ID: 1119178020

View in Genome Browser
Species Human (GRCh38)
Location 14:72583837-72583859
Sequence CAGCCATGGAGGACACCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178015_1119178020 3 Left 1119178015 14:72583811-72583833 CCTGGAAAAAATTCTGGAAGCCC No data
Right 1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG No data
1119178011_1119178020 30 Left 1119178011 14:72583784-72583806 CCATATGGTGCCAGTTTGGATCT No data
Right 1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG No data
1119178013_1119178020 20 Left 1119178013 14:72583794-72583816 CCAGTTTGGATCTGACTCCTGGA No data
Right 1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178020 Original CRISPR CAGCCATGGAGGACACCCGC CGG Intergenic
No off target data available for this crispr