ID: 1119164169

View in Genome Browser
Species Human (GRCh38)
Location 14:72478668-72478690
Sequence ATGCCCAGATTCACTTTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119164166_1119164169 -7 Left 1119164166 14:72478652-72478674 CCCTTTCAGCTATAAAATGCCCA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1119164167_1119164169 -8 Left 1119164167 14:72478653-72478675 CCTTTCAGCTATAAAATGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 180
Right 1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1119164165_1119164169 -6 Left 1119164165 14:72478651-72478673 CCCCTTTCAGCTATAAAATGCCC 0: 1
1: 1
2: 1
3: 23
4: 717
Right 1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1119164162_1119164169 30 Left 1119164162 14:72478615-72478637 CCTTCAGCCTCTGGATTAATTCA 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1119164164_1119164169 23 Left 1119164164 14:72478622-72478644 CCTCTGGATTAATTCAAATGGAA 0: 1
1: 0
2: 5
3: 20
4: 238
Right 1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119164169 Original CRISPR ATGCCCAGATTCACTTTATA GGG Intronic
906934224 1:50197834-50197856 ATGCCAAGATTCAGTTAAGAGGG + Intronic
908224105 1:62038907-62038929 GTGCACAGATTCACTTAATCTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
915320720 1:155054710-155054732 ATGCCCAGATACTTTTTGTAAGG - Intronic
915873347 1:159585781-159585803 ATACCCAGATTCAGTCTAGAAGG + Intergenic
916349819 1:163836512-163836534 ATGCACAGATCCACTTTACTTGG - Intergenic
922389160 1:225120775-225120797 ATGCCCAGATTCATTTTTTCAGG - Intronic
1072279953 10:93856679-93856701 ATTCACAGTTTCACTTTCTATGG + Intergenic
1075252305 10:120890694-120890716 ATGCCCAAATTCACTCTTGAAGG + Exonic
1077856788 11:6134467-6134489 TTGTCCAGCTTCACCTTATATGG + Intergenic
1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG + Intronic
1083683530 11:64362077-64362099 CTGGCCAGTTTCACTTTATTTGG + Intronic
1085184623 11:74565041-74565063 ATGCCCCGAATCACTTAGTAAGG - Intronic
1085969767 11:81573890-81573912 ATTCCTAGATACATTTTATATGG + Intergenic
1095912079 12:47438233-47438255 ACTTCCAAATTCACTTTATAAGG + Intergenic
1101182212 12:102231292-102231314 ATGGCCAGATTGAATTTACAAGG + Intergenic
1101459474 12:104875492-104875514 CAGCCCAGACTCATTTTATAAGG - Intronic
1102201034 12:111057862-111057884 CTGCCCAGAGTCACTTAATGGGG + Intronic
1103491722 12:121326476-121326498 TTGACGAGATTCTCTTTATAAGG - Intronic
1105533081 13:21237590-21237612 CTGCCCAGATTCCATTTATATGG + Intergenic
1107451213 13:40511833-40511855 ATGCAAAAATTAACTTTATATGG - Intergenic
1107876238 13:44793226-44793248 ATGGCCCTATTCACTCTATATGG + Intergenic
1113422082 13:110178826-110178848 GTGCTAAGCTTCACTTTATAGGG + Intronic
1116124580 14:40766657-40766679 TGGCCCAGATTCACTTTTGAAGG - Intergenic
1116398606 14:44477008-44477030 ATGCTCTTTTTCACTTTATAAGG - Intergenic
1117077656 14:52120845-52120867 TTGCCTGGATTCATTTTATAGGG + Intergenic
1118525684 14:66639071-66639093 GTGCTCAGATTCATTATATATGG + Intronic
1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG + Intronic
1119913897 14:78377732-78377754 ATCCCCAGTGTCTCTTTATAAGG + Intronic
1120135087 14:80857942-80857964 ATGGCCAGATTTTCTTTATTTGG - Intronic
1121386611 14:93532983-93533005 ATACCCAGACTGACTGTATATGG + Intronic
1121933919 14:97999026-97999048 TTGCCCAGAATCACTTTGTCTGG - Intergenic
1125208388 15:37181723-37181745 ATGATCAGATTCTCTTTACAGGG - Intergenic
1127443751 15:59038934-59038956 TTGCCCAGATTCATTATATTAGG + Intronic
1136238458 16:28929694-28929716 ATGCCCAGATACATTTTTTTTGG + Intronic
1137605675 16:49785451-49785473 ATACCAAAATTCACTTTAAATGG + Intronic
1138484267 16:57326778-57326800 ATTCCCATAATCAATTTATAAGG + Intergenic
1143688833 17:8542945-8542967 ATGCCTAAATTCACTTTATGAGG - Intronic
1147004355 17:37389942-37389964 ATGATCTGATTCAGTTTATATGG - Intronic
1150353710 17:64465664-64465686 ATGCCCAGTCCCACTTTCTAGGG + Intronic
1156970764 18:43151710-43151732 CAGCCCAGATTCAGTTTACAAGG + Intergenic
1157668688 18:49510492-49510514 TTTCCCAGAATCACTTTGTAAGG + Intergenic
1159706790 18:71699900-71699922 ATTTCCAAATTCACTTTATAAGG + Intergenic
1164898417 19:31897386-31897408 CTGCCCAGATTCACCTTCAATGG - Intergenic
1166579538 19:43882334-43882356 ATGCCAAGATTAACTTAAAATGG + Intronic
925375847 2:3384764-3384786 ATGACCCAATTCACTTTATAAGG - Intronic
931920190 2:67006812-67006834 ATGCCCATATTCACTCTGTTCGG + Intergenic
933369877 2:81400865-81400887 GTTCCCACATTCACTTGATACGG - Intergenic
938671391 2:133589685-133589707 ATGGCCAGAGCCCCTTTATATGG + Intergenic
940180670 2:150929047-150929069 ATGCCAAAATTCACCTTAGATGG - Intergenic
940245936 2:151616145-151616167 ATGAACAGCTTCACTTTTTATGG - Intronic
943940107 2:193982357-193982379 ATGGCCAGATAAACTTCATAAGG + Intergenic
944951446 2:204754503-204754525 ATTTCCAGAATAACTTTATAAGG - Intronic
946775621 2:223137492-223137514 AGGTAGAGATTCACTTTATATGG + Intronic
1170435537 20:16324277-16324299 ATGGCCATGTTCACTTTAAAAGG - Intronic
1178827609 21:36029790-36029812 ATGCCCAGATTCAGAAGATAGGG - Intergenic
1182905302 22:33930834-33930856 ATGCCCAGATTTACTCTGTGGGG - Intergenic
1183409342 22:37645774-37645796 ATGCCCAGAGTCATTTGAGAAGG + Intronic
1183817910 22:40319102-40319124 ACCCCCATATTCATTTTATATGG - Intronic
951107336 3:18760292-18760314 ATGCACAGATTTACTTTCTGTGG + Intergenic
957891146 3:86360950-86360972 ATGCACATACTCCCTTTATATGG - Intergenic
960280583 3:115777381-115777403 GTTCCCAGATACACTTTCTATGG - Intergenic
960925507 3:122792206-122792228 TTGGCCATTTTCACTTTATACGG + Intronic
962042960 3:131726268-131726290 ATGCCAACATGAACTTTATAAGG - Intronic
966021856 3:175222713-175222735 ATGTCCATATTTAATTTATATGG + Intronic
967062052 3:185881329-185881351 ATCCTCAGTTTCACTTTTTACGG - Intergenic
967310977 3:188105916-188105938 ATGCCCAGAATCCCTTTAATAGG + Intergenic
971728973 4:30351635-30351657 GTGCCAACATTCACTTTAAAAGG + Intergenic
973100644 4:46264694-46264716 ATTTCCTGACTCACTTTATAAGG - Intronic
975265924 4:72367275-72367297 ATAACCAGATTCAGTTTCTAAGG - Intronic
983482120 4:168288119-168288141 ATCCACAGATAAACTTTATAAGG - Intronic
985954665 5:3254985-3255007 ATGTCCAGATGCACTCTTTAAGG - Intergenic
986028584 5:3873851-3873873 ATGCCCAGATTCCCTCACTATGG - Intergenic
988885072 5:35547814-35547836 TTGCCCAGATTCCCTTTACTGGG + Intergenic
989774870 5:45193087-45193109 ATGCCAAGATTGACTTTGAAGGG - Intergenic
990953993 5:61325581-61325603 ATTCCAAAATTCACTTTGTAAGG - Intergenic
991438730 5:66623273-66623295 ATTCCCAGACTCATTTTATGAGG + Intronic
994879236 5:105464981-105465003 ATATTCAGATTCCCTTTATATGG + Intergenic
996325966 5:122274175-122274197 ATTCCCAGAATCACTTCAAATGG + Intergenic
997723252 5:136097867-136097889 CTCCCCAGATTCAATTTATAGGG - Intergenic
998422089 5:141996985-141997007 ATCCACAGTTTCACTTTCTATGG + Intronic
1002333094 5:178458740-178458762 TTGCCCAGATCCATTCTATAAGG - Intronic
1003389170 6:5698624-5698646 CTGCCCAGATTCCATTTATATGG - Intronic
1011829802 6:91358060-91358082 ATTCCCAAATTCACATTATCTGG + Intergenic
1015817512 6:137225845-137225867 ATGCCCAGATTCATTTTGGAGGG - Intergenic
1016631042 6:146231923-146231945 ACTCCCTGATTCACTTTATGAGG - Intronic
1018404535 6:163464818-163464840 CTTCCCAGATTCATTTTATGAGG + Intronic
1019211080 6:170405570-170405592 ATCCCCAGCTTCACTTTCTGTGG - Exonic
1020417423 7:7961898-7961920 ATGCCAACATTTACTTTAAAAGG - Intronic
1022853092 7:34285470-34285492 ATGCTCAAGTTCACTTTCTATGG + Intergenic
1024480576 7:49857805-49857827 AAGCTCTGATTCACTTTTTATGG - Intronic
1027330173 7:77084391-77084413 ATCCCCATATTAACTTTATGAGG + Intergenic
1029785589 7:102786941-102786963 ATCCCCATATTAACTTTATGAGG - Intronic
1031253332 7:119415089-119415111 ACACCCAGATTCATTTTATGGGG + Intergenic
1039343369 8:36675304-36675326 ATTCCCAAATTCATTTCATAAGG + Intergenic
1040365867 8:46714837-46714859 ATGGCTAGATTTACTTCATAAGG + Intergenic
1040844904 8:51827312-51827334 ATGCACAGTTTCACTTTCCACGG + Intronic
1041087005 8:54266057-54266079 ATGAGCAGATGCAGTTTATATGG + Intergenic
1043087566 8:75853992-75854014 ATTTCTAGATTCACTTTAAAAGG - Intergenic
1043748352 8:83904333-83904355 GTGCTCAGGTTTACTTTATATGG - Intergenic
1044245045 8:89934065-89934087 ATGCCCACAATCCCTTTCTAAGG - Exonic
1044408579 8:91859594-91859616 ATTCCCCCATTCCCTTTATAAGG - Intergenic
1044843657 8:96359653-96359675 AGACCCAGATTCCCTTTACAGGG + Intergenic
1047756227 8:127920492-127920514 ATGCTCATAATCACTTTAGAAGG - Intergenic
1050162184 9:2730488-2730510 ATCCCCAGACTCATTTTACAAGG - Intronic
1060778814 9:126396699-126396721 AGGACCAGATTGTCTTTATAGGG - Intronic
1186151582 X:6680213-6680235 GTGCCAAGAATCACTTGATAAGG - Intergenic
1188080577 X:25834777-25834799 GTGCACATATTCACTTTCTAAGG + Intergenic
1188655482 X:32689548-32689570 ACTTCCAAATTCACTTTATAAGG + Intronic
1189003186 X:36966999-36967021 CTGCCCAGATTCATTCTGTAGGG - Intergenic
1191987565 X:66999150-66999172 ATGCTCAAAATCAGTTTATATGG - Intergenic
1193801597 X:85943390-85943412 ATGCACAAATTCAAGTTATAGGG + Intronic
1194054834 X:89118440-89118462 ATTTCCAAATTCACTTTATGAGG - Intergenic
1194279316 X:91928384-91928406 ATGCCCTGATTAAATTTATTAGG + Intronic
1195336503 X:103859931-103859953 GTGCCCAGATTCAGGTAATAGGG + Intergenic
1199251761 X:145671552-145671574 ATGCCCAAACTCATTTTATGAGG - Intergenic
1200596794 Y:5151879-5151901 ATGCCCTGATTAAATTTATTAGG + Intronic
1201340546 Y:12928222-12928244 TTGCCCTGACTCACTTCATAAGG + Intergenic