ID: 1119178017

View in Genome Browser
Species Human (GRCh38)
Location 14:72583826-72583848
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178013_1119178017 9 Left 1119178013 14:72583794-72583816 CCAGTTTGGATCTGACTCCTGGA No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178010_1119178017 20 Left 1119178010 14:72583783-72583805 CCCATATGGTGCCAGTTTGGATC No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178008_1119178017 23 Left 1119178008 14:72583780-72583802 CCACCCATATGGTGCCAGTTTGG No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178011_1119178017 19 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data
1119178015_1119178017 -8 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178017 14:72583826-72583848 GGAAGCCCACTCAGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178017 Original CRISPR GGAAGCCCACTCAGCCATGG AGG Intergenic