ID: 1119178010

View in Genome Browser
Species Human (GRCh38)
Location 14:72583783-72583805
Sequence GATCCAAACTGGCACCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178010_1119178017 20 Left 1119178010 14:72583783-72583805 CCCATATGGTGCCAGTTTGGATC No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178010_1119178014 -1 Left 1119178010 14:72583783-72583805 CCCATATGGTGCCAGTTTGGATC No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data
1119178010_1119178016 17 Left 1119178010 14:72583783-72583805 CCCATATGGTGCCAGTTTGGATC No data
Right 1119178016 14:72583823-72583845 TCTGGAAGCCCACTCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178010 Original CRISPR GATCCAAACTGGCACCATAT GGG (reversed) Intergenic
No off target data available for this crispr