ID: 1119178011

View in Genome Browser
Species Human (GRCh38)
Location 14:72583784-72583806
Sequence AGATCCAAACTGGCACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178011_1119178014 -2 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data
1119178011_1119178020 30 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG No data
1119178011_1119178017 19 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178011_1119178016 16 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178016 14:72583823-72583845 TCTGGAAGCCCACTCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178011 Original CRISPR AGATCCAAACTGGCACCATA TGG (reversed) Intergenic
No off target data available for this crispr