ID: 1119174880

View in Genome Browser
Species Human (GRCh38)
Location 14:72561747-72561769
Sequence GGGTCATCAAACTCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119174872_1119174880 21 Left 1119174872 14:72561703-72561725 CCACATGGGTTATAGTTGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1119174880 14:72561747-72561769 GGGTCATCAAACTCTGCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119174880 Original CRISPR GGGTCATCAAACTCTGCCTC TGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
903280544 1:22247596-22247618 GGGTCAGCAGACTCGGGCTCAGG - Intergenic
905901376 1:41583971-41583993 GGCTCCTCAAACTCTTCCCCAGG + Exonic
910053818 1:83007949-83007971 TGGTCATCATACTCTGTCGCTGG - Intergenic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
915868144 1:159528041-159528063 GGGTCATTTGACTATGCCTCTGG + Intergenic
919044918 1:192439210-192439232 GGGGCAGCAAAATCTGCATCTGG + Intergenic
920353497 1:205353143-205353165 GGGTCAGCAAGCTATGCCTGAGG + Intronic
923361356 1:233214517-233214539 GGGAAATCGAGCTCTGCCTCTGG + Intronic
1063616778 10:7607186-7607208 GTGTCAGCAAACTGTGGCTCAGG + Intronic
1068080997 10:52316577-52316599 CGGTCATCAGACTGTGCCTCAGG + Exonic
1070732819 10:78843018-78843040 GAATCAGCAAACTCTGCCTGAGG + Intergenic
1073547961 10:104368716-104368738 AAGTCATCAAACTCTGCTTCTGG - Intronic
1077342578 11:2032635-2032657 GGGACCCCAAACTCTGGCTCTGG + Intergenic
1082070659 11:47937079-47937101 GGCTCTGCAACCTCTGCCTCCGG + Intergenic
1083167164 11:60897704-60897726 TAGTCATAAAGCTCTGCCTCAGG + Intronic
1090971361 11:131646129-131646151 GGGTCAGCAAACTGTGCCCATGG + Intronic
1091073177 11:132588214-132588236 GGGACATCAAAAGCTGCCCCAGG - Intronic
1202825564 11_KI270721v1_random:87824-87846 GGGACCCCAAACTCTGGCTCTGG + Intergenic
1094185909 12:27642556-27642578 GTTTCATCATATTCTGCCTCAGG - Intronic
1098299819 12:69042959-69042981 GGGCCCTCTGACTCTGCCTCTGG - Intergenic
1102734376 12:115145285-115145307 GGGTCCTCAGCCTCTGCCTCTGG - Intergenic
1103861718 12:124020587-124020609 GGGTCAGCAAACTATGGCCCTGG + Intronic
1105688781 13:22814649-22814671 GGGTAATGACACTCTGCCCCCGG - Intergenic
1106609537 13:31265268-31265290 GAGTAATCAATCTCTGACTCTGG + Intronic
1108757834 13:53525506-53525528 GGGTCATCACACTCTGACAGAGG + Intergenic
1112423109 13:99271679-99271701 AGGTTATCAAATTCTCCCTCAGG + Intronic
1112687802 13:101851612-101851634 GGGACTTCAACCTATGCCTCTGG + Intronic
1114742771 14:25115138-25115160 AAGTCATCATTCTCTGCCTCTGG - Intergenic
1115988032 14:39122608-39122630 GGGTCAGCAAACTCTACCCTGGG + Intronic
1116065078 14:39972043-39972065 GGATCATCTTACTCTGCCTATGG + Intergenic
1118577749 14:67260453-67260475 GAGTTAACAAACTTTGCCTCGGG + Intronic
1119174880 14:72561747-72561769 GGGTCATCAAACTCTGCCTCTGG + Intronic
1120386144 14:83848278-83848300 GGGTCATAAAAGTCTGGCGCTGG + Intergenic
1120711757 14:87799770-87799792 GGGCCATCTATATCTGCCTCAGG + Intergenic
1121208424 14:92188301-92188323 GGGGAATCAGACTTTGCCTCAGG - Intergenic
1122236135 14:100331593-100331615 GGCTCATCAAACACTGACCCCGG + Intergenic
1122953663 14:105060125-105060147 GGGTCTTCAGACTCTCCCTCGGG + Intronic
1128483485 15:68060755-68060777 GGATCCACAATCTCTGCCTCCGG + Intronic
1129116360 15:73367575-73367597 GGGTCAACAAATTCTCCCTAAGG - Exonic
1130031829 15:80321862-80321884 GGGTTCTCAAACTCAGCCTTTGG - Intergenic
1130437208 15:83913204-83913226 GGGCCTTCACACTCTTCCTCGGG - Exonic
1131367103 15:91850939-91850961 GAATCATCAAAGTCAGCCTCAGG - Intergenic
1132407092 15:101549814-101549836 GGGACATGAAGATCTGCCTCTGG - Intergenic
1132498068 16:273195-273217 GGGACTGCAGACTCTGCCTCGGG - Intronic
1133001306 16:2852972-2852994 GGCTCATCTACCTCTACCTCTGG - Exonic
1134088124 16:11372515-11372537 GGGACATGAAACTCTCCCACTGG - Exonic
1134671970 16:16062568-16062590 AGCTCAACAAACTCTGTCTCTGG - Intronic
1134807170 16:17135942-17135964 GGGTCAGCAAACTCTAGCCCTGG - Intronic
1135059839 16:19262056-19262078 GGGTCTTCAAAATCACCCTCAGG + Intronic
1137879382 16:52030972-52030994 GAGCCACCACACTCTGCCTCAGG + Intronic
1139842376 16:69891903-69891925 CAGTCATCAAGCCCTGCCTCTGG + Intronic
1140687551 16:77448151-77448173 GGCTCTTCAAACTCTGTCACAGG + Intergenic
1142504883 17:356995-357017 GGGGCATCTAACTCTGTCCCAGG + Intronic
1144120211 17:12145198-12145220 GGCTCTGCAACCTCTGCCTCCGG + Intergenic
1144611385 17:16720535-16720557 GAGTCAGCAAAGTCAGCCTCAGG - Exonic
1144901352 17:18594822-18594844 GAGTCAGCAAAGTCAGCCTCAGG + Intergenic
1145131148 17:20351275-20351297 GAGTCAGCAAAGTCAGCCTCAGG - Intergenic
1145925537 17:28644456-28644478 GGGTCTTCTCTCTCTGCCTCTGG - Intronic
1147781372 17:42945060-42945082 GGCTCAGCAACCTCTGACTCCGG + Intergenic
1147923933 17:43935315-43935337 GGGTGATGTAACTCAGCCTCTGG - Intergenic
1149150337 17:53554513-53554535 GGGTTATCAAAGTCTACCTGGGG + Intergenic
1155956908 18:31962047-31962069 GAGTCATCACACTCGGCCTAGGG + Intergenic
1160229787 18:77038931-77038953 GCGTCTTCAAACTATGCCTCGGG + Intronic
1160892398 19:1386172-1386194 GGGGCATCAAACCCTGGCCCTGG + Intronic
1162332402 19:10038411-10038433 GGGTCTTCTGACTCTGCCTTTGG - Intergenic
1164487683 19:28674412-28674434 GGGTCAGCAAACTCTGGCACAGG + Intergenic
1164505446 19:28856888-28856910 GGGTGACCTAACTTTGCCTCTGG - Intergenic
926490724 2:13523066-13523088 GGTTCTTCCACCTCTGCCTCAGG - Intergenic
928718703 2:34094412-34094434 GGGTCATCAAATTCTGTGGCTGG - Intergenic
929147544 2:38719831-38719853 GCAGCATCAAACTCAGCCTCGGG - Intronic
930176533 2:48306675-48306697 GGGTCAGCAAACTATGGCCCTGG - Intergenic
931220835 2:60286437-60286459 GGCTCCTCACACTCTGCCTTTGG + Intergenic
934720397 2:96571154-96571176 GGGTTATCAGATTCTGGCTCTGG + Intergenic
935131255 2:100262813-100262835 GGGACGTCCAACTCTGCCTAGGG + Intergenic
943228665 2:185215286-185215308 GGGTGATTGAACTCTGCCTCTGG - Intergenic
945369481 2:208999420-208999442 TGGTGTTCAAACCCTGCCTCTGG - Intergenic
948603105 2:239118562-239118584 GGGCCACCAAACTGTGCATCAGG - Intronic
948651143 2:239444708-239444730 GAGTCATCGCAGTCTGCCTCTGG - Intergenic
1173933691 20:46843245-46843267 GGGTCAGCAAACTTTTCCTGTGG + Intergenic
1175146840 20:56903401-56903423 GGGTCGACAAACTCTACCTCTGG - Intergenic
1178554793 21:33580121-33580143 GATTCTTCAACCTCTGCCTCTGG - Intronic
1179766070 21:43574045-43574067 TGGTCATGAAAGGCTGCCTCGGG - Intronic
1181757807 22:25037500-25037522 GGGTTAGCAAACTGTGCCCCTGG + Intronic
1182443141 22:30375719-30375741 AGGTCTTCAGACTCTGCCCCGGG + Intronic
1184016370 22:41788813-41788835 GTGACATTCAACTCTGCCTCTGG + Intronic
1184352185 22:43951774-43951796 GGGTCCTCAGTCTCTGACTCTGG + Intronic
951577308 3:24126974-24126996 GGGACATCAAACACTGGTTCAGG - Intronic
954754082 3:52829615-52829637 GGGGCATCACACTCAGCCTTTGG + Intronic
960943285 3:122948352-122948374 GGGTCCTGAGACTCTTCCTCTGG - Intronic
967381635 3:188865639-188865661 GGGTCAACAAACTATGCCCATGG + Intronic
969406157 4:6993589-6993611 GGGCCCTCAAACGCTGCCTCAGG - Intronic
969505470 4:7584310-7584332 GGGTCAAGAAACTGGGCCTCTGG - Intronic
969650576 4:8465444-8465466 GAGTCTTCTTACTCTGCCTCCGG - Exonic
972328854 4:38044882-38044904 GGGTCAGCAAACTATGCCCATGG + Intronic
976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG + Intergenic
976495944 4:85729872-85729894 GGGTCAGCAAACTATGCCCACGG - Intronic
980959168 4:139457680-139457702 GGGTCAGCAAACTATGCTTGAGG + Intronic
983373297 4:166892903-166892925 GGGTCAGCAAACACTGCGACAGG + Intronic
985061690 4:186086402-186086424 GGGTCATGGAACTCAGCCTTGGG - Exonic
985181950 4:187274101-187274123 GGGTCATTAAATTCTGTCTAGGG + Intergenic
990254396 5:53950949-53950971 GGGTCAGCAAACTTGGCCTGAGG + Intronic
997257012 5:132436810-132436832 GTGTTATCAAACTGTGCCTTTGG + Intronic
1003697306 6:8422550-8422572 GGGTTATCAAACACTTCCTTGGG - Exonic
1006669142 6:35718879-35718901 GGGGCCCTAAACTCTGCCTCTGG + Intronic
1009506464 6:64486746-64486768 GGGTCATCTAATTCAGCCTGTGG + Intronic
1012820648 6:104081720-104081742 GGGTCCTCAAACTCATCCTGTGG + Intergenic
1014670570 6:124299999-124300021 GGGTCACCCAACTCTGCCTCTGG - Intronic
1016592424 6:145761454-145761476 AGGTTATCAAACTCTGCCCATGG + Intergenic
1017900581 6:158715665-158715687 GGGTTTTCTATCTCTGCCTCTGG - Intronic
1020814748 7:12891587-12891609 GGGTAAACAAACTCTCCCTTGGG - Intergenic
1022385367 7:29893777-29893799 CAGTCAGCAAACCCTGCCTCAGG - Intronic
1024696788 7:51866302-51866324 GGGTCAGCAAACTACGGCTCAGG - Intergenic
1026214980 7:68340524-68340546 GGGTCTTCAAACTATGGCTTGGG + Intergenic
1028753675 7:94410561-94410583 GGGGTATCATAATCTGCCTCTGG - Intronic
1038282986 8:26182437-26182459 TGGTCATTAAACTCTGTCTTAGG + Intergenic
1038657658 8:29468896-29468918 GGGTCATCGAGCTCTGACTATGG - Intergenic
1041805134 8:61841428-61841450 GGAGCATCAAGCTCAGCCTCAGG + Intergenic
1044826886 8:96207349-96207371 GGAACATAAACCTCTGCCTCTGG - Intergenic
1050151650 9:2623202-2623224 GGGTCCCCAGACTCTGCCGCGGG + Intronic
1051335127 9:16059106-16059128 GGCTCATCAGACACTGTCTCGGG - Intronic
1051822759 9:21187326-21187348 TGGCCATCAAACTCCTCCTCGGG + Exonic
1051824309 9:21201960-21201982 TGGCCATCAAACTCCTCCTCTGG + Exonic
1053054873 9:34988354-34988376 GGGTGTCCAAACTCTGTCTCTGG + Intergenic
1055170301 9:73249362-73249384 GGGTCATCAAACTATGACTGTGG - Intergenic
1056022353 9:82452812-82452834 GGGTCAGCAAACTGAGGCTCAGG + Intergenic
1057256525 9:93553112-93553134 GGGTCATCAATCACTGTCACAGG - Intronic
1059579311 9:115526729-115526751 GAAACAGCAAACTCTGCCTCAGG - Intergenic
1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG + Intronic
1060518726 9:124281973-124281995 GAGGCATCAAAGTCTGCCCCGGG - Intronic
1187165613 X:16801468-16801490 GGGTCACCGAGCTCGGCCTCAGG + Intronic
1187978893 X:24733607-24733629 GGGTCATCAAATACTTCCACTGG - Intronic
1188554135 X:31392531-31392553 GGGTCTTCTAATTCTGCATCTGG + Intronic
1190481155 X:50878202-50878224 GGGGCATCAAACTCAGCATGAGG + Intergenic
1192158024 X:68761114-68761136 GGCCCTTCAAAGTCTGCCTCAGG + Intergenic
1195672605 X:107482468-107482490 GGGTCACCAGATTCTGCCTTGGG + Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1201525238 Y:14925797-14925819 GAGGCTTCAAACTATGCCTCTGG - Intergenic