAGGCAGAAGG - Intronic
1188469975 X:30527530-30527552 GGCCATGATGCCCACGCTGAAGG - Intergenic
1189110931 X:38287818-38287840 GGACCTCAGGCTGACACTGATGG - Intronic
1189333169 X:40155227-40155249 GGTCCTCCGGCTCTCGCAGACGG + Intronic
1193209256 X:78786526-78786548 GGCCATGATGCCCACGCTGAAGG + Intergenic
1193313948 X:80042723-80042745 GGCCATGACGCCCACGCTGAAGG + Intergenic
1194355262 X:92875029-92875051 GGCCCTGATGCCCACGCTGAAGG - Intergenic
1194536353 X:95109149-95109171 GGCCATGATGCCCACGCTGAAGG - Intergenic
1195307167 X:103595245-103595267 GGCCATGATGCCCACGCTGAAGG + Intergenic
1200663618 Y:5992051-5992073 GGCCCTGACGCCCACGCTGAAGG - Intergenic