ID: 1119178015

View in Genome Browser
Species Human (GRCh38)
Location 14:72583811-72583833
Sequence GGGCTTCCAGAATTTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178015_1119178022 16 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178022 14:72583850-72583872 CACCCGCCGGCTTCCTGCACTGG No data
1119178015_1119178023 17 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178023 14:72583851-72583873 ACCCGCCGGCTTCCTGCACTGGG No data
1119178015_1119178020 3 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG No data
1119178015_1119178017 -8 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178015 Original CRISPR GGGCTTCCAGAATTTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr