ID: 1119159527

View in Genome Browser
Species Human (GRCh38)
Location 14:72441540-72441562
Sequence AGGCACTGAGCGCCATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119159520_1119159527 14 Left 1119159520 14:72441503-72441525 CCCTCATGGGCAGAGGGCTGGCC 0: 1
1: 0
2: 4
3: 20
4: 217
Right 1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 167
1119159515_1119159527 21 Left 1119159515 14:72441496-72441518 CCAGCTCCCCTCATGGGCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 279
Right 1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 167
1119159521_1119159527 13 Left 1119159521 14:72441504-72441526 CCTCATGGGCAGAGGGCTGGCCT 0: 1
1: 0
2: 1
3: 26
4: 266
Right 1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 167
1119159519_1119159527 15 Left 1119159519 14:72441502-72441524 CCCCTCATGGGCAGAGGGCTGGC 0: 1
1: 0
2: 3
3: 23
4: 201
Right 1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 167
1119159523_1119159527 -7 Left 1119159523 14:72441524-72441546 CCTCTTGCAGCCGACCAGGCACT 0: 1
1: 0
2: 0
3: 12
4: 91
Right 1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119159527 Original CRISPR AGGCACTGAGCGCCATCCCA GGG Intronic
901015190 1:6225297-6225319 AAGCACAGGGCGTCATCCCACGG - Intronic
901446637 1:9312381-9312403 AGGCAGTGAGCGCTAACACAGGG + Intronic
902035593 1:13455809-13455831 TGGCACTGAGCAACATCCCTGGG - Intergenic
902811383 1:18889926-18889948 AGGCACGGGGCGCTATCTCAGGG + Intronic
903072615 1:20734275-20734297 AGGCACTGTGCTAGATCCCAGGG + Intergenic
903182120 1:21610037-21610059 AGGCTCAGAGGGGCATCCCAGGG + Intronic
903693944 1:25193879-25193901 AGGCACCCACCGCCATGCCAGGG + Intergenic
906182921 1:43837226-43837248 AGGCACTTAGCCCAATCCGAGGG + Intronic
909699866 1:78511068-78511090 AGGCACTCAACTCCAACCCATGG - Intronic
909911840 1:81268918-81268940 AGGCACTGAGATCCAGGCCAAGG - Intergenic
910465546 1:87495315-87495337 AGAAACTGAGCGCCATCGCGTGG - Intergenic
915690153 1:157680906-157680928 AGGGATTGAGCGACAGCCCATGG - Intronic
915842779 1:159229568-159229590 GGGCACTGAGCGGCAGCCAAAGG - Intergenic
916302740 1:163294032-163294054 AGGCACTCAATGCCAGCCCATGG - Intronic
919385829 1:196921508-196921530 AGACACTCAATGCCATCCCATGG + Intronic
920850432 1:209624584-209624606 AGGCACAGAACGCCCTTCCATGG + Intronic
922169381 1:223142459-223142481 AGGGCCTCAGCGCCTTCCCAGGG + Intronic
922756872 1:228101830-228101852 AGGTCCTGAGTGCCCTCCCACGG + Intronic
1064031456 10:11885721-11885743 AGGCACTGGGAGCCATCCGCTGG + Intergenic
1066434112 10:35380983-35381005 AGGCAGACAGCGGCATCCCAAGG + Intronic
1066747488 10:38615794-38615816 AGGCACACAGCGCCAGCGCAGGG + Intergenic
1072736672 10:97883792-97883814 AGGCTCTGAGCCCCACCCTAGGG + Intronic
1073254379 10:102141450-102141472 AGGCCCTGGGCCCCATCCCAAGG - Exonic
1073350001 10:102812875-102812897 AGCCACTGGGCTCCATCCCTGGG - Exonic
1074486767 10:113891805-113891827 AGGCACTCAGGGCCTTCCCAAGG - Intronic
1075742930 10:124706726-124706748 AGGCGCTGGGCTCCATCCCAGGG + Exonic
1076141694 10:128084486-128084508 CGGCTCTGAGCCCCATCCAAGGG + Exonic
1077010567 11:377456-377478 AGGCACCGCGCCCCACCCCAGGG + Intronic
1082804627 11:57439894-57439916 TTGCACTGAGCTCCCTCCCAGGG + Intergenic
1084612575 11:70212798-70212820 AGTCACTGCAGGCCATCCCAGGG + Intergenic
1085128575 11:74018644-74018666 AGACTCTGAGAGCCACCCCAGGG - Intronic
1085477256 11:76796342-76796364 AGCCACTGGGCGCCAGCTCAGGG - Exonic
1087346605 11:96979421-96979443 AAGAACTGTGAGCCATCCCAAGG - Intergenic
1089051466 11:115549452-115549474 AGGCACCAAGCTACATCCCAAGG - Intergenic
1092737395 12:11595532-11595554 AGGCACTGAGCTCCATGCTGAGG - Intergenic
1096520277 12:52181024-52181046 AGGCCCTGAGCCCCAACCAAGGG - Intronic
1096675001 12:53221586-53221608 CGGCACTGAGCGCCCTCGCCCGG + Intronic
1097194259 12:57235139-57235161 AGGCTCTGAGAGCCAGCCCAGGG - Exonic
1098434129 12:70450885-70450907 AAGCACTCAGCGCCAGCCCTGGG + Intergenic
1098514417 12:71357860-71357882 CGGCACTGTGCTCCACCCCATGG + Intronic
1102629276 12:114263172-114263194 TGGCTCTGACCACCATCCCAAGG - Intergenic
1111539292 13:89650262-89650284 AGACACTCAACGCCAGCCCATGG - Intergenic
1113552843 13:111206429-111206451 AGGCACTGGCCCCCATCCCTGGG + Intronic
1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG + Intronic
1119234450 14:73007659-73007681 AGCCACTGAGCCCAACCCCATGG + Intronic
1119754622 14:77106815-77106837 AGGAACAGAGCGCCAACCAAGGG + Intronic
1120080246 14:80208145-80208167 AGTCTCTGAGCGCCAGCACAAGG + Intronic
1122235972 14:100330777-100330799 AGGCACCTGGCGCCCTCCCACGG - Intergenic
1122604203 14:102937696-102937718 TGACACCAAGCGCCATCCCAAGG + Intronic
1122807011 14:104264860-104264882 AGGCCCAGAACCCCATCCCAGGG - Intergenic
1122922430 14:104885547-104885569 AGGCACAGACGGCCACCCCAAGG + Intronic
1124402481 15:29361660-29361682 AGGCTCTGAGCCTCATCTCATGG + Intronic
1125458481 15:39885548-39885570 AGGCACTGAGGGCAGTCCCCTGG + Intronic
1125790776 15:42364085-42364107 AGGCATTGAGTGACACCCCAGGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128376900 15:67083244-67083266 AGGCCCTGACGGCCATGCCAGGG + Intronic
1128504437 15:68256794-68256816 AGACACTGGGAGCCATCCCTAGG - Intronic
1128911611 15:71520424-71520446 AGGCCCTGGGCCCCACCCCACGG - Intronic
1129233935 15:74212518-74212540 AGGAACGGAGTGCCATCCAATGG + Intergenic
1132679496 16:1133945-1133967 ACGCCCTGAGGGCCAGCCCAGGG + Intergenic
1133060512 16:3171639-3171661 AGGCGCTGGGCTCCATCCGAGGG + Intergenic
1133119259 16:3596193-3596215 AGGGACTGAGCGCCAGCCCGTGG - Exonic
1133130565 16:3673940-3673962 AGGCTCTGAGGGCCCTCCCCAGG + Intronic
1133257249 16:4524653-4524675 AGGCACTGGCCTCCATCCCAAGG - Intronic
1134040560 16:11065182-11065204 AGGCTCTGAGGTCAATCCCAAGG - Intronic
1136004273 16:27317842-27317864 AATCACTGAGCGCCTTCCAAGGG - Intronic
1136735319 16:32461799-32461821 AGGCACACAGCGCCAGCGCAGGG - Intergenic
1137411250 16:48230198-48230220 AGGCACTGTGCTACATCACAGGG - Intronic
1141027979 16:80565726-80565748 AGGCACTGAGTGCCTGACCAGGG - Intergenic
1141146320 16:81532746-81532768 GGGCACAGAGCTGCATCCCAGGG - Intronic
1141650259 16:85389027-85389049 AGTCAATGAGGGCCATTCCATGG - Intergenic
1141669089 16:85482136-85482158 AGACACTGAGCATCATGCCAAGG - Intergenic
1141732946 16:85834503-85834525 AGGCACTGTGGACCATGCCATGG - Intergenic
1141967793 16:87458673-87458695 AGGCACGAAGCGCCGTGCCAGGG + Intronic
1203017764 16_KI270728v1_random:367792-367814 AGGCACACAGCGCCAGCGCAGGG + Intergenic
1203036099 16_KI270728v1_random:640950-640972 AGGCACACAGCGCCAGCGCAGGG + Intergenic
1142848316 17:2692523-2692545 AGGGACCCAGCTCCATCCCAGGG - Intronic
1144659598 17:17059627-17059649 AGGAACTCAGCACCATGCCAGGG - Intronic
1146901874 17:36593929-36593951 AGCCACTGAGAGGCAGCCCAGGG - Intronic
1148326404 17:46785789-46785811 GGGCCCTGTGCTCCATCCCAGGG + Intronic
1149642507 17:58212934-58212956 AGGCACTGAGGCTCATCCCTTGG + Intronic
1150345185 17:64399182-64399204 AGGCACTGAGCGCTGCCCCTTGG - Intronic
1150877532 17:68986163-68986185 ACGCAATGATCGCCATCACACGG - Exonic
1157202225 18:45668893-45668915 AGGCACTGAGGGCTTCCCCATGG - Intronic
1157616157 18:48988913-48988935 AGGCACTGGGGGCCTTCCCAGGG + Intergenic
1158000125 18:52608650-52608672 AGGCACTGAGTGCCAACTTAAGG + Intronic
1160096498 18:75878163-75878185 AGGCACTCAACACCAGCCCATGG + Intergenic
1161541199 19:4852387-4852409 AGGCGGGGAGCGCCATCCCCCGG + Intronic
1164691722 19:30215795-30215817 GGGCACTGAGAGACATCCCTGGG + Intergenic
1165018158 19:32899410-32899432 AGGCACACAGCACCATGCCAGGG + Intronic
1167240532 19:48340649-48340671 AGACACTGAGTCCCAGCCCACGG - Intronic
1167663767 19:50811673-50811695 AGGCAGGGAGGACCATCCCAGGG + Intergenic
1167663777 19:50811711-50811733 AGTCAGTGAGGACCATCCCAGGG + Intergenic
1167663788 19:50811749-50811771 AGGCAGTGAGGACCATCCCAGGG + Intergenic
1167663890 19:50812091-50812113 AGGCAGGGAGGACCATCCCAGGG + Intergenic
1167663902 19:50812129-50812151 AGGCAGGGAGGACCATCCCATGG + Intergenic
1167663912 19:50812168-50812190 AGGCAATGAGGACCATCCCAGGG + Intergenic
1168327454 19:55545528-55545550 AGGCCCTGCGCTCCATCTCAGGG + Exonic
925664574 2:6238934-6238956 GGACACTGTGCGCCATCTCAGGG + Intergenic
927651606 2:24916900-24916922 AGGCATTGACCCCCAGCCCAGGG - Intronic
927933217 2:27059066-27059088 AGGCACAGGGACCCATCCCAAGG - Intronic
928605412 2:32941271-32941293 AGGCACTGAGGGCCAGCACGAGG + Intergenic
934074472 2:88416203-88416225 AGGCACTGGGCACAATCCCCAGG - Intergenic
936017138 2:108968072-108968094 CAGCACTCAGCTCCATCCCAGGG - Intronic
936075243 2:109397631-109397653 AGGCCCTGAGGACCAGCCCAGGG + Intronic
937849667 2:126621152-126621174 GGGCACTGAGCTCAATCTCATGG + Intergenic
948899481 2:240949152-240949174 GGGCACTGAGCTCCATTCCAGGG - Intronic
1171240911 20:23566390-23566412 AGGCACATAGCGCCATCCTCTGG - Intronic
1171457130 20:25278474-25278496 TGGCACTGAGATCCCTCCCAGGG - Intronic
1173092479 20:39986325-39986347 AGGCACTGAGAGTTATCCCTGGG - Intergenic
1173135207 20:40433322-40433344 AGGCACTGAGCACCCTGCCCTGG + Intergenic
1174582724 20:51583852-51583874 AGGCACTGAGTTCCACACCAGGG - Intergenic
1175330527 20:58160866-58160888 AGGCACCCAGGGCCATGCCAGGG + Exonic
1175771982 20:61629761-61629783 GGGCACCGAGCACCTTCCCATGG - Intronic
1178777153 21:35562727-35562749 AGGCACTGAGAGTTATCCCAAGG + Intronic
1178845669 21:36172203-36172225 AGCCACTGAGCTTCCTCCCAGGG + Intronic
1179824671 21:43957391-43957413 GGGCACTGAGTGCACTCCCATGG - Intronic
1180537201 22:16403863-16403885 AGGCACACAGCGCCAGCGCAGGG + Intergenic
1180571106 22:16720673-16720695 AGGGACTGAGAGCCATGCCCTGG + Intergenic
1183108782 22:35633062-35633084 ATGCACTGAGGGCCTCCCCACGG + Intronic
1183396549 22:37574744-37574766 GGGCACTGAGGGTCCTCCCATGG - Intronic
1183616844 22:38950812-38950834 AGGCACTGGGCCTCATCCCAGGG + Intergenic
1184384839 22:44168100-44168122 AGGCACTGAGCCCCAAATCACGG + Intronic
950312632 3:11972361-11972383 AGGCTCTGAGCTCCAGGCCATGG + Intergenic
951465933 3:23000500-23000522 ATGAAATGAGAGCCATCCCAGGG - Intergenic
954579671 3:51696474-51696496 AGGACCTGAGAGCCAGCCCATGG + Intronic
955621892 3:60873402-60873424 AAGCACTCAGCGCCGTCCCAGGG + Intronic
963607403 3:147423022-147423044 AGCCGCTGAGCGCCAGACCAGGG - Intronic
968650761 4:1759401-1759423 AGGCCCTGGGCGCCAGCCCGAGG - Intergenic
982432463 4:155338371-155338393 AGACACTCAGCGCCAGCTCATGG + Intergenic
985415270 4:189730328-189730350 AGACACGGAGCACCATCCAAGGG - Intergenic
993623366 5:90193383-90193405 AGGCAAAGAGCCCCACCCCATGG - Intergenic
999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG + Intergenic
1001297691 5:170510293-170510315 AGGCACTGAGTCTTATCCCAGGG + Intronic
1001858609 5:175033809-175033831 AGGGACTCAGCTCCATACCAAGG - Intergenic
1001951684 5:175820855-175820877 CGGCCCTGAGCACCATCCAAAGG - Intronic
1002806935 6:586326-586348 GGGCACTGCGGGCCTTCCCAGGG + Intronic
1005010540 6:21331432-21331454 AGTCACTGAGCGCCTTGCCAAGG + Intergenic
1010585221 6:77650496-77650518 AGGCGCTCTGCGCCATCCCCAGG - Intergenic
1015712912 6:136161828-136161850 TGGCACTGTGCCCCATACCATGG + Intronic
1015881915 6:137878735-137878757 AGGCCCCGAGCGCCATGCCAGGG - Exonic
1017749638 6:157479460-157479482 AGGGCCTGAGAGCCATACCAGGG - Intronic
1018723000 6:166588150-166588172 AGGAGCTCAGCTCCATCCCAGGG + Intronic
1027554668 7:79648377-79648399 AGGCAGTGATGCCCATCCCAAGG - Intergenic
1028446829 7:90934111-90934133 GGGCACTGACCGCCTTTCCAGGG - Intronic
1029643196 7:101834090-101834112 AGGCACTAAAGGCCATCCCTGGG - Intronic
1032066556 7:128775711-128775733 TGGTACTGAGGCCCATCCCACGG + Exonic
1034266344 7:149782882-149782904 AGGCCCTCAGCGCCAATCCAGGG - Intergenic
1034303601 7:150035253-150035275 AGGGACTGAGAGCCAGCCCCTGG - Intergenic
1034304049 7:150036953-150036975 AGGGACTGAGAGCCAGCCCCTGG - Intergenic
1034304568 7:150038850-150038872 AGGGACTGAGAGCCAGCCCCTGG - Intergenic
1034305258 7:150041597-150041619 AGGGACTGAGAGCCAGCCCCTGG - Intergenic
1034305432 7:150042148-150042170 AGGGACTGAGAGCCAGCCCCTGG - Intergenic
1034801413 7:154058504-154058526 AGGGACTGAGAGCCAACCCCTGG + Intronic
1034801920 7:154060353-154060375 AGGGACTGAGAGCCAGCCCCTGG + Intronic
1034802486 7:154062429-154062451 AGGGACTGAGAGCCAACCCCTGG + Intronic
1034802544 7:154062591-154062613 AGGGACTGAGAGCCAACCCCTGG + Intronic
1034802599 7:154062754-154062776 AGGGACTGAGAGCCAACCCCTGG + Intronic
1037006757 8:13790888-13790910 TGGCACTGAGCCTCAGCCCACGG + Intergenic
1038846966 8:31238986-31239008 AGGCCCTGAGCTGCTTCCCAGGG + Intergenic
1039571261 8:38588221-38588243 AGGCACTTTGGGCCATCCAAAGG - Intergenic
1039957937 8:42221582-42221604 AGGCACTGTGAGCCATGCTAAGG + Intergenic
1040000902 8:42575442-42575464 AGGTCCTGAGCCCCACCCCACGG - Intergenic
1040582245 8:48707555-48707577 AAGAACTCAGCGCCATGCCAGGG - Intergenic
1045773473 8:105773120-105773142 ATGCACTGAGCGCCATCTGCTGG + Intronic
1047178831 8:122567877-122567899 ATACACTGAGCACCCTCCCAAGG + Intergenic
1047184107 8:122616645-122616667 AAACTCTGAGCGCCATCTCATGG + Intergenic
1047294115 8:123556189-123556211 AGTTACTGAGTGCCATACCAAGG + Intergenic
1051032775 9:12702345-12702367 AAGCACTGAGCGACATCCTGTGG - Exonic
1051093665 9:13439809-13439831 AGGCTCAGAGATCCATCCCAGGG + Intergenic
1051607072 9:18926730-18926752 AGGCCCTGAGCCCAAGCCCAAGG + Intergenic
1053619690 9:39802683-39802705 AGGCACTCAATGCCAGCCCATGG + Intergenic
1053877865 9:42561999-42562021 AGGCACTCAATGCCAGCCCATGG + Intergenic
1053894791 9:42732367-42732389 AGGCACTCAATGCCAGCCCATGG - Intergenic
1054233830 9:62539695-62539717 AGGCACTCAATGCCAGCCCATGG - Intergenic
1054264468 9:62904760-62904782 AGGCACTCAATGCCAGCCCATGG - Intergenic
1056747750 9:89318784-89318806 AGCCGCTGACCGCCACCCCAAGG - Intronic
1061488038 9:130930187-130930209 AGGCACTGAGAGACAGTCCAAGG + Intronic
1062478486 9:136741061-136741083 AGGGACTGAGTGCCCTCCCGGGG + Intronic
1062528658 9:136989861-136989883 AGGCCCTCAGTGCCATCTCAAGG - Intergenic
1189141926 X:38616276-38616298 AGGCACAGAGAGTCTTCCCAGGG + Intronic
1192174754 X:68878674-68878696 ACGCACTCAGGGCCATCACACGG + Intergenic
1197645642 X:129013560-129013582 AGGCTCTGAGGGCAATTCCATGG + Intergenic
1200747698 Y:6916972-6916994 GGGCACTGGGCAGCATCCCAGGG - Intronic