ID: 1119178647

View in Genome Browser
Species Human (GRCh38)
Location 14:72588573-72588595
Sequence CTCATTACTCAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119178647_1119178654 10 Left 1119178647 14:72588573-72588595 CCTTCCCCCTTCTGAGTAATGAG No data
Right 1119178654 14:72588606-72588628 GTCTGGCAATTCTTTTGTTGAGG No data
1119178647_1119178655 30 Left 1119178647 14:72588573-72588595 CCTTCCCCCTTCTGAGTAATGAG No data
Right 1119178655 14:72588626-72588648 AGGTTGCTATCAAAACTTGCTGG No data
1119178647_1119178653 -7 Left 1119178647 14:72588573-72588595 CCTTCCCCCTTCTGAGTAATGAG No data
Right 1119178653 14:72588589-72588611 TAATGAGCATTATTTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119178647 Original CRISPR CTCATTACTCAGAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr