ID: 1119178014

View in Genome Browser
Species Human (GRCh38)
Location 14:72583805-72583827
Sequence CTGACTCCTGGAAAAAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178010_1119178014 -1 Left 1119178010 14:72583783-72583805 CCCATATGGTGCCAGTTTGGATC No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data
1119178011_1119178014 -2 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data
1119178008_1119178014 2 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178014 14:72583805-72583827 CTGACTCCTGGAAAAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178014 Original CRISPR CTGACTCCTGGAAAAAATTC TGG Intergenic
No off target data available for this crispr