ID: 1119172513

View in Genome Browser
Species Human (GRCh38)
Location 14:72545858-72545880
Sequence CTGCAGAACTGGCAAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119172513_1119172515 -8 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172515 14:72545873-72545895 TTCTGCAGTCCCCACCCTTCCGG 0: 1
1: 0
2: 1
3: 23
4: 285
1119172513_1119172528 30 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172528 14:72545911-72545933 GTGTGTGTGTGTGTCAGGTGGGG 0: 3
1: 19
2: 491
3: 2572
4: 8283
1119172513_1119172525 25 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172525 14:72545906-72545928 CAGCTGTGTGTGTGTGTGTCAGG 0: 1
1: 2
2: 45
3: 380
4: 2662
1119172513_1119172527 29 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172527 14:72545910-72545932 TGTGTGTGTGTGTGTCAGGTGGG 0: 4
1: 35
2: 622
3: 3850
4: 14199
1119172513_1119172516 -3 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172516 14:72545878-72545900 CAGTCCCCACCCTTCCGGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 135
1119172513_1119172526 28 Left 1119172513 14:72545858-72545880 CCTTCAGCTTGCCAGTTCTGCAG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1119172526 14:72545909-72545931 CTGTGTGTGTGTGTGTCAGGTGG 0: 1
1: 17
2: 229
3: 2449
4: 10632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119172513 Original CRISPR CTGCAGAACTGGCAAGCTGA AGG (reversed) Intronic
900687394 1:3957436-3957458 CTCCAGAAATGACAAGCTCAGGG - Intergenic
901068856 1:6507493-6507515 CTTCAGACCTGGCAGGCTGGGGG - Intronic
901570086 1:10153099-10153121 CAGGAGAACTGGAAAACTGAAGG - Intronic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902998621 1:20248123-20248145 TTGCAGGACTGGGATGCTGAAGG - Intergenic
903324129 1:22560066-22560088 CTACAAAACAGGCAAGCTGGGGG - Intergenic
903367324 1:22813153-22813175 CTGCCTGACTGGCAAGTTGAAGG - Intronic
905276264 1:36820082-36820104 TTGCAGAACTGGGAGCCTGAAGG - Intronic
905482052 1:38268425-38268447 CTGAAGAGGTGGCATGCTGATGG + Intergenic
907411324 1:54285776-54285798 CTGCAGCCCTGGCATGCTGTAGG - Intronic
910175552 1:84426703-84426725 CTGCAGACCTAGCAAACTGGTGG - Intergenic
913611242 1:120511700-120511722 CTGGGGAGTTGGCAAGCTGATGG + Intergenic
913983548 1:143545122-143545144 CTGGGGAGTTGGCAAGCTGATGG - Intergenic
914579949 1:149010539-149010561 CTGGGGAGTTGGCAAGCTGATGG - Exonic
915307739 1:154990346-154990368 CTGCAGATGTTGGAAGCTGAGGG + Exonic
915719503 1:157974098-157974120 CTGCACAACTGGAAGGATGAAGG - Intergenic
916258858 1:162820206-162820228 CTGCAGAAAGGGCTACCTGACGG + Intergenic
916401565 1:164454348-164454370 CTGCACATCTGGAAAGCTCAAGG + Intergenic
917106935 1:171501763-171501785 AATCAGAGCTGGCAAGCTGAAGG + Intronic
918374205 1:183892368-183892390 TTGCATAACAGGCAAGCTAAGGG - Intronic
918611362 1:186496116-186496138 GTGAAGAACTGGCAAGGAGAAGG + Intergenic
918910407 1:190560529-190560551 TTGCAGCACTAGCATGCTGATGG + Intergenic
921083640 1:211766155-211766177 CCGAAGAACTGGGGAGCTGATGG - Intronic
922117260 1:222626147-222626169 CTGCAGAGCGTGCAAGCTGCTGG + Intronic
923824757 1:237488347-237488369 CTGCAGATATGGCATCCTGAGGG + Intronic
1062943608 10:1443506-1443528 CTGAAGAACTTGAAAACTGAAGG - Intronic
1065399848 10:25286815-25286837 CTACTGAAATGGCAAGCTGGTGG - Intronic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066291900 10:34022077-34022099 CTACAGAACTGCAAAGCTCAGGG + Intergenic
1066438239 10:35413727-35413749 CTGCAGGGCAGGCAAGCTCAGGG + Intronic
1066725305 10:38385874-38385896 CTGCAGAAAGGGCTACCTGACGG + Intergenic
1070539752 10:77407644-77407666 CTCCAGAACTTCCAAGCTGATGG + Intronic
1071588272 10:86846484-86846506 CTGGAGAAGAGGCACGCTGACGG - Intronic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1073442765 10:103562499-103562521 CTGCAGAACACAGAAGCTGATGG + Intronic
1075801120 10:125153922-125153944 CTGCAGCACAAGCAAGCTCAGGG - Intronic
1076424527 10:130358194-130358216 CTGCAGTACTGGCACCCTGGTGG + Intergenic
1076886832 10:133266902-133266924 CTGGAGCCCTGGCATGCTGAGGG - Intronic
1077034717 11:489069-489091 CTGCAGACATGGCTAGCTCACGG + Intronic
1079609505 11:22414566-22414588 GAGCAGAACTGCCAAGCTGCAGG + Intergenic
1082835883 11:57649841-57649863 CTGCAAAGCTGGCCAGCTGCTGG + Intronic
1083963989 11:66031544-66031566 GAGCACAACTGGCAATCTGATGG - Intergenic
1084760547 11:71268029-71268051 CTGCACAGCTGCCAAGCTGGGGG - Intergenic
1087456243 11:98389948-98389970 CAGCAGTAGTGTCAAGCTGAAGG - Intergenic
1087899648 11:103626347-103626369 CTGCAGACCCGGCAAGGGGAGGG + Intergenic
1087999113 11:104853031-104853053 CAGCAGCTCTGGCAAGTTGATGG + Intergenic
1088036739 11:105326329-105326351 CTGCAGAACAGGGAAGTTGTCGG + Intergenic
1089306268 11:117528273-117528295 CTGCAGAATTTACAAGCGGAGGG + Intronic
1090997002 11:131875891-131875913 CTGCAGCAGTGGCATCCTGAAGG + Intronic
1093502537 12:19828509-19828531 CTGCAGAGCTGGCAAGCTCTGGG - Intergenic
1095180157 12:39138012-39138034 CTGCCCTACTAGCAAGCTGAGGG - Intergenic
1095196093 12:39319240-39319262 ATGCAGAACAGGTAAACTGAGGG + Intronic
1096801584 12:54114063-54114085 CTGCAGCTCTGGGAAGTTGAAGG + Intergenic
1099797796 12:87421012-87421034 CTTCAGAACTGGCAGGTAGAAGG + Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1101743372 12:107519262-107519284 CTGCAAAACTGGAGATCTGAAGG - Intronic
1102885317 12:116517415-116517437 CTGCAGAACTTCAAAGCTGAAGG - Intergenic
1103608699 12:122107689-122107711 CTGCAGAGCTGGCAGGCAGTTGG + Intronic
1104192788 12:126499322-126499344 CTGCAGAGCTGACATGCTGGGGG - Intergenic
1105572825 13:21620230-21620252 CTGCAGAGCTGGCAAGAGGCAGG - Intergenic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106578427 13:30997545-30997567 CTGCCGAAATGGGGAGCTGAGGG + Intergenic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1108503752 13:51091055-51091077 TTGCAGAAATGGCAAGGTGTGGG - Intergenic
1108753743 13:53475414-53475436 CTGCAGAGCTAGGAAGATGACGG - Intergenic
1109228207 13:59722760-59722782 CTGCTGAATTGGGAAGCTGCTGG - Intronic
1110090684 13:71443472-71443494 CTGCTGAACTGAAAAGCTAAGGG - Intronic
1110512902 13:76374033-76374055 CTACAGAACTTGGCAGCTGATGG + Intergenic
1112090087 13:96073908-96073930 CAGCACAACTGACAATCTGAAGG + Intergenic
1113743491 13:112726499-112726521 CTGCAGATCTGGGAATCTGCCGG - Intronic
1113767881 13:112892272-112892294 CTGCAGGACGTGCAAGCAGATGG - Intergenic
1114646710 14:24260114-24260136 CTGCAGAACTGGCCAGAAGTAGG - Intronic
1115496604 14:34011138-34011160 CTTCAGAAATGGCAGGCTGCTGG - Intronic
1117281592 14:54246607-54246629 CTGCAGAATTTGTAAACTGAAGG - Intergenic
1117942031 14:60978205-60978227 CTACAGAACTGGCATACTCATGG + Intronic
1119087324 14:71750346-71750368 CTGCAGAACAGCCAATCAGAGGG - Intergenic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1119753785 14:77099122-77099144 CTGCTGAGCTGGCAGGCTGGTGG + Intronic
1120648072 14:87097386-87097408 CCTCAGAACAGGGAAGCTGATGG + Intergenic
1121592955 14:95133414-95133436 CTGCAGGCCTGCCATGCTGAGGG + Exonic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1124370850 15:29103886-29103908 CTGCGGAGTTGGCGAGCTGATGG - Intronic
1126576591 15:50203274-50203296 CTGCAGAAGTTTAAAGCTGATGG - Intronic
1127690783 15:61394909-61394931 CTGCAGAGCTGGGAAGCCAATGG + Intergenic
1127976630 15:64002126-64002148 CTGCAGAAGAGCCAAGCTCAGGG + Intronic
1129177116 15:73848086-73848108 CTTCAGAAATGGCAGGCTGTGGG + Intergenic
1129325443 15:74798078-74798100 CTCCAGTCCTGGCAGGCTGACGG - Intronic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1131380110 15:91956406-91956428 CTGCAGATCTGCAAAGCTGGAGG - Intronic
1131885895 15:96912377-96912399 CAGCAGATATGGCCAGCTGATGG + Intergenic
1132370586 15:101295163-101295185 CTGCAGGATGGTCAAGCTGACGG - Exonic
1135919918 16:26640669-26640691 CACCAGAACTTGCAAGCTGGTGG + Intergenic
1136586514 16:31189709-31189731 CAGGGAAACTGGCAAGCTGAAGG + Exonic
1137900606 16:52263872-52263894 ATGCAAACCTGGCAAGCAGAAGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1147203840 17:38822729-38822751 CTGGAGATGTGGCAAGCTGATGG + Intronic
1150447629 17:65239560-65239582 CTGCAAAACTTGACAGCTGAGGG + Intergenic
1150478204 17:65489669-65489691 CTGCAGAGCTGGCAAGCAATGGG + Intergenic
1151402371 17:73864250-73864272 CTGCAGAACCGGCCAGCAGCAGG + Intergenic
1154020487 18:10660401-10660423 CTGCAGAACAGGCAGACAGAGGG - Intergenic
1154228167 18:12527603-12527625 CTCCAGAAGTGGGAACCTGAGGG - Intronic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159950979 18:74483321-74483343 CTGCATGTGTGGCAAGCTGAGGG - Intergenic
1167845182 19:52157207-52157229 CTGCAGAAATTTCAAACTGAAGG - Exonic
1167961615 19:53109575-53109597 CTGCAGCAGTTTCAAGCTGAAGG - Exonic
925042885 2:747343-747365 CTGTAGAACTTACAATCTGATGG - Intergenic
928411904 2:31060818-31060840 GTGGAGCACTGGCAAGATGAAGG - Intronic
931188145 2:59973645-59973667 CAGCAGAACTGGCAAGCGGAGGG + Intergenic
932734245 2:74243237-74243259 CTGCAGAACGGGGGAGCAGAAGG - Intronic
933241291 2:79923332-79923354 GTACAGAAATGGCTAGCTGAGGG - Intronic
933728596 2:85440101-85440123 CTGTAGCACAGGGAAGCTGAAGG + Intergenic
934613571 2:95757875-95757897 CAGCTGAAATTGCAAGCTGAGGG + Intergenic
936576230 2:113657901-113657923 CTGCAGGATGGTCAAGCTGACGG + Intergenic
937575796 2:123419857-123419879 CTTCAGAGCTGGCAAAGTGAGGG + Intergenic
940155216 2:150649032-150649054 CTCCAGAACTGGCTTGCTGATGG - Intergenic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
944187674 2:196967388-196967410 CTGCAAAACAGGCACCCTGAGGG - Intronic
944655233 2:201870859-201870881 CTGCAGGGGAGGCAAGCTGATGG - Intronic
946194397 2:218024475-218024497 CTGCAGAGGTGGGGAGCTGATGG + Intergenic
1171382227 20:24742561-24742583 CAGCAGAACTGGGAAGCGGAAGG - Intergenic
1171795115 20:29560403-29560425 CTGCAGCTCTGGGAAGTTGAAGG - Intergenic
1171853339 20:30323862-30323884 CTGCAGCTCTGGGAAGTTGAAGG + Intergenic
1172386429 20:34537162-34537184 CTGCAGTGCTGCCAAGGTGAGGG - Intronic
1173199775 20:40945871-40945893 CTCCAATCCTGGCAAGCTGATGG - Intergenic
1174645152 20:52079326-52079348 CTGCATCACTGGAAAGCTGTGGG - Intronic
1175034242 20:55984661-55984683 CTGGAGACCTGGGAAGCTGGTGG - Intergenic
1175414091 20:58790135-58790157 CAGCTGAACTGGGAAGGTGAAGG + Intergenic
1175660478 20:60808284-60808306 CTGCAGGCCTGGCCAGCTGCTGG + Intergenic
1175985142 20:62760829-62760851 CTTCAGGCCTGGCAAGCTGGGGG + Exonic
1176966969 21:15222229-15222251 CTCCAGCTCTGGCAAGCAGAGGG + Intergenic
1177125108 21:17184563-17184585 GTGCAGAAGTGGTCAGCTGAAGG - Intergenic
1178238092 21:30867392-30867414 CTGCAGACCTCGGAAGCTGAGGG + Intergenic
1178847597 21:36186715-36186737 CTGCACACCTGGGAAGCTGCAGG + Intronic
1179661507 21:42879007-42879029 CTGCAGAACTGGGAAGAAGCGGG - Intronic
1181635664 22:24173227-24173249 CTGCAGAAGTGCCCAGCAGAAGG + Intronic
1184968575 22:47998881-47998903 GTGCAGGACAGGCAGGCTGATGG - Intergenic
950172205 3:10846732-10846754 CTGCAGCACTTGCAAGTTGCCGG - Intronic
950872046 3:16237889-16237911 CTGAATACCTGACAAGCTGAGGG - Intergenic
951815575 3:26750458-26750480 CTGCAGAAATGGGGAGCTGGAGG - Intergenic
953091206 3:39727513-39727535 CGGTACAGCTGGCAAGCTGAAGG - Intergenic
953785094 3:45905582-45905604 CTGAAGAACTGGCAACCAGAGGG - Intronic
953844970 3:46419734-46419756 CCGCACAACTTGCAAGCTGTGGG - Intergenic
953895758 3:46798886-46798908 CTGGAGAACAGGAAAACTGATGG - Intronic
954137385 3:48588281-48588303 CTTCTGCACTGGCAACCTGAGGG - Exonic
954433042 3:50481434-50481456 CGGCTGAACTGCCAAGCTGAAGG - Intronic
956287155 3:67622910-67622932 CTGCAGAACAGGTGAGCTCATGG + Intronic
957195640 3:77063475-77063497 CTGCAAGACAGGGAAGCTGATGG + Intronic
959733539 3:109631338-109631360 ATGAAGAACTGGGAAGCTGTTGG + Intergenic
959925233 3:111913530-111913552 ATGCAGACTTGGCAAGCTGTGGG + Exonic
960964216 3:123093492-123093514 CAGCAGTTCTGCCAAGCTGATGG + Intronic
963403001 3:144825819-144825841 GTGGAGAACTGGAAAGCTGGTGG + Intergenic
965554969 3:170009302-170009324 CTCCAGAAGTGGAGAGCTGAGGG + Intergenic
967075182 3:185995444-185995466 CTGCAGAACTGGGAGACAGAGGG + Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
973547581 4:51996937-51996959 CTCCACAACTGGCATTCTGAGGG - Intronic
973598840 4:52520951-52520973 CTGCAGCTCTGACAAGCTCATGG + Intergenic
973642153 4:52914029-52914051 CTTAACAACTGGCAAGCTGCAGG + Intronic
974487003 4:62518318-62518340 CTGGAGAAGTGAGAAGCTGAAGG + Intergenic
974691530 4:65303622-65303644 CTGGAGCAGTGGCATGCTGATGG + Intergenic
977080081 4:92515039-92515061 ATGCAGAAATACCAAGCTGAGGG + Intronic
985757559 5:1728015-1728037 CTGCAGAACTTTCAAGTTGAAGG - Intergenic
986121089 5:4837517-4837539 CTCCACACCTCGCAAGCTGAGGG - Intergenic
988160910 5:27517571-27517593 CTGCAGGACTTGCCAGCTGAAGG + Intergenic
988291796 5:29296820-29296842 CTACACACCTGGCAAGCTGAGGG + Intergenic
989322022 5:40145872-40145894 TGGCAGAACTAGCAATCTGAAGG + Intergenic
990336141 5:54774627-54774649 GAGCAGAGCTGGCCAGCTGAAGG - Intergenic
991009491 5:61868160-61868182 CTGCAGAACTGGGTCACTGAGGG - Intergenic
991121927 5:63026574-63026596 CTTCAGAACTGGCAACATAATGG + Intergenic
994250555 5:97531976-97531998 GTGCACATTTGGCAAGCTGAAGG - Intergenic
995026728 5:107432135-107432157 CTCCTAAACTGGAAAGCTGAGGG + Intronic
995074554 5:107966821-107966843 CTGCAAAACAGGAAAGCAGATGG - Intronic
996193289 5:120571798-120571820 GAGCAGAACTGCCCAGCTGAGGG - Intronic
998149825 5:139750574-139750596 CTGCAGAAAAGGCAGGGTGAAGG + Intergenic
998867704 5:146521918-146521940 GTGCAGAACTGCAAAGCTGAGGG - Intergenic
1002311992 5:178320487-178320509 CTGCAGAGCTGGGCAGCTGAGGG - Intronic
1003131881 6:3401898-3401920 TTTCAGACCTGGTAAGCTGATGG - Intronic
1006792929 6:36715557-36715579 CTCCAGAGCTGGGAAGCTGGTGG - Exonic
1007078366 6:39082163-39082185 CTGCTGAACTGGCTACCTGTGGG + Intronic
1007778008 6:44234509-44234531 CTGCAAAACTGGCCAGCTCCTGG + Intergenic
1007785527 6:44277233-44277255 CTGCAGGACTGGGGAGCGGAAGG - Exonic
1009931180 6:70179112-70179134 CTTCAGCACAGGCAAGCTGTGGG + Intronic
1010552342 6:77238128-77238150 TTGCTGACCTGGCTAGCTGAAGG - Intergenic
1011660486 6:89590150-89590172 CTGAAGATCTGGGAAGCTGTAGG + Intronic
1011867743 6:91851628-91851650 CTGCAGAACAGACAAGGAGATGG + Intergenic
1018798080 6:167202735-167202757 CTGCAGGACTGGGCAGGTGAGGG + Intergenic
1018814632 6:167321441-167321463 CTGCAGGACTGGGCAGGTGAGGG - Intergenic
1019480290 7:1263580-1263602 CTGCAGTCCTGGCAAGCTCCGGG - Intergenic
1021313643 7:19119156-19119178 CTGCAGATATCTCAAGCTGAAGG + Intergenic
1024584292 7:50827579-50827601 CTGCTAAACTGGGAAGCTGGTGG + Intergenic
1026894817 7:74003824-74003846 CGGCAGAACTGGCAAGCCCTGGG - Intergenic
1030182054 7:106720421-106720443 CTACAGAACTGGGTAGCTGAAGG + Intergenic
1032311937 7:130795775-130795797 CTGAAGAAATGGCCATCTGAGGG - Intergenic
1034407081 7:150911753-150911775 CTGCAGAAGTGGCAGGCTGGGGG + Intergenic
1034735221 7:153422832-153422854 CTGGAGGACTGGCAAGGTGCTGG + Intergenic
1035733256 8:1867629-1867651 CTGCAGATCTGGCCACCTGGAGG - Intronic
1039387308 8:37147448-37147470 CGGCAGGACTGGCAAGCAAATGG - Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1039888386 8:41668541-41668563 CTGCAGGACTGGGATGCAGACGG - Exonic
1041416064 8:57609775-57609797 CTGCAGGCCTGGCATGGTGATGG + Intergenic
1043518572 8:81019684-81019706 CTGCAGGAGTGGCAAGCTGATGG + Intronic
1045894445 8:107197212-107197234 CCTGAGAACTGGGAAGCTGATGG + Intergenic
1047809821 8:128396414-128396436 CAGCAGGACTGGGAAGGTGAAGG + Intergenic
1048600897 8:135917633-135917655 TTGCAGAACTGGCAAGATGGTGG + Intergenic
1049672230 8:143875056-143875078 CTGCAGATTTGGGGAGCTGAGGG - Intronic
1050437009 9:5621594-5621616 TTGCAGAACTGGCAAGTCAAAGG - Intergenic
1050611530 9:7359059-7359081 CTGCAGAACTGGCCTGGAGAGGG + Intergenic
1051438932 9:17062360-17062382 GTGCAGAAGTGTCAAGCTCATGG + Intergenic
1051718324 9:20008816-20008838 CTTCTGAACTGGGAAACTGAAGG - Intergenic
1054179486 9:61898855-61898877 CTGCAGCTCTGGGAAGTTGAAGG + Intergenic
1054473797 9:65558731-65558753 CTGCAGCTCTGGGAAGTTGAAGG - Intergenic
1054658052 9:67681966-67681988 CTGCAGCTCTGGGAAGTTGAAGG - Intergenic
1056825790 9:89875578-89875600 CTGCACAGCTGGCACGCTGGGGG - Intergenic
1057040938 9:91847004-91847026 CTGCAGACATCACAAGCTGAGGG + Intronic
1057752156 9:97802026-97802048 CTGCAGAGTTGGGAAGCTGGGGG - Intergenic
1058700010 9:107592149-107592171 CTTCTCATCTGGCAAGCTGAAGG + Intergenic
1059414269 9:114153825-114153847 CTGGGGAACTGGCAGGCTGCTGG - Intergenic
1060414995 9:123423970-123423992 CTGAAGAGCTGGCAACCTGGAGG + Intronic
1060600969 9:124877159-124877181 CTGCAGAACTGACATTTTGACGG + Exonic
1186237647 X:7530830-7530852 GTGCAGAACTGACATCCTGAAGG - Intergenic
1186820344 X:13281790-13281812 CTGGAGAACTGGCAGGGTCAGGG - Intergenic
1187191145 X:17036574-17036596 CTCCAGAACTGGGAAGCAGCTGG - Intronic
1192410380 X:70928411-70928433 CTGCAGAGCTGGGAAAATGAAGG - Intronic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1198234457 X:134724083-134724105 CTGAAGAACTGTCAAATTGAAGG + Intronic
1199847974 X:151705078-151705100 GTGCTGAACTGCAAAGCTGAAGG - Exonic