ID: 1119174257

View in Genome Browser
Species Human (GRCh38)
Location 14:72557565-72557587
Sequence TGGAATTAGAGGCCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119174257_1119174265 21 Left 1119174257 14:72557565-72557587 CCCACCCCAGGCCTCTAATTCCA 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1119174265 14:72557609-72557631 CTTGAGCACCATCTATTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119174257 Original CRISPR TGGAATTAGAGGCCTGGGGT GGG (reversed) Intronic
900332410 1:2142546-2142568 CGGAATCAGAGGTCTTGGGTGGG + Intronic
900852129 1:5152407-5152429 TTGAATTACAGGGCTGGGGATGG - Intergenic
901013197 1:6212421-6212443 TGGAGTTAGAGTCCTTGGGAGGG - Intronic
901059043 1:6463223-6463245 TAGAGTGAGAGGCCTGGGGAGGG - Intronic
901871743 1:12142522-12142544 TGGAAAGTGAGGCCTGGGCTGGG + Exonic
901987896 1:13090843-13090865 TGGAAGCACAGGCCTGGGGGTGG - Intergenic
901993916 1:13135924-13135946 TGGAAGCACAGGCCTGGGGGTGG + Intergenic
903685402 1:25128063-25128085 TGTAGTTAGAGGCCTTGTGTGGG + Intergenic
904533928 1:31186782-31186804 TGGAAGGAGAGGGCTGGGATGGG + Intronic
905156494 1:35987646-35987668 TGGAATAAGGTGCCTGGGTTGGG + Intronic
905631039 1:39518704-39518726 TGGAAGGAGAGGGCTGGGGATGG + Intronic
905666721 1:39767472-39767494 TGGAAGGAGAGGGCTGGGGATGG - Intronic
906226778 1:44129253-44129275 TGGAAATAGAGGGCTGGATTAGG + Intronic
907341691 1:53739728-53739750 TGGGCTGAGAGGCCTGGGTTTGG - Intergenic
907968233 1:59354716-59354738 TGGGATAAGGGCCCTGGGGTAGG + Intronic
908644111 1:66258566-66258588 TGGAATGAGAGGACTGGAGGAGG + Intronic
909863518 1:80637397-80637419 TGAAACAAGAGGCTTGGGGTTGG - Intergenic
910108384 1:83655688-83655710 TGGGATTACAGGCCTGAGCTAGG + Intergenic
911241539 1:95472640-95472662 TGGAACTAGAGGCCAGGTCTAGG + Intergenic
911880078 1:103225687-103225709 TGGAGATAGAGGCCTGAGGGAGG + Intergenic
913594447 1:120359915-120359937 TGGAAAAGGAGGCCTGGGGCTGG - Intergenic
914305713 1:146414804-146414826 TGGAAAAGGAGGCCTGGGGCTGG - Intergenic
914461757 1:147891512-147891534 TGATCTTCGAGGCCTGGGGTTGG - Intergenic
914596342 1:149158002-149158024 TGGAAAAGGAGGCCTGGGGCTGG + Intergenic
914846179 1:151284615-151284637 TGGAACTCTAGGGCTGGGGTCGG - Intronic
915508929 1:156375367-156375389 TGAAATTAGAGGTCTGAGGCTGG - Intronic
916417156 1:164602677-164602699 GGGACTTTGAGGGCTGGGGTGGG - Intronic
917493303 1:175517094-175517116 TGGATTTAGAGGTGAGGGGTTGG - Intronic
919939916 1:202279032-202279054 GGGAATTGGAGGCCTGGAGCTGG + Intronic
919973144 1:202593632-202593654 TGGAAGCTGAGGCCTGGGGAAGG - Exonic
920029889 1:203030464-203030486 TGGACATGGAGGCCTGGGCTTGG + Intronic
920514676 1:206575933-206575955 TGGACCTAGGGGTCTGGGGTGGG + Intronic
921411060 1:214836675-214836697 TGGAAATAGAGGAAAGGGGTAGG - Intergenic
924200811 1:241656729-241656751 TGGAGTTGGGGGCCTAGGGTGGG + Intronic
1062855041 10:775829-775851 TGGATGTGGAGGCCTGGGTTGGG - Intergenic
1062970402 10:1643802-1643824 TGGAATTAGAGATCTGGGATTGG - Intronic
1064489023 10:15830459-15830481 TGGAATTAGACTACTGTGGTTGG - Intronic
1065291124 10:24230798-24230820 TGGGATTACAGGTGTGGGGTAGG + Intronic
1068811173 10:61257389-61257411 TGGAATGAAGTGCCTGGGGTTGG - Intergenic
1069751388 10:70747464-70747486 TGGAATTAGGGGCCGGGGGAGGG + Intronic
1069992858 10:72325670-72325692 TGAAAGCAGAGGCCTGGGCTTGG + Intergenic
1070356743 10:75647386-75647408 TGGTATTAGAAGCATGGAGTTGG - Intronic
1070932126 10:80268499-80268521 TGGGATGAAAGGCATGGGGTGGG - Intergenic
1071131161 10:82395044-82395066 TGGAAGTAGAGGCCTGAAATGGG + Intronic
1071179062 10:82961816-82961838 TGGAAATAAATGCCTGCGGTGGG - Intronic
1071998903 10:91175071-91175093 TGGAATTAGAGGCTTTGGAGTGG + Intronic
1074534083 10:114316116-114316138 AGGAATTAGAGGCCCCGAGTAGG - Intronic
1075559838 10:123460449-123460471 TGGAACTAGAGGCCTAGTCTGGG + Intergenic
1078007494 11:7543427-7543449 TGGAAATCAAGGCCTGGGGAAGG - Intronic
1078366970 11:10714910-10714932 TGGATGTAGAGGGGTGGGGTGGG + Intergenic
1078761130 11:14252868-14252890 CTGAATTAGAGACTTGGGGTAGG - Intronic
1079345249 11:19646136-19646158 TTGAATGAGAGGCCAGGGCTGGG + Intronic
1079470067 11:20769655-20769677 TGGAGTTAGAGGAATTGGGTTGG + Intronic
1079603566 11:22340802-22340824 TTGAACTAGAGCCCTGGGGCGGG + Intronic
1083256096 11:61496331-61496353 GGGAACTGGAGGCCTGGGGGTGG + Intergenic
1083431160 11:62614202-62614224 TGGAGATAGAGGCCTGGGGGAGG - Intronic
1083972338 11:66086884-66086906 TGGGATTACAGGCGTGGGGCCGG + Intronic
1084215055 11:67642581-67642603 GGGAAATTGAGGCCAGGGGTTGG + Exonic
1084218950 11:67666212-67666234 TGGAATGAGAGGCTCGGGGCGGG + Intronic
1084435619 11:69137625-69137647 TGACATCAGAGGCCTGGGGTGGG + Intergenic
1084524594 11:69687852-69687874 AGGAATTAGAGGACTGGGGACGG - Intergenic
1084756108 11:71239872-71239894 TGGGCTTAGTGGCCTGGGGTGGG - Intronic
1085659612 11:78351780-78351802 TGGAATTAGAGTCCTGGTCCTGG - Intronic
1085788024 11:79472032-79472054 TGGTGCTAGAGGTCTGGGGTGGG - Intergenic
1086924904 11:92629794-92629816 TGGAATGAGAGACATGGGGCAGG - Intronic
1087023809 11:93629864-93629886 AGGAATTGGGGGCATGGGGTGGG - Intergenic
1089567505 11:119379592-119379614 TGGACTTCTAGGCCTGGGATTGG + Intronic
1089990684 11:122856920-122856942 TGGAGGTGGAGGCGTGGGGTGGG - Intronic
1090073176 11:123561571-123561593 AGGAAGTAGAGGGCTGGGGGAGG + Intronic
1091146670 11:133286112-133286134 TGGATTTAGAAGCCAGGGGCTGG - Intronic
1091766160 12:3121059-3121081 TGGAATGAGAAGGTTGGGGTGGG + Intronic
1093221876 12:16431352-16431374 TGGCATAAGAGGCCTAGGTTTGG + Intronic
1094528454 12:31249648-31249670 TGGAATTAGATGACTGTTGTTGG - Intergenic
1095208372 12:39464334-39464356 TGGAATCAGAGGACTTAGGTTGG + Intergenic
1095685030 12:45023850-45023872 TGGAATTAGAGTCCTGTGTCAGG + Exonic
1097509642 12:60521482-60521504 AGGAATTGGAGGCCTGGTTTGGG - Intergenic
1097821892 12:64136105-64136127 TGGAGTTAGTGGGCTGGGGAAGG - Intronic
1101357049 12:103989705-103989727 TTGATTTGGAGACCTGGGGTGGG - Intronic
1102984933 12:117270316-117270338 TGGAATTGGAGGGTCGGGGTGGG + Intronic
1103364146 12:120369733-120369755 CTAAATTAGAGCCCTGGGGTGGG - Intergenic
1105740489 13:23317911-23317933 TGGAGTTAGTGGGCTGGGGAAGG + Intronic
1106207987 13:27617252-27617274 TAGAATTAGAAGACTGGGGCAGG - Intronic
1107603747 13:42039606-42039628 AAGAATTAGAGGGCTGGGGACGG + Intergenic
1108044078 13:46366349-46366371 TGAAACTAGATGCCAGGGGTGGG + Intronic
1110752663 13:79133259-79133281 GGGAATTAGAGGTGAGGGGTGGG + Intergenic
1110993610 13:82075058-82075080 TGGAATTACAGGCCTGAGCAAGG + Intergenic
1112543688 13:100342994-100343016 TGGAATTATAGACCTGAGCTGGG + Intronic
1113409292 13:110070253-110070275 GGGGATTAGAGGGCTGGGGAAGG - Intergenic
1113646296 13:111998882-111998904 TTGAATGAGGTGCCTGGGGTGGG + Intergenic
1114514640 14:23290540-23290562 TGGAATTTGGGGACTGGGGTTGG + Intronic
1114538130 14:23435925-23435947 TGGAATGTGAGGCCTGGCCTGGG - Intergenic
1116970964 14:51065662-51065684 TGGCCATAGAGGCCTGGAGTTGG + Intronic
1117287879 14:54305032-54305054 TGGAATTAGAGGCATTGGTGTGG - Intergenic
1117832139 14:59762216-59762238 TTGAATTACTGGCCTGGGGTTGG + Intronic
1119174257 14:72557565-72557587 TGGAATTAGAGGCCTGGGGTGGG - Intronic
1120695138 14:87636377-87636399 TTGAAATAGAGCACTGGGGTGGG - Intergenic
1120708875 14:87772885-87772907 TAGAACTAGAGCCCTGGGATAGG + Intergenic
1122268370 14:100557164-100557186 TGGGATTGGGGGCCTGGGTTTGG - Intronic
1123113876 14:105885138-105885160 TGGAGTTTGAGCCCTGGGGCAGG + Intergenic
1123403061 15:20005063-20005085 TGGATTTTTAGTCCTGGGGTAGG + Intergenic
1123512400 15:21011717-21011739 TGGATTTTTAGTCCTGGGGTAGG + Intergenic
1126825480 15:52543757-52543779 TGGGATTACAGGCATGAGGTGGG + Intergenic
1127057948 15:55151657-55151679 TGGAAATTGAGGTGTGGGGTGGG + Intergenic
1128100870 15:64998815-64998837 TGGAATCACTGGACTGGGGTGGG + Intergenic
1128462246 15:67879458-67879480 TCTAATGAGAGGTCTGGGGTGGG + Intergenic
1131271195 15:90948566-90948588 TGGAATTGGGGGCCTGGGCCTGG + Intronic
1132887207 16:2187521-2187543 TGGAAATGGAGGCCTGGCTTGGG - Intronic
1134386380 16:13777335-13777357 TGGAATTACAGGCATAGGCTTGG - Intergenic
1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG + Intronic
1135192908 16:20369294-20369316 AGGAATTAAAGGCTTGGGATAGG + Intronic
1135351474 16:21733044-21733066 GGGAACTAGAAGTCTGGGGTGGG - Intronic
1135449956 16:22549172-22549194 GGGAACTAGAAGTCTGGGGTGGG - Intergenic
1136368759 16:29822608-29822630 TGGAGCAAGAGCCCTGGGGTTGG + Intronic
1136775176 16:32867970-32867992 GGGAACTAAAGGCCTGGGCTGGG + Intergenic
1136895441 16:33993542-33993564 GGGAACTAAAGGCCTGGGCTGGG - Intergenic
1138456901 16:57126305-57126327 GGGAATGGGAGGCCTGGGGTGGG + Intronic
1139655762 16:68386559-68386581 TGGAACCAGAGGGGTGGGGTGGG - Intronic
1139727096 16:68909546-68909568 TGGATTCAGTGGCCTGGTGTGGG - Intronic
1139838673 16:69860730-69860752 TGGGATTAGAGGCATGAGCTGGG - Intronic
1140922481 16:79551915-79551937 TGGCATTAGAGGACTGGGCCTGG + Intergenic
1141039519 16:80660976-80660998 AGGAAGTGGAGGGCTGGGGTTGG + Intronic
1203077594 16_KI270728v1_random:1130079-1130101 GGGAACTAAAGGCCTGGGCTGGG + Intergenic
1142521422 17:507552-507574 TGGAATTAGAGCATCGGGGTTGG - Intergenic
1142763105 17:2052577-2052599 TGGGGTTAGGGGCCTGGGCTGGG + Intergenic
1142763192 17:2052857-2052879 TGGGGTTAGGGGCCTGGGCTGGG + Intergenic
1142763213 17:2052927-2052949 TGGGGTTAGGGGCCTGGGCTGGG + Intergenic
1142763234 17:2052997-2053019 TGGGGTTAGGGGCCTGGGCTGGG + Intergenic
1143196316 17:5078723-5078745 TGGAAATGAAGGCCTGGGGGCGG - Intronic
1144240894 17:13310412-13310434 TGCAACTAGAGGCATGGGGAAGG + Intergenic
1145917755 17:28586051-28586073 TGGAGGTGGAGGCCTGTGGTGGG - Intronic
1147109549 17:38251853-38251875 TGTTAGTAGAGGCCAGGGGTTGG + Intergenic
1147909477 17:43847004-43847026 TGGAAGGTGAGCCCTGGGGTAGG + Intergenic
1148241981 17:46005534-46005556 AGGAATTTGAGACCTGGGCTGGG + Intronic
1148419904 17:47536216-47536238 TGTTAGTAGAGGCCAGGGGTTGG - Intronic
1149458281 17:56807223-56807245 TGGAATGAGAAGCCTGGGCGAGG + Intronic
1149856615 17:60088362-60088384 TGGAATGCAAGGCCAGGGGTGGG + Intergenic
1150628447 17:66858762-66858784 CAGAATAAGAGGCCTGGGGAGGG - Intronic
1151056054 17:71032687-71032709 TGGAATTAAAGGTCTGGCCTGGG - Intergenic
1151729699 17:75904051-75904073 TGAAATTAAAGGCCTGGGCAGGG - Intronic
1152067829 17:78121283-78121305 TTGAACTTGAGGCCTGGGGAGGG - Intronic
1152272389 17:79332250-79332272 TGGAATTTGAGCCCTGGGAGGGG + Intronic
1152787642 17:82257936-82257958 TGGAATTATAGGCCTGAGCCTGG - Intronic
1155506123 18:26535087-26535109 TGGAGGGAAAGGCCTGGGGTTGG + Intronic
1157100661 18:44725928-44725950 TGGTAATAGTGGCCAGGGGTGGG + Intronic
1157968544 18:52238343-52238365 TGGAATTACAGGCACGAGGTGGG - Intergenic
1158246400 18:55437673-55437695 TGTGTTTAGAGGCCTGGGCTGGG - Intronic
1158966332 18:62625300-62625322 TGGAAACAGAGTCCTAGGGTTGG - Intergenic
1159954858 18:74512070-74512092 TGGAGCTGGAGACCTGGGGTCGG - Intronic
1160369868 18:78363173-78363195 TCGTATGAGAGACCTGGGGTAGG + Intergenic
1160443529 18:78911409-78911431 GGGAGTTGGAGGCCTGGGGCTGG - Intergenic
1160443536 18:78911429-78911451 GGGATCTGGAGGCCTGGGGTGGG - Intergenic
1160443544 18:78911449-78911471 TGGAGCTGGAGGCCTGGGGTGGG - Intergenic
1160443567 18:78911511-78911533 GGGAACTGGAGGCCTGGGGTGGG - Intergenic
1160443620 18:78911655-78911677 TGGAGCTAGAGGCCTGGGGCAGG - Intergenic
1161900996 19:7118966-7118988 GGGAACTGGAGACCTGGGGTTGG - Intronic
1162060189 19:8090140-8090162 TGCAGTAAGAGGCCTGGGGAGGG - Exonic
1163196645 19:15726433-15726455 TGGGATTGGAGGATTGGGGTTGG + Intergenic
1163345979 19:16742518-16742540 TGGAAACAGGGGCCTGGGGATGG - Intronic
1163767362 19:19170985-19171007 TGGATTTAGAGTTCTGGGCTGGG - Intronic
1164917609 19:32064675-32064697 TGGAATTGGAAGCCTCTGGTTGG + Intergenic
1165289274 19:34870115-34870137 TGCAATTAGATGCCTGGGTAGGG + Intergenic
1166684854 19:44790152-44790174 TTGGCTCAGAGGCCTGGGGTTGG + Intronic
1167307669 19:48718743-48718765 GGGGATTGGAGGCCAGGGGTAGG - Intronic
1167658980 19:50784776-50784798 TGGAGGTAGAGGCAGGGGGTGGG + Intergenic
925603137 2:5629269-5629291 TGGAAAAGGAGGCCTGGGGCTGG - Intergenic
925811181 2:7702437-7702459 TGGAATTCTAGGCCAGGAGTTGG + Intergenic
926420654 2:12693474-12693496 TGGTTTCAGAGGCATGGGGTGGG + Intergenic
927854762 2:26521093-26521115 CTGAATCAGAGCCCTGGGGTCGG - Intronic
929387286 2:41424481-41424503 TGGAATCAGTGGCCTGATGTCGG + Intergenic
930385763 2:50693070-50693092 TGGGTTTAGGGGACTGGGGTAGG - Intronic
931482615 2:62657158-62657180 TGGAACTAAAGTCCTGGGCTGGG - Intergenic
932101219 2:68900873-68900895 TGGGAGCAAAGGCCTGGGGTAGG - Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932890060 2:75586848-75586870 TGGAATTAGTGGCCTTGAGTTGG + Intergenic
935206802 2:100903225-100903247 TGGAAGCACAGGCTTGGGGTAGG + Intronic
936479914 2:112876737-112876759 TGGCCCTGGAGGCCTGGGGTGGG - Intergenic
936501570 2:113070758-113070780 TGGTTTTTCAGGCCTGGGGTGGG - Intronic
937046498 2:118854822-118854844 TGGAGTTGGAAGCCTGGGGTAGG - Intergenic
937419558 2:121742317-121742339 TGGAAGTTGAGGCCTGCAGTAGG - Intronic
939603641 2:144225251-144225273 TGATACCAGAGGCCTGGGGTGGG - Intronic
939859438 2:147400075-147400097 TAGAATTAGAAGCATGGGCTGGG - Intergenic
940071123 2:149689325-149689347 TGGAATAAGAGGCCATGAGTGGG - Intergenic
942426348 2:175864484-175864506 TCTAATTAGAAGCCTGGAGTTGG - Intergenic
944935281 2:204561234-204561256 TGGGATTAGAGGGCAGGTGTGGG + Intronic
946164223 2:217854073-217854095 TCCACTCAGAGGCCTGGGGTGGG + Intronic
946239137 2:218343346-218343368 AGGGAATAGATGCCTGGGGTGGG + Intronic
946416317 2:219541773-219541795 TGGCAGTAGCGGCCGGGGGTGGG + Exonic
946769131 2:223070251-223070273 GGGAATTTGAGGCCTGTGGAAGG + Intronic
947052558 2:226062697-226062719 TGGAAAGAGAGGGCTGGAGTTGG - Intergenic
947669440 2:231926957-231926979 TGGGGTTGGAGGACTGGGGTGGG + Intergenic
948850814 2:240704456-240704478 GTGAGTTAGAGGGCTGGGGTTGG - Intergenic
1169072793 20:2743364-2743386 TGGAATTAGAGGACTTCCGTTGG - Intronic
1172101313 20:32484944-32484966 TGGATTTGGAGGGGTGGGGTGGG - Intronic
1174595403 20:51679542-51679564 GGGGATCAGAGGCCTGGGGGTGG - Intronic
1175832907 20:61976764-61976786 TGCACTGGGAGGCCTGGGGTTGG + Intronic
1175965531 20:62658351-62658373 AGGAATTAGGGGCCCAGGGTGGG - Intronic
1176173333 20:63706309-63706331 TGGCACTGGAGGGCTGGGGTGGG + Intronic
1176183483 20:63765135-63765157 GGGGCTTAGAGGCTTGGGGTGGG + Intronic
1176219227 20:63962141-63962163 GGGCATGTGAGGCCTGGGGTGGG + Intronic
1177787311 21:25685135-25685157 TTGAAGTAAAGGCCTGGAGTGGG + Intronic
1178117776 21:29435280-29435302 TGGACTTAGAAGGCTGGGTTGGG + Intronic
1178920384 21:36734857-36734879 AGGAACAGGAGGCCTGGGGTTGG - Intronic
1179180158 21:39037938-39037960 TGGGAATAGCGGCCTGGGGCAGG - Intergenic
1180219900 21:46352023-46352045 CGGAATGGGGGGCCTGGGGTCGG - Intronic
1180225005 21:46387002-46387024 AGGACTCAGAGGCCTGGGGCGGG - Intronic
1180970343 22:19811823-19811845 TGAAGTTGGAGGCCTGGGGAGGG - Intronic
1181283648 22:21736610-21736632 TGACATTAGAGGCGTGGGGGTGG - Intergenic
1181402701 22:22661024-22661046 TGGACCCAGAGGCCTGGGGCTGG - Intergenic
1182356448 22:29724300-29724322 TGGGACCAGAGGCCTGGGCTTGG - Intronic
1183439475 22:37815292-37815314 TGGCACCTGAGGCCTGGGGTGGG + Intronic
1183898185 22:40985714-40985736 TGGGATTAGGGGCCAGTGGTGGG - Intergenic
1183942306 22:41302443-41302465 TGGACTTCGAGGCCTGTGGGAGG + Intronic
1184549746 22:45198146-45198168 TGGAGTTGGAGGCCTGGGTCTGG - Intronic
1185103982 22:48857037-48857059 TGGACTTAGAGGCTTAGGGTAGG + Intergenic
949748366 3:7322566-7322588 TGGACTTTGGGGACTGGGGTGGG - Intronic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
951598302 3:24342405-24342427 TGATATTGGAGCCCTGGGGTGGG + Intronic
952070614 3:29630673-29630695 TGGATTCAAAGGCCTGGGATGGG - Intronic
952386140 3:32843004-32843026 TGTAATTGGAGGGCGGGGGTGGG + Intronic
953106269 3:39883155-39883177 AGGAATTAGAGGCCTGGCAAGGG + Intronic
953662994 3:44904530-44904552 GGGAAGCAGAGGCATGGGGTTGG + Intronic
954148314 3:48645262-48645284 GGGAAGCAGATGCCTGGGGTAGG - Intronic
954349071 3:50027179-50027201 TTCACTTAGAGGCTTGGGGTAGG + Intronic
955109805 3:55937212-55937234 TGGGATTAGAGGCCTGAGCCTGG - Intronic
956055383 3:65293155-65293177 TGGAATGTGTGGCTTGGGGTGGG - Intergenic
959141730 3:102494026-102494048 TGCAGTTAGTGGCCTGGAGTAGG - Intergenic
961581069 3:127882732-127882754 AGGAAACAGAGGCCTGTGGTGGG - Intergenic
961828871 3:129613062-129613084 TGGGAATGGAGGCCTGGAGTGGG - Intergenic
962045606 3:131756708-131756730 TTGAGTTGGAGGCCCGGGGTTGG + Intronic
962474162 3:135741087-135741109 AGGAATTAGAGGGCTGGATTGGG + Intergenic
963148109 3:142015672-142015694 TGGAAATAGAGTTGTGGGGTAGG - Intronic
966301808 3:178487332-178487354 TGCAATTAGAGGACTGAGATGGG - Intronic
966891660 3:184411673-184411695 TGGCATAAGAGACCTGGCGTGGG + Intronic
968653200 4:1767948-1767970 TGGAAGCCGGGGCCTGGGGTGGG - Intergenic
969082091 4:4626804-4626826 TGGAATTAGAGACCTGGGTTAGG + Intergenic
970583718 4:17495449-17495471 TGGACTTCGAGGCCAGGGGTTGG + Intronic
971188063 4:24400247-24400269 TGGAGTCAGAGGGCTGGGGAAGG + Intergenic
976503806 4:85823353-85823375 TGAAATTAGAGGACTGTGTTAGG - Intronic
976545867 4:86335124-86335146 TGAAATTAGAGGCGCAGGGTTGG - Intronic
980516800 4:133874527-133874549 TGGAATTAAAGGCATGTGGTTGG - Intergenic
981765956 4:148250496-148250518 TGAAATTAAAAGCCTGGGGAAGG - Intronic
982366429 4:154584526-154584548 TTGAATTAGAGGACTGGGCTGGG - Exonic
986211259 5:5675079-5675101 TGGAATATGAGGCCAGGGATGGG + Intergenic
987745272 5:21962993-21963015 AGGAAAAAGAGGCATGGGGTAGG - Intronic
987895718 5:23943322-23943344 TGGAATTTGGGGCCTGGGATGGG + Intergenic
987980168 5:25073782-25073804 TGGGATTAGAGGCGTGCGCTAGG + Intergenic
988397898 5:30719349-30719371 TGGGATTAGAGGCCTGTGCCAGG + Intergenic
989776137 5:45208800-45208822 TGGATTTAGAGGCCTCAGGTAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991194403 5:63915778-63915800 TGGAACAAGAGGCCTGCGATTGG - Intergenic
991194718 5:63919590-63919612 AGGAATTAGAGACCTTGGCTGGG - Intergenic
991765474 5:69973112-69973134 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991781848 5:70145045-70145067 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
991844710 5:70848184-70848206 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991874291 5:71145356-71145378 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
992951495 5:81862451-81862473 TGGAAGTAGAGGGCTGTGATGGG - Intergenic
994379721 5:99056900-99056922 TGGAGTGAGAGACGTGGGGTTGG + Intergenic
995792585 5:115906652-115906674 TGGAGGTAGAGGGGTGGGGTTGG + Intronic
996548577 5:124706987-124707009 TGTAATCAGAGGGCTGGGTTGGG + Intronic
997354780 5:133255234-133255256 TGGAAAGAGAGGGCTGGGTTGGG + Intronic
999317042 5:150590978-150591000 TGGAATTAGAGGTAGGGGCTGGG - Intergenic
1000183754 5:158838997-158839019 TGTTAATAGAGGTCTGGGGTGGG - Intronic
1001050906 5:168413658-168413680 TGGGGTCAGAGGCCTGGAGTTGG - Intronic
1001110584 5:168892992-168893014 TGGAATCAGACGCCTGTGGTTGG - Intronic
1001623572 5:173110256-173110278 TGGAACTAGAAGCCTAGGGTAGG + Intronic
1002423648 5:179163569-179163591 TGGAATAAGAGCCCTGCAGTGGG + Intronic
1002493970 5:179599453-179599475 GGGAAGTGGAGGGCTGGGGTCGG - Intronic
1003258747 6:4496875-4496897 ACGAATAAAAGGCCTGGGGTGGG + Intergenic
1003704983 6:8515908-8515930 TGGGAATAGATGCCTAGGGTTGG + Intergenic
1005822675 6:29610655-29610677 GGGGATTAGAGGCAGGGGGTGGG - Intronic
1006166542 6:32068721-32068743 TGGAAAGAGAGGACTGAGGTGGG + Intronic
1006385277 6:33727249-33727271 CGGAATCACAAGCCTGGGGTTGG + Intronic
1006473637 6:34241892-34241914 TGGAATTCAGAGCCTGGGGTGGG + Intronic
1006623281 6:35382219-35382241 GGCAATTAGAGGCCTGTGGCAGG + Intronic
1007107851 6:39295690-39295712 TGGAATGGGAGGCCTGGGGATGG + Intergenic
1007237782 6:40403415-40403437 AGGGACCAGAGGCCTGGGGTTGG + Intronic
1008102978 6:47412629-47412651 AGGAGTTTGAGGCATGGGGTGGG + Intergenic
1011206361 6:84903594-84903616 TGGAATCAGTGGGCTGGGGAAGG - Intergenic
1011649511 6:89492945-89492967 TGGAATTTGGGGCATGGGGAAGG - Intronic
1011794119 6:90933999-90934021 TGGAAATAGAAGCCTGGGGCTGG + Intergenic
1013248977 6:108315505-108315527 TTGATTCAGAGGGCTGGGGTAGG + Intronic
1016898819 6:149080397-149080419 TGGAATAAGAGGCCTGTGACAGG - Intergenic
1017283806 6:152651694-152651716 TGATATTAGAGGCCGGGGCTGGG + Intergenic
1019329626 7:456023-456045 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019329681 7:456166-456188 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019329737 7:456309-456331 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019329790 7:456451-456473 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019329846 7:456594-456616 TGGAGTGGGAGGCCTGGGGTGGG - Intergenic
1019329874 7:456665-456687 TGGAGTGGGAGGCCTGGGGTGGG - Intergenic
1019329902 7:456736-456758 TGGAGTGGGAGGCCTGGGGTGGG - Intergenic
1019329929 7:456807-456829 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019329956 7:456878-456900 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019330023 7:457050-457072 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019330109 7:457251-457273 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019330309 7:457726-457748 TGGAGTGGGAGGTCTGGGGTGGG - Intergenic
1019343100 7:517647-517669 TGGAACCAGAAGCCGGGGGTGGG + Intronic
1021168353 7:17368215-17368237 TGAGGTTGGAGGCCTGGGGTTGG - Intergenic
1023757230 7:43431277-43431299 TGGAAATAGAGGCCTGGGCATGG - Intronic
1026211535 7:68310254-68310276 TGGAAATGGAGGCTTGGGATTGG - Intergenic
1027228697 7:76260368-76260390 AGGAGCTTGAGGCCTGGGGTGGG - Intronic
1028108254 7:86906052-86906074 TTGAGTTAGAGGCCTGGAGGAGG + Intronic
1028573356 7:92317293-92317315 TTGATTCAGAGGCCTGGGCTTGG + Intronic
1030258987 7:107543430-107543452 TGGAAGTACTGGCCTGGAGTCGG - Intronic
1031924579 7:127627184-127627206 TGGCATGACAGGCCTGGGATAGG - Intergenic
1034842616 7:154413167-154413189 AGGAATTGGATGACTGGGGTGGG - Intronic
1035355119 7:158271908-158271930 AGGAACTGGAGGCGTGGGGTAGG + Intronic
1035457655 7:159019033-159019055 TGTATTCAGGGGCCTGGGGTTGG + Intergenic
1035626612 8:1075795-1075817 TGGGATTACAGGCCTGAGTTGGG - Intergenic
1035906300 8:3513458-3513480 TGGGATTACAGGCCTGTTGTGGG + Intronic
1038985098 8:32800570-32800592 GGCAGTTAGAGGGCTGGGGTAGG + Intergenic
1039403948 8:37297026-37297048 TCCATTTAGTGGCCTGGGGTAGG - Intergenic
1039561616 8:38516937-38516959 TGGCATTGGAGGGCAGGGGTGGG - Intronic
1047490878 8:125373714-125373736 GGAAATCTGAGGCCTGGGGTAGG - Intergenic
1047502851 8:125455260-125455282 CGGATTTACAGGCCTGGAGTTGG - Intergenic
1051418576 9:16869909-16869931 TGGGATTTGGGGCCTGGGGAGGG - Intronic
1053267279 9:36724445-36724467 TGTAATAAGAGCCCTGGGTTGGG + Intergenic
1053286404 9:36852199-36852221 TGGGATCAGAGGGCTTGGGTGGG - Intronic
1053474927 9:38375822-38375844 TGGGAGCAAAGGCCTGGGGTAGG - Intergenic
1056114752 9:83431014-83431036 TGGTATTAGAGCCCTGTGATAGG + Intronic
1056440865 9:86619792-86619814 GAGAAGAAGAGGCCTGGGGTAGG + Intergenic
1059434369 9:114267321-114267343 TGGAACTAGGGGGCTGGGGGTGG - Intronic
1060140954 9:121209417-121209439 TGGAATTAGCAGCGGGGGGTGGG + Intronic
1060537197 9:124399848-124399870 TGGCGTGAGAGGCCTGGGGCAGG - Intronic
1060940045 9:127537979-127538001 TGGAGACAGAGGCCTGGGATGGG - Intronic
1061520839 9:131116975-131116997 TGGCAGGAGAGGGCTGGGGTAGG - Intronic
1061673074 9:132200188-132200210 TGGAGTGAGAGGGCTGGGGCGGG + Intronic
1062650657 9:137575193-137575215 TGGCCCTGGAGGCCTGGGGTGGG - Intronic
1185736021 X:2497104-2497126 AGGAATTGGAGGCCGGGGGCAGG + Intronic
1185774971 X:2794655-2794677 TGGGATGAGAGGCCTGAAGTTGG + Intronic
1186136067 X:6522464-6522486 GGGAATTAGGGGTTTGGGGTGGG + Intergenic
1187055565 X:15738551-15738573 TGGAGGAAGAGGGCTGGGGTGGG - Intronic
1189034946 X:37486236-37486258 TGGTAGTGGAGGCCAGGGGTGGG + Intronic
1189220864 X:39370492-39370514 TGGAATCATAGACCTGGTGTAGG + Intergenic
1189846813 X:45145960-45145982 CGGAAGTAGAGGCTTGGGGTGGG + Intergenic
1190128251 X:47724445-47724467 TGTAATTAGAGGCATGGTATGGG + Intergenic
1195021457 X:100832835-100832857 TGCCATTAGAGGTCTGGGCTCGG - Exonic
1198797359 X:140411087-140411109 ATGAATGAGAGCCCTGGGGTGGG - Intergenic
1199156057 X:144550628-144550650 AGGAGTCAGTGGCCTGGGGTTGG + Intergenic
1199329997 X:146548327-146548349 TGAAATGAGAGTCCTGGAGTGGG + Intergenic
1201295383 Y:12458741-12458763 TGGGATGAGAGGCCTGAGATTGG - Intergenic
1202604284 Y:26625807-26625829 TGACATTAGCTGCCTGGGGTTGG - Intergenic