ID: 1119171421

View in Genome Browser
Species Human (GRCh38)
Location 14:72538960-72538982
Sequence CCAGCAAATAACTGAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119171421 Original CRISPR CCAGCAAATAACTGAAATGA GGG (reversed) Intronic
902061205 1:13644728-13644750 TTAGCAAACAACTGAAATGATGG + Intergenic
902829369 1:19000456-19000478 CCCAGAAATAACAGAAATGATGG + Intergenic
903735893 1:25529835-25529857 CCAGGGAATAACTGAGAAGAGGG + Intergenic
905021260 1:34814465-34814487 CCCCTAAATAACAGAAATGATGG + Intronic
906239381 1:44232964-44232986 CAAGAAAAAGACTGAAATGATGG - Intronic
906578267 1:46910683-46910705 CCAGGAAATAATTCAAATGCAGG + Intergenic
906652987 1:47526388-47526410 CTAGCAAATAGTGGAAATGATGG + Intergenic
908276120 1:62473103-62473125 CTAGCAAATCACTGAAATTGGGG + Intronic
909621109 1:77668343-77668365 CCAGCTAGAAATTGAAATGATGG - Intronic
911766616 1:101683875-101683897 TCAGCAGAGAACTGAAATCATGG - Intergenic
913026026 1:114841333-114841355 TAAGCATACAACTGAAATGATGG + Intergenic
916982053 1:170148478-170148500 GCTGCAAATAAGTAAAATGAAGG - Intronic
917242468 1:172963560-172963582 CCAGCAAATATATGAAAAGAAGG + Intergenic
917666863 1:177233630-177233652 CCAGCAAAGAGCTGAATTGAAGG - Intronic
918135622 1:181671443-181671465 CAAGCAAATAACACAAATAATGG + Intronic
918506358 1:185258442-185258464 CCAGAAAATGAGTAAAATGAAGG - Intronic
1063229603 10:4051713-4051735 CCAGCAAATTGCTCAAATGTCGG + Intergenic
1063370407 10:5518211-5518233 CCAGCAAATAAAGGAGATGGTGG - Intergenic
1066687383 10:37993830-37993852 CCAGAAAATAAGAGAAGTGAAGG + Intergenic
1067209987 10:44252070-44252092 CTAGTAAATAACTCAATTGAGGG - Intergenic
1067766400 10:49090766-49090788 CCAGCAAATAGCTGGCATGGGGG + Intronic
1068853374 10:61770277-61770299 CCTGCAAATACCTGAAATAGTGG - Intergenic
1071372612 10:84967745-84967767 CCCGGAAATAACTGAGCTGAAGG - Intergenic
1071936299 10:90534640-90534662 CAGGCAAATAACTGGAATCAAGG - Intergenic
1072204842 10:93194236-93194258 CCAGAAAACAAATGAAATAACGG + Intergenic
1074594215 10:114845420-114845442 CCAGGAAAGAAATGAAATTAAGG - Exonic
1074953624 10:118365513-118365535 CCAGCAAAGAGCTGTAATAATGG - Intergenic
1075106078 10:119541103-119541125 CCAGCACATCACTGAAACGGAGG + Intronic
1075326138 10:121533649-121533671 GCAGCAAAGAACTGAAAGCAGGG + Intronic
1076280110 10:129239538-129239560 CCAGCGAATGACAGAGATGATGG + Intergenic
1076718659 10:132382467-132382489 GCAGCCAATTACGGAAATGATGG + Intergenic
1078203522 11:9206863-9206885 CCAGCAAGGTACAGAAATGAAGG + Intronic
1081114517 11:39183432-39183454 CCAGGTAATAACTGAAATTCAGG - Intergenic
1081539808 11:44024822-44024844 GCAAAAAATAACAGAAATGAAGG - Intergenic
1082661393 11:55916355-55916377 CCATAAAATAATTGAAATGAGGG - Intergenic
1085361521 11:75892254-75892276 CCAGCAGATGACTGATCTGATGG - Intronic
1086218823 11:84416849-84416871 ACAGTAAATAACAGAAATAATGG + Intronic
1087902696 11:103660285-103660307 CAAGCAAATGACTGAAATTTTGG - Intergenic
1088390461 11:109308712-109308734 CCACCAAGAAGCTGAAATGATGG + Intergenic
1090080151 11:123606953-123606975 ACAGCAAATGACTGAAAACAGGG - Intronic
1090479230 11:127053454-127053476 ACAGATGATAACTGAAATGATGG + Intergenic
1090513900 11:127404226-127404248 CAAGCAAAAAACTGTGATGACGG + Intergenic
1090816611 11:130302671-130302693 CCAGTAAAAAAGTGAAATGAGGG + Intronic
1091958130 12:4665560-4665582 ACACCAAATAACTGAAATCAGGG - Intronic
1092174705 12:6395401-6395423 ACAGCAGATAACTGAAACCATGG - Intergenic
1094543646 12:31383938-31383960 CCTGCAAATAAATTAAATGCTGG - Exonic
1095253153 12:40002051-40002073 CCAACTAACAACTGAAATTAAGG + Intronic
1095303096 12:40610146-40610168 ACAGCTAACAAGTGAAATGAAGG - Intergenic
1096425120 12:51494933-51494955 CGATCAAAGAACTGAAAGGAAGG - Exonic
1097520816 12:60668551-60668573 ACAGCTAATAACGGAAGTGAAGG - Intergenic
1097568779 12:61305536-61305558 CCAACAAATAACTGAGAACATGG + Intergenic
1099112137 12:78574798-78574820 CCAGTGAATTACTGAAATCATGG + Intergenic
1100030570 12:90185091-90185113 AGAACAAATAATTGAAATGAAGG + Intergenic
1100546042 12:95603438-95603460 CAAGGAAATAACTGAAATGAAGG + Intergenic
1101936655 12:109063533-109063555 ACAGAAAATAACTGAAAGCAGGG - Intronic
1103715774 12:122944622-122944644 CCAGCCACAAACTGAAATGCCGG + Intronic
1105248092 13:18670870-18670892 CAAGCAAACAATTGAAATGCAGG - Intergenic
1106611415 13:31286044-31286066 TCACCAAATAATTAAAATGAGGG + Intronic
1107492061 13:40890084-40890106 CCAAGAAATAACTGAAGTGAAGG + Intergenic
1107629070 13:42324871-42324893 CCAGCAGGCAACAGAAATGAGGG - Intergenic
1108561059 13:51644585-51644607 ACTGCAAATAACTGGAATGGCGG + Intronic
1108565511 13:51693192-51693214 GCAAGAAATAACTAAAATGAAGG - Intronic
1109507528 13:63325077-63325099 ACTGCAATTAACTGAAATCATGG - Intergenic
1110363340 13:74653839-74653861 CCAGGAAACAAATCAAATGAAGG - Intergenic
1110527498 13:76555953-76555975 CCAGCAAATAAATTATTTGAGGG - Intergenic
1110607897 13:77454517-77454539 ACAGCTGGTAACTGAAATGAGGG - Intergenic
1111472429 13:88700512-88700534 CCAATAAAGAACTCAAATGATGG - Intergenic
1112991770 13:105522538-105522560 CAAGGAAATAAGTGCAATGAAGG - Intergenic
1113181483 13:107632861-107632883 CCAGAAAAAGACGGAAATGAAGG + Intronic
1113745172 13:112739347-112739369 CCAGCCAATGAATGAAAAGATGG + Intronic
1115418652 14:33166673-33166695 TCAGAAGAGAACTGAAATGAAGG - Intronic
1116343910 14:43763364-43763386 AAAGCAAATAACTGAAATTTAGG - Intergenic
1118424548 14:65645770-65645792 CAAGGTAATAACAGAAATGAAGG - Intronic
1119171421 14:72538960-72538982 CCAGCAAATAACTGAAATGAGGG - Intronic
1119637453 14:76288067-76288089 CCAGAAAATAACTGACAAGATGG - Intergenic
1120873263 14:89356963-89356985 CCTGCAGAGAACTGATATGACGG + Intronic
1122360260 14:101155395-101155417 CCCCCAAATAACTCAAACGAAGG - Intergenic
1123510187 15:20991181-20991203 CCATCACATCACTGAAAGGAGGG - Intergenic
1124787685 15:32697350-32697372 CCAACAAATAAATGATAGGAGGG + Intergenic
1126054114 15:44713282-44713304 CCAGCAAATACCAGTAATGGTGG - Intronic
1127977271 15:64006931-64006953 CCAGGAAGTCACTGAAATGCAGG + Intronic
1129081231 15:73042763-73042785 CAAGAATATAAGTGAAATGATGG - Intergenic
1129698785 15:77755691-77755713 CCAGGAAATATCTGAAATGCAGG - Intronic
1132192489 15:99879231-99879253 CCTCCAAAAAACTGAAAAGAAGG + Intergenic
1134155712 16:11841587-11841609 CCAGAAGATAACTGAAAAGTCGG + Intronic
1135745565 16:25013956-25013978 CCTGCAAATAACAGAAAAGTAGG + Intronic
1137878489 16:52021002-52021024 CTACAAAAAAACTGAAATGAAGG + Intronic
1138107702 16:54298243-54298265 GCAGCACATAACTGAAATTCTGG + Intergenic
1138233123 16:55354512-55354534 CCAGAAAATAAGAGAAATCAGGG - Intergenic
1140210459 16:72965441-72965463 GCTGCAAAGAACTGAAATGTAGG + Intronic
1144318482 17:14088371-14088393 ACAGAAACCAACTGAAATGATGG - Intronic
1145052049 17:19670360-19670382 AAAGCAAAAAACTGACATGAAGG - Intronic
1146086622 17:29836643-29836665 ACCACAAATAACTGAAAAGATGG - Intronic
1149046177 17:52248002-52248024 CAAGGGAATAACTGAATTGAGGG + Intergenic
1149259321 17:54861712-54861734 TTAGCAAATGAATGAAATGAAGG - Intergenic
1150242329 17:63644884-63644906 CCAGCAAATAATAGAGATAAAGG - Intronic
1151031714 17:70748136-70748158 CCAGCGAATAAATGAAGAGATGG - Intergenic
1152886922 17:82857484-82857506 ACAGAAAAGAACTGAAAAGAGGG - Intronic
1154440762 18:14388261-14388283 CAAGCAAACAATTGAAATGCAGG + Intergenic
1155527019 18:26727350-26727372 CAAAGAAATAACAGAAATGATGG - Intergenic
1155851942 18:30784944-30784966 CCAGCACATGAGAGAAATGAAGG + Intergenic
1157591458 18:48838703-48838725 CCACCAAATAAATGAAGTGTTGG - Intronic
1158602527 18:58866888-58866910 CCAGTAAATAGCTTACATGATGG + Intronic
1159202796 18:65209008-65209030 CCAGAAATAAACTGAAATAAAGG + Intergenic
1159431001 18:68353396-68353418 ACTGCAAATAACTGAAACCAGGG + Intergenic
1165650137 19:37480540-37480562 GCAAGGAATAACTGAAATGAGGG - Intronic
1165659773 19:37567094-37567116 TGAGCAGAAAACTGAAATGAGGG - Intronic
926527297 2:13996587-13996609 CCAAAAAATAATTGAAATAATGG + Intergenic
927385798 2:22532577-22532599 CCAGCAAAGAACAGGAATGGGGG - Intergenic
928669963 2:33592923-33592945 ACAGGGAATAACTTAAATGAAGG - Intronic
928707096 2:33961674-33961696 CCATGAACTAAATGAAATGATGG - Intergenic
931632223 2:64311538-64311560 CCAGCAGATAACTTGAATGAAGG + Intergenic
931886096 2:66619103-66619125 CCTACAAATAAATGAAATAAAGG + Intergenic
932636879 2:73397327-73397349 CCATCAGAGAACTGAGATGAAGG - Intronic
933005148 2:76982839-76982861 CTTGCAAATAAGTGAAGTGAGGG + Intronic
938471227 2:131564238-131564260 CCAGCAGCAAACTCAAATGAAGG - Intergenic
939449701 2:142357758-142357780 CCATAAAATAAATGAAATAATGG + Intergenic
940078140 2:149767251-149767273 GCAGCAAATAAATAAAATGAAGG - Intergenic
940179383 2:150914853-150914875 ACAGATACTAACTGAAATGAAGG + Intergenic
940233224 2:151481675-151481697 CCTGCAAATAATGGAAATAATGG + Exonic
940823166 2:158380494-158380516 TCAGCAAATTACTTAAATGGTGG + Intronic
940983397 2:160027389-160027411 TCAGCAAATTCCTGAAATAATGG + Intronic
941296562 2:163746063-163746085 CCAGAAAAGAACTGAAATATTGG + Intergenic
941617610 2:167739017-167739039 CCACCATAAAACTGAAATGTAGG - Intergenic
942923825 2:181409636-181409658 ACAGTAAATATTTGAAATGATGG - Intergenic
944750043 2:202699549-202699571 CCACCATGTAACTGAAAGGATGG - Intronic
944856197 2:203769548-203769570 CCAACAAATATATGAAAAGATGG + Intergenic
945813363 2:214574482-214574504 CCATCAAATAAATGAAATCTGGG - Intronic
946524964 2:220508414-220508436 TCTGCAAAAAACTAAAATGAAGG - Intergenic
946596688 2:221313403-221313425 CCAGCAATTAACTTAATTTAAGG - Intergenic
948715899 2:239863373-239863395 CAACCAACTAACTCAAATGAAGG + Intergenic
949030415 2:241794262-241794284 CCACAAAATATCTAAAATGAGGG - Intronic
1170872704 20:20221620-20221642 CCAGCAAATAATGCAATTGAAGG - Intronic
1171192679 20:23170350-23170372 CCAGACAATAACAGAAAAGAAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174738259 20:52986089-52986111 CCAGTAAAGAAATGAAATAATGG + Intronic
1174762679 20:53221831-53221853 CCAGAAAATAATTGAAATTCTGG - Intronic
1176891603 21:14326143-14326165 CCAAAAAATAAAAGAAATGATGG - Intergenic
1177015094 21:15776859-15776881 TAAGCAAATAACTAAAATGAAGG + Intronic
1180412896 22:12632544-12632566 GCAAGAAATAACTGAAATCAGGG + Intergenic
1180471721 22:15664079-15664101 CCAGCAGCAAACTCAAATGAAGG - Intergenic
949507059 3:4738296-4738318 TCAACAAATAAAAGAAATGAGGG + Intronic
952094613 3:29934425-29934447 ACAACAAATACCTGAAATGAAGG + Intronic
952629312 3:35445570-35445592 ACTGCAAATAACTGAAACCATGG - Intergenic
953134088 3:40167753-40167775 CTAGCAAATAATTGAATTGAGGG - Intronic
953462512 3:43093206-43093228 CCAGCAAAGCACTGAGATCAGGG + Intronic
957434404 3:80154893-80154915 GGAGCAAATACCTGGAATGAAGG + Intergenic
958560073 3:95736947-95736969 ACAGAAAAGAACTGATATGAAGG + Intergenic
959092031 3:101913236-101913258 CCAGCAAATAAGGGATATGAGGG - Intergenic
959860310 3:111208391-111208413 CTAGAAAATAACTAAAATGATGG - Intronic
959869017 3:111305053-111305075 CCAGCACAGAACTTAAATCAGGG + Intronic
962024028 3:131528334-131528356 CCAGCAGATACCTCAAAAGAAGG - Intergenic
963499154 3:146103017-146103039 CCAGCAGATACCCAAAATGAAGG + Intronic
965722915 3:171681257-171681279 CCAGGAAATACCTGGAATGTAGG - Intronic
966138725 3:176730767-176730789 CTAGCAAATGGCTGACATGATGG - Intergenic
966201487 3:177362960-177362982 CAAGCAAGTAGCTTAAATGAGGG - Intergenic
971175394 4:24277677-24277699 CAAGGAAATAAATGAAATGAGGG - Intergenic
971725407 4:30305477-30305499 CCAGCAAAGAAATAAAATAATGG + Intergenic
971778594 4:31000797-31000819 CCAGAAAATAACCTAAATGGTGG + Intronic
972765001 4:42144606-42144628 TTAGCAAATAAATGAAAAGAAGG - Intronic
973544682 4:51968963-51968985 ACAGCTAACAAATGAAATGAAGG - Intergenic
974247887 4:59345089-59345111 CAAACAAACAAATGAAATGAAGG - Intergenic
975617981 4:76266416-76266438 CCAGAAAAAAACTGGAAAGATGG - Intronic
977831538 4:101599825-101599847 GCAGCAAAGAATTGAAAGGATGG + Intronic
978289301 4:107118477-107118499 CCTGGAAATATCTGAAATGTGGG - Intronic
978590318 4:110317388-110317410 CCCCCAATTAACTGGAATGACGG + Intergenic
979533067 4:121789442-121789464 CCAAAAAAAAACTGAAAGGAGGG - Intergenic
981003285 4:139849393-139849415 AGAGCAAATAACTGAAAGGAGGG + Intronic
981442365 4:144797784-144797806 CAAGCAAATTACTAAAATGAGGG + Intergenic
983198057 4:164829975-164829997 CCATCAAGTAAATGATATGAAGG + Intergenic
985699573 5:1362372-1362394 CCAGCAAATTACTGAATTTAAGG + Intergenic
987496371 5:18650518-18650540 CCAGAAAACAAATAAAATGACGG - Intergenic
987997127 5:25297998-25298020 ATAGCAAATAACAGAAAAGATGG - Intergenic
988607402 5:32690567-32690589 CAAGCCAATAACTGAAACCAAGG - Intronic
990530274 5:56666761-56666783 CCAGCAGATAATTGGAAGGAGGG - Intergenic
991503057 5:67296580-67296602 CCTGCAAATAACTGACATTGAGG + Intergenic
991955454 5:71989666-71989688 CCAGCCAATGACTGATATCATGG + Intergenic
992606839 5:78466293-78466315 CCATTAAATAACTGAATTGGGGG - Intronic
992908005 5:81366368-81366390 ACAACAGATAACAGAAATGATGG + Intronic
993317606 5:86430566-86430588 ACAGTTAATAAATGAAATGATGG + Intergenic
993768805 5:91897756-91897778 ACAGAAAATAGGTGAAATGATGG - Intergenic
994400299 5:99271557-99271579 CCAGGGAATAACAGAGATGATGG - Intergenic
994743767 5:103653565-103653587 CCTGCAAATAACTGAGAATAGGG - Intergenic
995723459 5:115161830-115161852 ACAGCGAAAAACTAAAATGAAGG + Intronic
996331311 5:122332349-122332371 TCACTAAATAACAGAAATGAGGG + Intronic
997745495 5:136296443-136296465 TCAGGAAATAACAGAAAAGAAGG + Intronic
998767920 5:145508991-145509013 TCTGTAAAAAACTGAAATGAGGG + Intronic
999036151 5:148352574-148352596 CTTGCAAATAATTAAAATGAAGG - Intergenic
1001491980 5:172162397-172162419 GCACCAGATAACTTAAATGATGG - Intronic
1003783701 6:9459013-9459035 CCAGTTAATAACTAAACTGAGGG - Intergenic
1004471862 6:15936744-15936766 CCACCAAATAACAAAAATGAAGG - Intergenic
1005869704 6:29965686-29965708 CCAGCAAATAATAAAAAGGAGGG + Intergenic
1008068545 6:47075828-47075850 ACTGCAATTCACTGAAATGACGG - Intergenic
1008380785 6:50837827-50837849 TCAGCAAATAACCAAAAGGAAGG + Intronic
1010099596 6:72088783-72088805 CAAGCAAATTACTTATATGAGGG - Intronic
1011492109 6:87902711-87902733 CCAGAAATTAGCTGAATTGAGGG + Intergenic
1012124383 6:95409302-95409324 CCAGAAAACAACTTAAAAGAAGG - Intergenic
1012323686 6:97886082-97886104 ACAGCAAATTACTGAAAGCAGGG - Intergenic
1013855814 6:114570703-114570725 CCAGCCAAGAAATGGAATGAGGG + Intergenic
1014919802 6:127200533-127200555 CCAGAAAAGAACTGAATTGAGGG - Intergenic
1015067728 6:129051737-129051759 CCAGAAAGTAAATGAATTGATGG + Intronic
1015887045 6:137928126-137928148 CTAGCACAGAACTGAAATCAAGG - Intergenic
1015928864 6:138336507-138336529 CCACCAAATAACAGTAGTGAGGG + Exonic
1015960980 6:138649471-138649493 CCTGCAAATAAATGTATTGATGG - Intronic
1016621483 6:146114414-146114436 TGAGGAAATAACTGAAATTATGG + Intronic
1016977716 6:149825353-149825375 ACAGAAAACAACAGAAATGAGGG - Intronic
1018503900 6:164443360-164443382 CCACCAAATAACTGATTTCATGG - Intergenic
1018601885 6:165552773-165552795 CCAGCAAATCACCAAACTGAGGG + Intronic
1021083604 7:16392635-16392657 TCATCAAGTAACTGAGATGAGGG - Intronic
1022399731 7:30025761-30025783 GAAGCAAATGACTGAAATCATGG + Intronic
1023438218 7:40160156-40160178 CTAGCAAATCACTGAAAATATGG + Intronic
1024681335 7:51692743-51692765 CAAACAAATAAATAAAATGAGGG - Intergenic
1024906018 7:54381293-54381315 CCAAAAAATAAGTGCAATGAAGG - Intergenic
1024986006 7:55193593-55193615 CCAGCAACTTACTGAAAGGCTGG + Intronic
1026376990 7:69761737-69761759 TAAGCTAATAACTGGAATGAAGG + Intronic
1026471642 7:70698374-70698396 CCAGCAAATAGCTGCACTGCAGG + Intronic
1026636948 7:72091763-72091785 CCACCAAATTATTGCAATGAAGG + Intronic
1026934712 7:74247340-74247362 TCAGAAAATAACTGCAATGTAGG + Intronic
1028092452 7:86720355-86720377 CCAGCAAGGCACTAAAATGAGGG + Intronic
1030699775 7:112625485-112625507 ACAGAAAATAACTGAAGTTATGG - Intergenic
1031775433 7:125902924-125902946 TAAGAAAATCACTGAAATGATGG + Intergenic
1032533049 7:132637712-132637734 CAAGCAAATAACTGAAAATGAGG + Intronic
1032794378 7:135265997-135266019 CCAGCAGATGCCTGAAATCAAGG + Intergenic
1033188782 7:139256700-139256722 TCTGCAAATAAGTGATATGAGGG - Intronic
1035005437 7:155654644-155654666 CTAGGTAATAACTGAGATGAAGG - Intronic
1035671245 8:1418897-1418919 CAAGCAAATCACTGAACTGGAGG - Intergenic
1037228853 8:16629746-16629768 CCAGCAAATAACTAATTTCACGG - Intergenic
1038526516 8:28278863-28278885 CCTGAAAATAACTAAAATGTTGG - Intergenic
1039007686 8:33058903-33058925 ACTGCAGATAACTGAAATCATGG + Intergenic
1042379343 8:68094939-68094961 CTAGCAAATAACTGAACCCAAGG - Intronic
1044141664 8:88661542-88661564 CCAACAGAAAACTGAAATCAGGG + Intergenic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1045074483 8:98548165-98548187 CAAGCAAAATACTGCAATGAGGG + Intronic
1045170082 8:99655938-99655960 CAAACAATTAAGTGAAATGAAGG + Intronic
1045539561 8:103070716-103070738 CCAGCATATGTCTGAAACGACGG + Exonic
1046523866 8:115359446-115359468 CCAGCAACTAAAGGAAATAAAGG + Intergenic
1046794176 8:118352850-118352872 CCAGCAAATGACTGATAAAAAGG + Intronic
1046915845 8:119677481-119677503 ACATCAGATAACTGATATGAAGG - Intergenic
1047035227 8:120931005-120931027 ACAGAAAATAACAGAAGTGATGG + Intergenic
1056964741 9:91156203-91156225 CCTAAAAGTAACTGAAATGATGG + Intergenic
1058901239 9:109443966-109443988 CCAGGAAAGAACAGAAATGAAGG - Intronic
1059575442 9:115483465-115483487 CTAGCTAATGACTGAAATAATGG - Intergenic
1059760268 9:117330829-117330851 GCAGAAAATTCCTGAAATGAAGG + Intronic
1188761158 X:34031881-34031903 AAAGCAATTAAATGAAATGATGG - Intergenic
1190483243 X:50898494-50898516 CCAGCAAATAACTTAGTTGGGGG + Intergenic
1191167588 X:57406596-57406618 ACAGCATATATCTGAACTGAAGG - Intronic
1192943726 X:75941582-75941604 ACAGCAAATAAGGGAAGTGAAGG - Intergenic
1193359023 X:80558834-80558856 AAAGCAAATAACAGAAATTAAGG + Intergenic
1193399359 X:81023930-81023952 ACAGGAAATAACTAAAATCAGGG + Intergenic
1196144816 X:112305092-112305114 CAAGCAAATGACTGAACTCATGG + Intergenic
1196978611 X:121187072-121187094 CCAGAACATAACCTAAATGAGGG - Intergenic
1197713279 X:129687492-129687514 CAAGCAAATACCTGACAGGAGGG - Intergenic
1201380191 Y:13367668-13367690 CCAAAAAATAACTGTACTGAAGG + Intronic
1202085076 Y:21128235-21128257 CGATCAAATGAATGAAATGAAGG - Intergenic