ID: 1119157775

View in Genome Browser
Species Human (GRCh38)
Location 14:72427496-72427518
Sequence CAATTTGGGCAGAGGTTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 10, 3: 46, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119157775_1119157780 13 Left 1119157775 14:72427496-72427518 CCGACCAACCTCTGCCCAAATTG 0: 1
1: 1
2: 10
3: 46
4: 257
Right 1119157780 14:72427532-72427554 AAGATAAGTGATTATTCTGTTGG 0: 1
1: 1
2: 1
3: 20
4: 256
1119157775_1119157783 16 Left 1119157775 14:72427496-72427518 CCGACCAACCTCTGCCCAAATTG 0: 1
1: 1
2: 10
3: 46
4: 257
Right 1119157783 14:72427535-72427557 ATAAGTGATTATTCTGTTGGGGG 0: 1
1: 0
2: 3
3: 19
4: 203
1119157775_1119157782 15 Left 1119157775 14:72427496-72427518 CCGACCAACCTCTGCCCAAATTG 0: 1
1: 1
2: 10
3: 46
4: 257
Right 1119157782 14:72427534-72427556 GATAAGTGATTATTCTGTTGGGG 0: 1
1: 0
2: 2
3: 10
4: 138
1119157775_1119157781 14 Left 1119157775 14:72427496-72427518 CCGACCAACCTCTGCCCAAATTG 0: 1
1: 1
2: 10
3: 46
4: 257
Right 1119157781 14:72427533-72427555 AGATAAGTGATTATTCTGTTGGG 0: 1
1: 0
2: 1
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119157775 Original CRISPR CAATTTGGGCAGAGGTTGGT CGG (reversed) Intronic
901411837 1:9089708-9089730 CAAGTTGGGCACAGTTTGGTGGG - Intergenic
902728589 1:18353335-18353357 CAACTTGGGCAGGGATTGGAGGG + Intronic
903613452 1:24633911-24633933 CAATTCGGCCAGGGGTTGGGAGG + Intronic
903764646 1:25726298-25726320 CGAGTTGGGCAGAGGTTTGGTGG - Intronic
904702045 1:32363502-32363524 CAAGGTGGGCAGAAGTTGGAAGG + Intronic
905307853 1:37031908-37031930 CAGTTTGGGCGGAGGATGGGAGG - Intronic
908427434 1:64021104-64021126 CAATTAGGGCAGAGGCTAGGAGG - Intronic
910488349 1:87740931-87740953 ATATTTGGGCAGAGGTTGAAGGG - Intergenic
911410245 1:97495135-97495157 CTTTATGGGAAGAGGTTGGTGGG + Intronic
912683119 1:111741307-111741329 CAATATGGGCTGAACTTGGTCGG + Intronic
912770528 1:112460278-112460300 CAATTTGGGCATATTTTGTTGGG + Exonic
914684673 1:149967843-149967865 CAATTTGGTCATTGTTTGGTGGG + Intronic
914805449 1:150987999-150988021 CAGTTTGGGCTGAGGAAGGTGGG + Intronic
914850661 1:151311520-151311542 CATTTTGGGTAGAAGGTGGTGGG + Intronic
915117761 1:153611144-153611166 CAAGCTGGGCTGAGGTGGGTGGG - Intronic
916200892 1:162270838-162270860 CAGGATGGGCAGAGGTTGGTTGG + Intronic
916206509 1:162320514-162320536 CAATGTGGGGAGGGGGTGGTTGG - Intronic
917241255 1:172951005-172951027 CAATTTGGACAGACCTTGGTGGG + Intergenic
917728309 1:177848763-177848785 CAATTTGGGCAGGGCCTGGCAGG + Intergenic
917857253 1:179110888-179110910 CTATTTGGGGACAGGTTGGCAGG - Intronic
918005219 1:180535489-180535511 CACTTTGGGCACATGTTGTTAGG - Intergenic
920044519 1:203124802-203124824 CACTGTGGGCAGAGGTGGGTGGG - Intronic
921069878 1:211649913-211649935 CAATTTGAGCAGAAGTTGGGAGG - Intergenic
921384397 1:214553874-214553896 CAAAGAGGGCAGAGCTTGGTTGG + Intergenic
921889847 1:220342893-220342915 TAATTTGGGCAGAGCTTGGCAGG + Intergenic
923210851 1:231803087-231803109 CAATTTGGGCAGGGCTTGGCAGG + Intronic
923404426 1:233646005-233646027 CAATTTGGGCTGAGGTTTTCAGG + Intronic
924191035 1:241552858-241552880 CAATTTGGGGAGAAGATGGGAGG - Intronic
1063577288 10:7273445-7273467 AAATGTGGGCGGGGGTTGGTTGG - Intronic
1064566426 10:16644086-16644108 TAAGGTGGGCAGAGGGTGGTGGG + Intronic
1065182584 10:23141612-23141634 CAATTTTGTCAAAGATTGGTTGG - Intergenic
1065312669 10:24431426-24431448 CAATTTGGACAGTGCTTGGAGGG + Intronic
1065560633 10:26960525-26960547 AAATTTGGGCAGAGCCTGGCTGG - Intergenic
1065593782 10:27292898-27292920 CCATTAGGGCAGAGGTAGGGAGG - Intergenic
1065600548 10:27363557-27363579 GAATCTGGGCACAGGTTGGCTGG + Intergenic
1065715389 10:28561922-28561944 CAATGAGGGTAGAGGGTGGTTGG - Intronic
1066088147 10:31991279-31991301 GAATTTGGGCAGGGTTTGGTGGG + Intergenic
1066201419 10:33145514-33145536 CAATTTGGGCAGGGCTTGGTGGG + Intergenic
1066559682 10:36656441-36656463 CCATTTTGGCATATGTTGGTTGG - Intergenic
1066574394 10:36809750-36809772 CAATTTGTACAGAGGTGAGTGGG + Intergenic
1067126532 10:43521191-43521213 AAATGTGGGCAGAGGCTGGCAGG - Intergenic
1068423237 10:56822621-56822643 CAATCTGGGCACAGGTGGCTTGG + Intergenic
1069656797 10:70095713-70095735 CAATTTCGGCTGTGGTTGGGTGG - Exonic
1070344023 10:75524204-75524226 ACATTTTGGAAGAGGTTGGTTGG + Intronic
1071833878 10:89399703-89399725 AATTTTGGGCAGGGGTGGGTGGG - Intronic
1072281496 10:93869770-93869792 CAATTTGGGCAGGGTTCAGTGGG - Intergenic
1072293590 10:93989183-93989205 CAATTTGGGCAGGGCATGGCAGG + Intergenic
1074140550 10:110668403-110668425 CAAAATGGCCATAGGTTGGTTGG - Intronic
1074434536 10:113422722-113422744 CAATATGGGAAGAGGTTGCCTGG + Intergenic
1074519623 10:114207313-114207335 CAATTAGGGCAAAGGATGGGAGG - Intronic
1074766356 10:116702830-116702852 CATTTTGGAGGGAGGTTGGTTGG - Intronic
1075005821 10:118829420-118829442 AAATGTGAGCAGAGGTTGCTGGG + Intergenic
1077614720 11:3666623-3666645 CCATTTGTGCAGAGGTGGCTGGG - Intronic
1078824548 11:14916445-14916467 CAACTTGGGCAGGGCTTGGTGGG - Intronic
1079123141 11:17699293-17699315 GATTTGGGGCAGAGGCTGGTGGG - Intergenic
1079387913 11:19997275-19997297 CTATGTGGGGAGATGTTGGTGGG + Intronic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1080763149 11:35272108-35272130 CAAAATGAGAAGAGGTTGGTGGG + Intronic
1082832671 11:57630653-57630675 GAATCTGGGCAGAGGTTAGCTGG - Intergenic
1085356376 11:75841913-75841935 CAGTTTGGTCTGAGCTTGGTGGG + Intronic
1087154040 11:94883903-94883925 CAATTTGAGCAGGGCTTGATGGG + Intergenic
1087465216 11:98495439-98495461 CAAATTGGGCAGTGGTGGTTGGG + Intergenic
1087863837 11:103198267-103198289 CATTTTGGGCAAAGGTATGTTGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1090863075 11:130671951-130671973 CAATTTGAGAAAAGGTTGGGAGG + Intergenic
1091932931 12:4411573-4411595 CAATTTTGGCAGATGCTGGCCGG - Intergenic
1092287361 12:7136431-7136453 AAGTTTGGACAGAGGTTGGATGG - Intronic
1092387791 12:8049498-8049520 CAATACGGGCAGGGGCTGGTGGG - Exonic
1092554195 12:9539113-9539135 CACCTTGGGCACATGTTGGTAGG - Intergenic
1094517904 12:31151525-31151547 CACCTTGGGCACATGTTGGTAGG + Intergenic
1094661782 12:32476357-32476379 CAATTTGGCCAGAGTTTGGTAGG + Intronic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1098065973 12:66616614-66616636 CAGTGTGGGGAGAGGATGGTGGG + Intronic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1098231954 12:68380475-68380497 CAATTTGGGAAGGGCTTGGTGGG + Intergenic
1098316109 12:69195000-69195022 CACTTTGGGCATATGTTGTTAGG - Intergenic
1098345959 12:69503662-69503684 GAGTTTGGGCAGTAGTTGGTAGG + Intronic
1100922100 12:99499751-99499773 CAATTTGGGGAGGGCTTGGCAGG - Intronic
1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG + Intronic
1106836648 13:33642377-33642399 GAATTTGAGCAAAAGTTGGTGGG + Intergenic
1107911457 13:45109070-45109092 CACTTTGGGCACATGTTGTTAGG + Intergenic
1109002954 13:56830076-56830098 CAATTTTGTGACAGGTTGGTGGG - Intergenic
1111276096 13:85949309-85949331 CAATGTGGACTGAGGTTGGATGG + Intergenic
1111674977 13:91375839-91375861 CAATTTGGGCAGGGCTTGGTGGG - Intergenic
1112126284 13:96471918-96471940 TCATTTTGGCTGAGGTTGGTTGG + Intronic
1112217361 13:97446874-97446896 CAATTTGGGCAGAACTCAGTTGG - Intronic
1113898546 13:113782761-113782783 CAGGTTGGGCACAGTTTGGTGGG + Intronic
1114458862 14:22874273-22874295 CAATCTGTGGAGAGGCTGGTGGG + Intronic
1115986657 14:39109312-39109334 CTATTTGGGCCGAGCGTGGTGGG - Intronic
1116605880 14:46994237-46994259 CATATAGGGCAGAGCTTGGTAGG - Intronic
1117508835 14:56428551-56428573 CATTTTGCTCTGAGGTTGGTGGG - Intergenic
1118376009 14:65177740-65177762 CAATTTGGACAGAGCTTTGTTGG - Intergenic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119747687 14:77056037-77056059 GAATTTGGGCAGGGCTTGGCTGG + Intergenic
1119900496 14:78255387-78255409 CCACGTGGGCAGAGGATGGTTGG + Intronic
1120623379 14:86792942-86792964 CAATTTGAGATGAGGTTTGTGGG - Intergenic
1120834019 14:89024719-89024741 CAATTTGGGCAGAGCTAGGCAGG + Intergenic
1121814314 14:96917395-96917417 CACTTAGAGCAGAGGTGGGTGGG + Intronic
1122301934 14:100736561-100736583 GAGTTTGGGCAGATGCTGGTCGG - Exonic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1124137017 15:27043794-27043816 GAATTTGGGCAGAGCTTAGCTGG + Intronic
1124391251 15:29259870-29259892 CAATTTGTACAGAGGTTTCTGGG - Intronic
1125956798 15:43796069-43796091 CATTCTGGGTAGAGGTTGGTAGG + Intronic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1127710713 15:61595130-61595152 CAATTTGGGCAGGGCTTAGTAGG + Intergenic
1128173570 15:65533443-65533465 CAATTTGGCCAAAGGGTGTTTGG + Intronic
1129481720 15:75831783-75831805 CAATTTGTGCAGAGGTGCATGGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130051322 15:80486310-80486332 AATTTTGGGCAGGGGGTGGTTGG + Intronic
1132132146 15:99292284-99292306 CATTTTTGGTAAAGGTTGGTGGG + Intronic
1137233725 16:46595075-46595097 CAGTTAAGGAAGAGGTTGGTGGG + Intronic
1140703432 16:77603850-77603872 CACTTTGGGTGGAGGTAGGTAGG - Intergenic
1140971283 16:80015378-80015400 CAATTTGGGCTGAGCTCGGCAGG + Intergenic
1141077758 16:81023599-81023621 CAATTTGGTGAGAGGGTAGTAGG - Intronic
1141767859 16:86070573-86070595 CAATTTGGGTAGGGTTTGGAGGG + Intergenic
1142134549 16:88445639-88445661 CCATTTGGGCAGGGCTGGGTGGG + Intergenic
1143275348 17:5705887-5705909 CAGTTTGGGCTGAGGAAGGTGGG + Intergenic
1144044897 17:11446614-11446636 GACTTTGGGCAGAGGTGTGTGGG + Intronic
1146327673 17:31901236-31901258 CTAATTGGGCAGAGTGTGGTGGG - Intronic
1147473727 17:40689355-40689377 CAACTTGGGAGGAGGTGGGTGGG - Intergenic
1147570067 17:41564670-41564692 CAATTTTGACAGGGCTTGGTGGG - Intergenic
1148030868 17:44619966-44619988 GAATTTGGGCAGGGCTTGGCTGG + Intergenic
1150584514 17:66505310-66505332 CCCTGTGGCCAGAGGTTGGTGGG - Intronic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1153796700 18:8630159-8630181 CACTTTGGGCACAGGTTGTCAGG - Intronic
1158319719 18:56249384-56249406 CCACATGGGCTGAGGTTGGTGGG - Intergenic
1158406367 18:57163268-57163290 CAATTTGAACAGAGGTTAGCAGG - Intergenic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1159234287 18:65651025-65651047 GAATTGGAGAAGAGGTTGGTGGG - Intergenic
1159259341 18:65991621-65991643 AAATTTGGGCAGAGGTTGGTGGG + Intergenic
1160421269 18:78747355-78747377 CCTTTTGGGCAGGAGTTGGTGGG + Intergenic
1160492907 18:79352757-79352779 CAATCTGGGCACAGGTTGGGGGG - Intronic
1161654346 19:5504562-5504584 AAATTGGGGCAGAGCTGGGTGGG + Intergenic
1164441638 19:28284240-28284262 GAGTTTGGGCAGAAGATGGTGGG - Intergenic
1164819896 19:31241687-31241709 ATATCTGGGCAGAGGATGGTGGG - Intergenic
1165358780 19:35320719-35320741 CATCCTGGGCAGAGGTTGGGGGG + Intronic
1166420403 19:42632053-42632075 TAACTTGGGCAGTGGTGGGTGGG + Intronic
1168010597 19:53528616-53528638 TAATTTGGGCAGAGGTACTTTGG - Intronic
1168645051 19:58054137-58054159 CAAGGTGGCCAGGGGTTGGTGGG - Exonic
924979079 2:203880-203902 CAATTTGGGCAGTGGGTTGTGGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
926619318 2:15032972-15032994 GGCTTTGGGCAGAGGTTGGTTGG - Intergenic
927320501 2:21739281-21739303 CAATTTGGGCAGAGATATGTAGG - Intergenic
928980201 2:37129344-37129366 CAAGTTGGGCATGGTTTGGTGGG - Intronic
929300587 2:40299704-40299726 CTATTTGGGCAGAGGCAGATGGG - Intronic
929577229 2:43059546-43059568 CAGTTTGGGCAGGGCATGGTGGG + Intergenic
932627056 2:73305989-73306011 CAATTTGGGCAGGGCTTGGCAGG + Intergenic
933472081 2:82738837-82738859 CAATTATCGCAGAGGTAGGTGGG - Intergenic
933619321 2:84519190-84519212 CAATTTAGGCAGAGCTCAGTGGG + Intronic
936048952 2:109208578-109208600 CAACTTGAACAGAGCTTGGTGGG - Intronic
937369620 2:121288139-121288161 CATTTTGGGCAGGGCTTGGGTGG - Intergenic
937866017 2:126752466-126752488 CAACTTGGCCAGAGGCTGGATGG - Intergenic
937975108 2:127577593-127577615 CAGTTTAGGCAGAGGATGATGGG - Intronic
940600323 2:155850555-155850577 CAATTTGGGCAGACCTTGGTTGG + Intergenic
941006186 2:160249499-160249521 CAATTTGGGCTGAGCTTAGCTGG - Intronic
941188210 2:162343980-162344002 CAATCAGGGCAGAGATGGGTGGG + Intronic
941562170 2:167060084-167060106 GAATTTGGGCAGAATTTGGTGGG - Intronic
942145092 2:173018946-173018968 CAGTATGGGTAGAGGTGGGTTGG + Intronic
945157183 2:206851615-206851637 GAATTTGGGCAGTGTTTGGCTGG + Intergenic
945814975 2:214593675-214593697 CAATTTGGGCAGAGGTGGTTTGG + Intergenic
946359137 2:219208488-219208510 TGAGTTGGGCAGAGGTTGGATGG + Intronic
946426921 2:219603896-219603918 CAATTTGTGCAGAGGTGGCTGGG + Intronic
947764579 2:232629134-232629156 CAATTTGGGCAGAGTTTTGTGGG - Intronic
1168740821 20:189916-189938 CCATTTGGGTCAAGGTTGGTTGG + Intergenic
1168986528 20:2053778-2053800 CAATTTGGGCAGGGCTTAGCAGG + Intergenic
1169028276 20:2387773-2387795 CAATTTGGGCAGAGCTCGGCAGG + Intronic
1169034543 20:2438812-2438834 CAATTTGGGTGGGGCTTGGTGGG + Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173350119 20:42237169-42237191 CACTTTGGGCAGAGCTTGAAGGG - Intronic
1174620189 20:51868255-51868277 GAGTTTGAGCAGAGGTTTGTGGG - Intergenic
1175289742 20:57867879-57867901 CAAGGTGGGCAGAGGTGGGCAGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175682632 20:61001778-61001800 CAATTTGGGCTGAGCATCGTTGG - Intergenic
1178507166 21:33171519-33171541 CACTTTGGGCTGCGGTTGGGGGG + Intergenic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1183496792 22:38150474-38150496 CAATTTGAGCAGAGCTCAGTGGG - Intronic
1184296611 22:43529124-43529146 CTGTTTGGGCAGAGGTTGAGAGG - Intronic
1185198523 22:49488214-49488236 CGATTTTGGCAGGGGTTGGCTGG - Intronic
949515167 3:4800901-4800923 CAATCTGGTCAAAGGTTTGTTGG + Intronic
949748000 3:7317253-7317275 AAAATTGGGAAGAGGTTGGTGGG - Intronic
949961402 3:9315237-9315259 CAATCTGGGAAAAGGTTGGGTGG - Intronic
950657853 3:14448341-14448363 CAGTTTGGGCTGAGCTTGGCTGG + Intronic
951173094 3:19566160-19566182 CCATTTGGGTGGAGGTGGGTGGG - Intergenic
952312044 3:32199157-32199179 CAATTTGGACAGGGTTTGGTGGG - Intergenic
952865411 3:37852036-37852058 CAGTTTAGGCAGGGCTTGGTGGG - Intergenic
956060549 3:65344188-65344210 AACTTGGGGAAGAGGTTGGTGGG - Intergenic
956077616 3:65522718-65522740 TACTTTGGGGAGAGGTTTGTGGG - Intronic
956256714 3:67291017-67291039 CAGTTTGGCCAGGAGTTGGTGGG + Intergenic
956848819 3:73209165-73209187 GAATTTGGGAAGAGCTTGGTGGG + Intergenic
957127667 3:76182989-76183011 AAATTTGGGCAGAGCTATGTTGG + Intronic
961083416 3:124045279-124045301 CAATTGGGGAAAAGATTGGTAGG + Intergenic
961802416 3:129461904-129461926 GAAATTGGGCAGAGGCTTGTAGG + Intronic
962135248 3:132724977-132724999 AAATGTGGGCAGAGGTTGGCTGG - Intergenic
962159876 3:132988024-132988046 AAATTTGGGCAGAGCTTGGCAGG + Intergenic
962753479 3:138451319-138451341 CAAGGTGGGCAGAGGTGGGAGGG + Intronic
962854410 3:139330876-139330898 AAATTTGGGTAGGGCTTGGTGGG - Intronic
964295366 3:155227267-155227289 CAATTTGGGCAGACCTTGGTGGG + Intergenic
966203632 3:177383243-177383265 CAATTTGGGCCGAGCTCAGTGGG - Intergenic
966278160 3:178200376-178200398 CCATTTGGGCAGTGTTTGGTAGG + Intergenic
967527164 3:190508327-190508349 CTATTTGTGTAGAGGTTGTTTGG - Intergenic
967868500 3:194210103-194210125 CTCTTTGGGCAAAGGGTGGTGGG - Intergenic
969327971 4:6454618-6454640 GAATTTGGGCAGAGCTTGGCTGG - Intronic
969328578 4:6459125-6459147 CAGTTTGGGTAGATCTTGGTGGG + Intronic
969995871 4:11312584-11312606 GAATTTGGGCAGGGCTTGGTTGG + Intergenic
971808956 4:31398706-31398728 CAATTTAGGCAGGGTTTAGTGGG + Intergenic
971837158 4:31782568-31782590 CAATTTGAGATGAGGTGGGTGGG - Intergenic
973848256 4:54935015-54935037 CAATTTGAGCAGGGGTTGATGGG - Intergenic
975839525 4:78458744-78458766 CAATCTGTGCAGAGGTGGGGTGG - Intronic
977768625 4:100830525-100830547 TAATTTGGACAGGGCTTGGTGGG - Intronic
979614043 4:122721533-122721555 CAATTTAGGCAGGGTTTAGTGGG + Intergenic
979798687 4:124878255-124878277 AAATTTGAACAGAGGTTGGGTGG + Intergenic
983907558 4:173199746-173199768 CAGTTTGGGCGGCGGGTGGTGGG + Intronic
984357703 4:178685302-178685324 GAGTTTGGGCAGATTTTGGTAGG - Intergenic
986637159 5:9834770-9834792 AAAGATGGGCAGAGGTTTGTGGG - Intergenic
987212123 5:15693761-15693783 GAAATTTGGCAGAGGGTGGTTGG + Intronic
987986013 5:25146893-25146915 CAATTTGAGATGAGATTGGTTGG - Intergenic
988491920 5:31712275-31712297 GAATTTGGGGAGAATTTGGTGGG + Intronic
988714712 5:33813838-33813860 CAATTTGGGCAGAGCTCAGGGGG - Intronic
990609441 5:57442560-57442582 CAATTTGGCCAGGGCTTGGGAGG + Intergenic
990886303 5:60598269-60598291 CCATTTGAGCAGAAGCTGGTGGG - Intronic
991606186 5:68403481-68403503 CAATTTGGGCAGGGCTTGGTGGG - Intergenic
991940620 5:71848848-71848870 CAATTTGAGCAAGGATTGGTGGG + Intergenic
993656488 5:90584493-90584515 TAATTTGGGTAGAGCTTGGTGGG + Intronic
995433023 5:112103532-112103554 AATTGTGGGCAGTGGTTGGTGGG + Intergenic
996633579 5:125665255-125665277 CAAGTTGGGCATGGTTTGGTGGG + Intergenic
997903907 5:137795071-137795093 GAATTTGGGCTGAGGCTGGGGGG + Intergenic
999186407 5:149713855-149713877 CAATTTGGGCAGGGCTTGGTGGG + Intergenic
999244420 5:150146245-150146267 GTATTTGGGGAGAGGGTGGTTGG - Intronic
1000421396 5:161042032-161042054 GAATTAGGGCAGAGCTTGGTTGG - Intergenic
1001807517 5:174600380-174600402 TAATTTGGGCAGGGCTTGATGGG - Intergenic
1001903279 5:175448925-175448947 CAGTTTCTGCAGTGGTTGGTGGG + Intergenic
1003966329 6:11255897-11255919 AAATTTGGGCAGAAGTTGAAGGG + Intronic
1005329779 6:24738683-24738705 CAATTTCGGCAGGGCTTGGAGGG + Intergenic
1006387477 6:33739390-33739412 CAATTCTGACACAGGTTGGTGGG + Intronic
1006576557 6:35050761-35050783 CTGTTTGGGCAGAGATTGGCAGG - Intronic
1006919953 6:37620963-37620985 CAATTTGGGCAGGATTTGGTGGG + Intergenic
1007225708 6:40312515-40312537 CAGTTTGGGCAGGAGTTGGTGGG - Intergenic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1011014480 6:82739975-82739997 GTATTTGGGCAAAGGGTGGTAGG - Intergenic
1012044448 6:94252186-94252208 CAATTTGTGCAGGGTTTGATAGG - Intergenic
1012377631 6:98581507-98581529 CCATATTGTCAGAGGTTGGTAGG - Intergenic
1013594870 6:111651390-111651412 AAATTTGGGCAGAGCTGGGTGGG + Intergenic
1015091162 6:129361466-129361488 CAATTTGGGCTGAGCTCAGTTGG + Intronic
1016857453 6:148685114-148685136 CAGGTTGGGCAGAGGTGGGGTGG + Intergenic
1019963909 7:4483685-4483707 GAATTTGGGAAGGGTTTGGTGGG - Intergenic
1022503478 7:30896732-30896754 CAGTTTGGGAAGAGGCTGCTGGG - Intergenic
1022589689 7:31649909-31649931 CAATTTGTGCAGAGGTGATTTGG + Intronic
1023356301 7:39370602-39370624 TAATTTAGGCAGAGGTGGGGAGG - Intronic
1025073087 7:55918347-55918369 CAATTTGGGCAGGACTAGGTGGG - Intronic
1026179987 7:68030514-68030536 CAATTTGGGCAGAGCCTGGCAGG + Intergenic
1026604908 7:71807338-71807360 CATTTTGGGCAGAGGTGTCTAGG - Intronic
1026854563 7:73744473-73744495 CAAGTGGGGTAGAGGTTGCTGGG - Intergenic
1029418032 7:100455948-100455970 CAATTTGGAAGGAGGTTGGAGGG - Intergenic
1029836073 7:103311817-103311839 CAATTTGTGAAGATATTGGTAGG + Exonic
1031317203 7:120273071-120273093 CATTTTGCGCCGGGGTTGGTGGG + Intergenic
1032087570 7:128891816-128891838 CAGTCTGGGCAGTGGATGGTGGG + Exonic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032422213 7:131791568-131791590 GAATTTGGGCACAGCTTGGCTGG - Intergenic
1032589046 7:133175438-133175460 CTCTTTGGGTAGAGGGTGGTGGG - Intergenic
1034998163 7:155591470-155591492 CAATGTGGGCAGGGGATGGGTGG - Intergenic
1036053615 8:5226894-5226916 CAATTTGTGCACAGGTGGCTGGG - Intergenic
1037396474 8:18449111-18449133 CACCTTGGGCACAGGTTGTTAGG + Intergenic
1037521825 8:19687226-19687248 GAATTTGTCAAGAGGTTGGTAGG - Intronic
1038231598 8:25705774-25705796 CAATTTGGTCAGGGGTTGGTAGG + Intergenic
1040914538 8:52555626-52555648 CAATTAGGGCAGAGGAATGTTGG - Intronic
1042368713 8:67966503-67966525 CAATCTGGGCAGAGCTTGGAAGG + Intronic
1042440397 8:68819766-68819788 CGATTTGTGCAGAGGTGGCTAGG + Intergenic
1044001893 8:86893143-86893165 AAATGTGGGCAGAGATAGGTGGG + Intronic
1044271056 8:90244582-90244604 CAATTTGGGCTGGGCTTAGTAGG + Intergenic
1044813927 8:96091302-96091324 CCATTTGGGCAGGTGTTAGTGGG + Intergenic
1047525306 8:125627952-125627974 CGATTTGGGCAGAGCTTGGCAGG + Intergenic
1047684385 8:127289844-127289866 CAACTTGAGCAGAGCTTAGTAGG + Intergenic
1047859830 8:128953397-128953419 CAATTTGGGAAGAAGTTAGCAGG - Intergenic
1048918301 8:139204754-139204776 CATTTTGTGCAGAGGTTGCCAGG - Intergenic
1049267214 8:141674636-141674658 AAATGAGGGCAGAGGTGGGTGGG + Intergenic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1050627957 9:7526035-7526057 CAATTTGGGCATGGCTTTGTGGG + Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1055073020 9:72186824-72186846 GAACTTGGACAGTGGTTGGTAGG - Intronic
1055241190 9:74188413-74188435 AAATTAGAGCAGATGTTGGTGGG + Intergenic
1055280021 9:74663616-74663638 CAATTTGGGCAGGGCTCAGTGGG + Intronic
1055546117 9:77375412-77375434 CAATTTGGGGAGAGAATGATTGG + Intronic
1057000307 9:91503108-91503130 CAATTTGGGCAGGGCTTGCGGGG + Intergenic
1057726235 9:97570584-97570606 CTCTTTGGGCAGAGGTTTGGAGG - Intronic
1060257722 9:122047279-122047301 CAATTTGAGCTGAGATTGGAAGG + Intronic
1060626685 9:125119700-125119722 CAATTTGGGTAGAGTTTGACAGG + Intronic
1185872700 X:3677435-3677457 CTATTTGGGCTGAGGTGGGAGGG - Intronic
1186305793 X:8256094-8256116 GAATTGGGGCAGAGAATGGTTGG + Intergenic
1186367424 X:8910214-8910236 CAATTTGGGCAGATTTTCATTGG + Intergenic
1186809688 X:13176180-13176202 CACTTTGGGCAGGGCTTGGCAGG + Intergenic
1187738861 X:22333554-22333576 CAATTTGGGCAGGGCTCAGTGGG + Intergenic
1189283748 X:39837558-39837580 CAATTTGGGCTGGGCTGGGTTGG + Intergenic
1189310897 X:40016763-40016785 CAATCTGGGCAGGGCTTGGCAGG + Intergenic
1189377942 X:40480453-40480475 CAAGTGGGTCAGAGGGTGGTTGG + Intergenic
1189518210 X:41737337-41737359 CAGTTTGGGCAGAGCTTGATAGG - Intronic
1189849202 X:45162257-45162279 CAACTTGAGCAGGGCTTGGTGGG - Intronic
1190486383 X:50929239-50929261 GAATTTGGGCACAGCTTAGTAGG + Intergenic
1192573354 X:72223899-72223921 CAAGTTGGGCACGGTTTGGTAGG - Intronic
1192602464 X:72479279-72479301 GGATTAGGGCAGAGGTTAGTGGG + Intronic
1192928160 X:75778099-75778121 CAATTTGTGCAAAGGTGGTTTGG + Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1196441173 X:115721448-115721470 CGGTTTGGGCAGAGGTGGGTGGG - Intergenic
1196444701 X:115839436-115839458 CGGTTTGGGCAGAGGTGGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1196933283 X:120703503-120703525 CAATTTAGGCAGAGCTTGACTGG - Intergenic
1198119825 X:133580915-133580937 CCATATGGGCAGAGGTTGGGAGG - Intronic
1198391848 X:136183144-136183166 TATTTTGGGCAGAGATTAGTTGG + Intronic
1199651332 X:149947798-149947820 CATCTGGGCCAGAGGTTGGTGGG + Intergenic
1199787109 X:151115454-151115476 CAATTTGGGCAGAGATAGATAGG + Intergenic
1200225210 X:154413292-154413314 AAATCTGGGCAGAGGCAGGTGGG - Intronic
1200257055 X:154588346-154588368 CATCTTGGGCAGAGCTAGGTTGG + Intergenic
1200260714 X:154616056-154616078 CATCTTGGGCAGAGCTAGGTTGG - Intergenic
1200266840 X:154650948-154650970 CATCTTGGGCAGAGCTAGGTTGG - Intergenic