ID: 1119178008

View in Genome Browser
Species Human (GRCh38)
Location 14:72583780-72583802
Sequence CCAAACTGGCACCATATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178008_1119178012 -10 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178012 14:72583793-72583815 GCCAGTTTGGATCTGACTCCTGG No data
1119178008_1119178016 20 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178016 14:72583823-72583845 TCTGGAAGCCCACTCAGCCATGG No data
1119178008_1119178014 2 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data
1119178008_1119178017 23 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178008 Original CRISPR CCAAACTGGCACCATATGGG TGG (reversed) Intergenic
No off target data available for this crispr